Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TYK2-CIB3

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TYK2-CIB3
	FusionPDB ID: 95650
	FusionGDB2.0 ID: 95650
		Hgene	Tgene
	Gene symbol	TYK2	CIB3
	Gene ID	7297	117286
	Gene name	tyrosine kinase 2	calcium and integrin binding family member 3
	Synonyms	IMD35\|JTK1	KIP3
	Cytomap	19p13.2	19p13.11
	Type of gene	protein-coding	protein-coding
	Description	non-receptor tyrosine-protein kinase TYK2	calcium and integrin-binding family member 3DNA-dependent protein kinase catalytic subunit-interacting protein 3
	Modification date	20200329	20200313
	UniProtAcc	.	Q96Q77 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000264818, ENST00000525621, ENST00000529370, ENST00000524462, ENST00000529422,	ENST00000541493, ENST00000269878, ENST00000379859,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 11 X 8=1144	6 X 5 X 5=150
	# samples	15	9
	** MAII score	log2(15/1144*10)=-2.93105264628251 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(9/150*10)=-0.736965594166206 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: TYK2 [Title/Abstract] AND CIB3 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TYK2 [Title/Abstract] AND CIB3 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TYK2(10488890)-CIB3(16275724), # samples:2
Anticipated loss of major functional domain due to fusion event.	TYK2-CIB3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TYK2-CIB3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TYK2-CIB3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TYK2-CIB3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TYK2-CIB3 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. TYK2-CIB3 seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF. TYK2-CIB3 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:10488890/chr19:16275724)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TYK2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CIB3 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000525621	TYK2	chr19	10488890	-	ENST00000269878	CIB3	chr19	16275724	-	990	675	482	892	136
ENST00000525621	TYK2	chr19	10488890	-	ENST00000379859	CIB3	chr19	16275724	-	943	675	482	892	136
ENST00000529370	TYK2	chr19	10488890	-	ENST00000269878	CIB3	chr19	16275724	-	839	524	331	741	136
ENST00000529370	TYK2	chr19	10488890	-	ENST00000379859	CIB3	chr19	16275724	-	792	524	331	741	136

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000525621	ENST00000269878	TYK2	chr19	10488890	-	CIB3	chr19	16275724	-	0.014877766	0.9851222
ENST00000525621	ENST00000379859	TYK2	chr19	10488890	-	CIB3	chr19	16275724	-	0.012803899	0.9871961
ENST00000529370	ENST00000269878	TYK2	chr19	10488890	-	CIB3	chr19	16275724	-	0.010022806	0.9899771
ENST00000529370	ENST00000379859	TYK2	chr19	10488890	-	CIB3	chr19	16275724	-	0.00954628	0.9904537

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TYK2-CIB3

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TYK2	chr19	10488890	CIB3	chr19	16275724	524	64	TAEEVCIHIAHKVDFNNDDYICAWDL
TYK2	chr19	10488890	CIB3	chr19	16275724	675	64	TAEEVCIHIAHKVDFNNDDYICAWDL

Top

Potential FusionNeoAntigen Information of TYK2-CIB3 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TYK2-CIