![]() |
|||||||
|
Fusion Protein:TSFM-HMGA2 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: TSFM-HMGA2 | FusionPDB ID: 94553 | FusionGDB2.0 ID: 94553 | Hgene | Tgene | Gene symbol | TSFM | HMGA2 | Gene ID | 10102 | 8091 |
Gene name | Ts translation elongation factor, mitochondrial | high mobility group AT-hook 2 | |
Synonyms | EFTS|EFTSMT | BABL|HMGI-C|HMGIC|LIPO|STQTL9 | |
Cytomap | 12q14.1 | 12q14.3 | |
Type of gene | protein-coding | protein-coding | |
Description | elongation factor Ts, mitochondrialEF-TsEF-TsMtmitochondrial elongation factor Ts | high mobility group protein HMGI-CHMGA2/KRT121P fusionhigh-mobility group (nonhistone chromosomal) protein isoform I-C | |
Modification date | 20200313 | 20200329 | |
UniProtAcc | . | P52926 Main function of 5'-partner protein: FUNCTION: Functions as a transcriptional regulator. Functions in cell cycle regulation through CCNA2. Plays an important role in chromosome condensation during the meiotic G2/M transition of spermatocytes. Plays a role in postnatal myogenesis, is involved in satellite cell activation (By similarity). Positively regulates IGF2 expression through PLAG1 and in a PLAG1-independent manner (PubMed:28796236). {ECO:0000250|UniProtKB:P52927, ECO:0000269|PubMed:14645522, ECO:0000269|PubMed:28796236}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000497617, ENST00000323833, ENST00000350762, ENST00000454289, ENST00000540550, ENST00000543727, ENST00000548851, ENST00000550559, | ENST00000393577, ENST00000403681, ENST00000541363, ENST00000354636, ENST00000393578, ENST00000425208, ENST00000536545, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 26 X 8 X 7=1456 | 16 X 12 X 5=960 |
# samples | 30 | 15 | |
** MAII score | log2(30/1456*10)=-2.27897594970282 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(15/960*10)=-2.67807190511264 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: TSFM [Title/Abstract] AND HMGA2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: TSFM [Title/Abstract] AND HMGA2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | TSFM(58180074)-HMGA2(66345163), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | TSFM-HMGA2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TSFM-HMGA2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TSFM-HMGA2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TSFM-HMGA2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TSFM-HMGA2 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. TSFM-HMGA2 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. TSFM-HMGA2 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | TSFM | GO:0070129 | regulation of mitochondrial translation | 27677415 |
Tgene | HMGA2 | GO:0000122 | negative regulation of transcription by RNA polymerase II | 14627817 |
Tgene | HMGA2 | GO:0002062 | chondrocyte differentiation | 21484705 |
Tgene | HMGA2 | GO:0006284 | base-excision repair | 19465398 |
Tgene | HMGA2 | GO:0007095 | mitotic G2 DNA damage checkpoint | 16061642 |
Tgene | HMGA2 | GO:0010564 | regulation of cell cycle process | 14645522 |
Tgene | HMGA2 | GO:0010628 | positive regulation of gene expression | 18832382 |
Tgene | HMGA2 | GO:0031052 | chromosome breakage | 19549901 |
Tgene | HMGA2 | GO:0031507 | heterochromatin assembly | 16901784 |
Tgene | HMGA2 | GO:0035978 | histone H2A-S139 phosphorylation | 16061642 |
Tgene | HMGA2 | GO:0035986 | senescence-associated heterochromatin focus assembly | 16901784 |
Tgene | HMGA2 | GO:0035988 | chondrocyte proliferation | 21484705 |
Tgene | HMGA2 | GO:0042769 | DNA damage response, detection of DNA damage | 19465398 |
Tgene | HMGA2 | GO:0043065 | positive regulation of apoptotic process | 16061642 |
Tgene | HMGA2 | GO:0043066 | negative regulation of apoptotic process | 19465398 |
Tgene | HMGA2 | GO:0043392 | negative regulation of DNA binding | 14645522 |
Tgene | HMGA2 | GO:0043922 | negative regulation by host of viral transcription | 17005673 |
Tgene | HMGA2 | GO:0045869 | negative regulation of single stranded viral RNA replication via double stranded DNA intermediate | 17005673 |
Tgene | HMGA2 | GO:0045892 | negative regulation of transcription, DNA-templated | 18832382 |
Tgene | HMGA2 | GO:0045893 | positive regulation of transcription, DNA-templated | 15225648|15755872|17005673|17324944|17426251 |
Tgene | HMGA2 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 14645522|18832382 |
Tgene | HMGA2 | GO:0071158 | positive regulation of cell cycle arrest | 16061642 |
Tgene | HMGA2 | GO:0071902 | positive regulation of protein serine/threonine kinase activity | 19549901 |
Tgene | HMGA2 | GO:0090402 | oncogene-induced cell senescence | 16901784 |
Tgene | HMGA2 | GO:2000648 | positive regulation of stem cell proliferation | 21484705 |
Tgene | HMGA2 | GO:2000679 | positive regulation of transcription regulatory region DNA binding | 18832382 |
Tgene | HMGA2 | GO:2000685 | positive regulation of cellular response to X-ray | 16061642 |
Tgene | HMGA2 | GO:2001022 | positive regulation of response to DNA damage stimulus | 16061642|19465398 |
Tgene | HMGA2 | GO:2001033 | negative regulation of double-strand break repair via nonhomologous end joining | 19549901 |
Tgene | HMGA2 | GO:2001038 | regulation of cellular response to drug | 16061642 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr12:58180074/chr12:66345163) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000543727 | TSFM | chr12 | 58180074 | + | ENST00000403681 | HMGA2 | chr12 | 66345163 | + | 3501 | 417 | 6 | 497 | 163 |
ENST00000543727 | TSFM | chr12 | 58180074 | + | ENST00000393577 | HMGA2 | chr12 | 66345163 | + | 631 | 417 | 6 | 524 | 172 |
ENST00000550559 | TSFM | chr12 | 58180074 | + | ENST00000403681 | HMGA2 | chr12 | 66345163 | + | 3459 | 375 | 15 | 455 | 146 |
ENST00000550559 | TSFM | chr12 | 58180074 | + | ENST00000393577 | HMGA2 | chr12 | 66345163 | + | 589 | 375 | 15 | 482 | 155 |
ENST00000548851 | TSFM | chr12 | 58180074 | + | ENST00000403681 | HMGA2 | chr12 | 66345163 | + | 3459 | 375 | 15 | 455 | 146 |
ENST00000548851 | TSFM | chr12 | 58180074 | + | ENST00000393577 | HMGA2 | chr12 | 66345163 | + | 589 | 375 | 15 | 482 | 155 |
ENST00000454289 | TSFM | chr12 | 58180074 | + | ENST00000403681 | HMGA2 | chr12 | 66345163 | + | 3657 | 573 | 42 | 653 | 203 |
ENST00000454289 | TSFM | chr12 | 58180074 | + | ENST00000393577 | HMGA2 | chr12 | 66345163 | + | 787 | 573 | 42 | 680 | 212 |
ENST00000540550 | TSFM | chr12 | 58180074 | + | ENST00000403681 | HMGA2 | chr12 | 66345163 | + | 3501 | 417 | 6 | 497 | 163 |
ENST00000540550 | TSFM | chr12 | 58180074 | + | ENST00000393577 | HMGA2 | chr12 | 66345163 | + | 631 | 417 | 6 | 524 | 172 |
ENST00000323833 | TSFM | chr12 | 58180074 | + | ENST00000403681 | HMGA2 | chr12 | 66345163 | + | 3470 | 386 | 26 | 466 | 146 |
ENST00000323833 | TSFM | chr12 | 58180074 | + | ENST00000393577 | HMGA2 | chr12 | 66345163 | + | 600 | 386 | 26 | 493 | 155 |
ENST00000350762 | TSFM | chr12 | 58180074 | + | ENST00000403681 | HMGA2 | chr12 | 66345163 | + | 3733 | 649 | 409 | 729 | 106 |
ENST00000350762 | TSFM | chr12 | 58180074 | + | ENST00000393577 | HMGA2 | chr12 | 66345163 | + | 863 | 649 | 409 | 756 | 115 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000543727 | ENST00000403681 | TSFM | chr12 | 58180074 | + | HMGA2 | chr12 | 66345163 | + | 0.005733472 | 0.99426657 |
ENST00000543727 | ENST00000393577 | TSFM | chr12 | 58180074 | + | HMGA2 | chr12 | 66345163 | + | 0.027045429 | 0.9729546 |
ENST00000550559 | ENST00000403681 | TSFM | chr12 | 58180074 | + | HMGA2 | chr12 | 66345163 | + | 0.00585893 | 0.99414104 |
ENST00000550559 | ENST00000393577 | TSFM | chr12 | 58180074 | + | HMGA2 | chr12 | 66345163 | + | 0.019325556 | 0.98067445 |
ENST00000548851 | ENST00000403681 | TSFM | chr12 | 58180074 | + | HMGA2 | chr12 | 66345163 | + | 0.00585893 | 0.99414104 |
ENST00000548851 | ENST00000393577 | TSFM | chr12 | 58180074 | + | HMGA2 | chr12 | 66345163 | + | 0.019325556 | 0.98067445 |
ENST00000454289 | ENST00000403681 | TSFM | chr12 | 58180074 | + | HMGA2 | chr12 | 66345163 | + | 0.069384895 | 0.93061507 |
ENST00000454289 | ENST00000393577 | TSFM | chr12 | 58180074 | + | HMGA2 | chr12 | 66345163 | + | 0.20960799 | 0.790392 |
ENST00000540550 | ENST00000403681 | TSFM | chr12 | 58180074 | + | HMGA2 | chr12 | 66345163 | + | 0.005733472 | 0.99426657 |
ENST00000540550 | ENST00000393577 | TSFM | chr12 | 58180074 | + | HMGA2 | chr12 | 66345163 | + | 0.027045429 | 0.9729546 |
ENST00000323833 | ENST00000403681 | TSFM | chr12 | 58180074 | + | HMGA2 | chr12 | 66345163 | + | 0.005839227 | 0.9941607 |
ENST00000323833 | ENST00000393577 | TSFM | chr12 | 58180074 | + | HMGA2 | chr12 | 66345163 | + | 0.02162355 | 0.9783764 |
ENST00000350762 | ENST00000403681 | TSFM | chr12 | 58180074 | + | HMGA2 | chr12 | 66345163 | + | 0.020668495 | 0.9793315 |
ENST00000350762 | ENST00000393577 | TSFM | chr12 | 58180074 | + | HMGA2 | chr12 | 66345163 | + | 0.021513255 | 0.9784868 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for TSFM-HMGA2 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
TSFM | chr12 | 58180074 | HMGA2 | chr12 | 66345163 | 375 | 120 | GLLQEGNTTVLVEPQQVVQKKPAQEE |
TSFM | chr12 | 58180074 | HMGA2 | chr12 | 66345163 | 375 | 120 | GLLQEGNTTVLVEPQQVVQKKPAQVN |
TSFM | chr12 | 58180074 | HMGA2 | chr12 | 66345163 | 386 | 120 | GLLQEGNTTVLVEPQQVVQKKPAQEE |
TSFM | chr12 | 58180074 | HMGA2 | chr12 | 66345163 | 386 | 120 | GLLQEGNTTVLVEPQQVVQKKPAQVN |
TSFM | chr12 | 58180074 | HMGA2 | chr12 | 66345163 | 417 | 137 | GLLQEGNTTVLVEPQQVVQKKPAQEE |
TSFM | chr12 | 58180074 | HMGA2 | chr12 | 66345163 | 417 | 137 | GLLQEGNTTVLVEPQQVVQKKPAQVN |
TSFM | chr12 | 58180074 | HMGA2 | chr12 | 66345163 | 573 | 177 | GLLQEGNTTVLVEPQQVVQKKPAQEE |
TSFM | chr12 | 58180074 | HMGA2 | chr12 | 66345163 | 573 | 177 | GLLQEGNTTVLVEPQQVVQKKPAQVN |
Top |
Potential FusionNeoAntigen Information of TSFM-HMGA2 in HLA I |
![]() |
TSFM-HMGA2_58180074_66345163.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-A02:13 | VLVEPQQVV | 0.9883 | 0.6156 | 9 | 18 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-A02:21 | VLVEPQQVV | 0.9868 | 0.5349 | 9 | 18 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-A02:04 | VLVEPQQVV | 0.9554 | 0.604 | 9 | 18 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-A02:38 | VLVEPQQVV | 0.9407 | 0.5394 | 9 | 18 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-A02:17 | VLVEPQQVV | 0.8965 | 0.6723 | 9 | 18 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-A02:21 | TVLVEPQQV | 0.8096 | 0.515 | 8 | 17 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-B13:02 | VLVEPQQVV | 0.1718 | 0.8615 | 9 | 18 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-B52:01 | VLVEPQQVV | 0.1257 | 0.9773 | 9 | 18 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-C04:06 | VLVEPQQVV | 0.9027 | 0.9438 | 9 | 18 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-A02:03 | VLVEPQQVV | 0.995 | 0.5139 | 9 | 18 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-A02:14 | VLVEPQQVV | 0.9871 | 0.503 | 9 | 18 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-A02:06 | VLVEPQQVV | 0.9868 | 0.5349 | 9 | 18 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-A69:01 | TVLVEPQQV | 0.9553 | 0.6119 | 8 | 17 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-A02:06 | TVLVEPQQV | 0.8096 | 0.515 | 8 | 17 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-B15:73 | VLVEPQQVV | 0.7012 | 0.9291 | 9 | 18 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-B15:30 | VLVEPQQVV | 0.617 | 0.9057 | 9 | 18 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-C17:01 | VLVEPQQVV | 0.3423 | 0.9607 | 9 | 18 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | HLA-A69:01 | TVLVEPQQVV | 0.8184 | 0.6018 | 8 | 18 |
Top |
Potential FusionNeoAntigen Information of TSFM-HMGA2 in HLA II |
![]() |
TSFM-HMGA2_58180074_66345163.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | DRB1-0806 | VEPQQVVQKKPAQEE | 11 | 26 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | DRB1-0810 | VEPQQVVQKKPAQEE | 11 | 26 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | DRB1-0812 | VEPQQVVQKKPAQEE | 11 | 26 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | DRB1-0822 | VEPQQVVQKKPAQEE | 11 | 26 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | DRB1-1220 | NTTVLVEPQQVVQKK | 6 | 21 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | DRB1-1220 | NTTVLVEPQQVVQKK | 6 | 21 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | DRB1-1221 | NTTVLVEPQQVVQKK | 6 | 21 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | DRB1-1221 | NTTVLVEPQQVVQKK | 6 | 21 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | DRB1-1412 | VEPQQVVQKKPAQVN | 11 | 26 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | DRB1-1476 | NTTVLVEPQQVVQKK | 6 | 21 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | DRB1-1476 | NTTVLVEPQQVVQKK | 6 | 21 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | DRB1-1478 | VEPQQVVQKKPAQEE | 11 | 26 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | DRB1-1479 | NTTVLVEPQQVVQKK | 6 | 21 |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 | DRB1-1479 | NTTVLVEPQQVVQKK | 6 | 21 |
Top |
Fusion breakpoint peptide structures of TSFM-HMGA2 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
6424 | NTTVLVEPQQVVQK | TSFM | HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 386 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TSFM-HMGA2 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 6424 | NTTVLVEPQQVVQK | -5.49573 | -5.60913 |
HLA-B14:02 | 3BVN | 6424 | NTTVLVEPQQVVQK | -4.86535 | -5.90065 |
HLA-B52:01 | 3W39 | 6424 | NTTVLVEPQQVVQK | -4.93905 | -5.97435 |
HLA-B52:01 | 3W39 | 6424 | NTTVLVEPQQVVQK | -4.40273 | -4.51613 |
HLA-A11:01 | 4UQ2 | 6424 | NTTVLVEPQQVVQK | -8.42149 | -9.45679 |
HLA-A24:02 | 5HGA | 6424 | NTTVLVEPQQVVQK | -8.4573 | -8.5707 |
HLA-A24:02 | 5HGA | 6424 | NTTVLVEPQQVVQK | -6.08477 | -7.12007 |
HLA-B44:05 | 3DX8 | 6424 | NTTVLVEPQQVVQK | -3.99808 | -4.11148 |
HLA-B44:05 | 3DX8 | 6424 | NTTVLVEPQQVVQK | -3.42377 | -4.45907 |
Top |
Vaccine Design for the FusionNeoAntigens of TSFM-HMGA2 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 8 | 17 | TVLVEPQQV | ACTGTATTAGTAGAGCCACAACAAGTT |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 8 | 18 | TVLVEPQQVV | ACTGTATTAGTAGAGCCACAACAAGTTGTT |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 9 | 18 | VLVEPQQVV | GTATTAGTAGAGCCACAACAAGTTGTT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 11 | 26 | VEPQQVVQKKPAQEE | GTAGAGCCACAACAAGTTGTTCAGAAGAAGCCTGCTCAGGAGGAA |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 11 | 26 | VEPQQVVQKKPAQVN | GTAGAGCCACAACAAGTTGTTCAGAAGAAGCCTGCTCAGGTCAAT |
TSFM-HMGA2 | chr12 | 58180074 | chr12 | 66345163 | 6 | 21 | NTTVLVEPQQVVQKK | AACACAACTGTATTAGTAGAGCCACAACAAGTTGTTCAGAAGAAG |
Top |
Information of the samples that have these potential fusion neoantigens of TSFM-HMGA2 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
SKCM | TSFM-HMGA2 | chr12 | 58180074 | ENST00000323833 | chr12 | 66345163 | ENST00000403681 | TCGA-GN-A26D-06A |
Top |
Potential target of CAR-T therapy development for TSFM-HMGA2 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to TSFM-HMGA2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to TSFM-HMGA2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Tgene | HMGA2 | C1519176 | Salivary Gland Pleomorphic Adenoma | 2 | ORPHANET |
Tgene | HMGA2 | C0005612 | Birth Weight | 1 | CTD_human |
Tgene | HMGA2 | C0006826 | Malignant Neoplasms | 1 | CTD_human |
Tgene | HMGA2 | C0027626 | Neoplasm Invasiveness | 1 | CTD_human |
Tgene | HMGA2 | C0027651 | Neoplasms | 1 | CTD_human |
Tgene | HMGA2 | C0086692 | Benign Neoplasm | 1 | CTD_human |
Tgene | HMGA2 | C0175693 | Russell-Silver syndrome | 1 | GENOMICS_ENGLAND |
Tgene | HMGA2 | C0473935 | Radiolabeled somatostatin analog study | 1 | GENOMICS_ENGLAND |
Tgene | HMGA2 | C0796160 | MENTAL RETARDATION, X-LINKED, SNYDER-ROBINSON TYPE | 1 | GENOMICS_ENGLAND |
Tgene | HMGA2 | C1096309 | Myolipoma | 1 | GENOMICS_ENGLAND |
Tgene | HMGA2 | C4305140 | 12q14 microdeletion syndrome | 1 | ORPHANET |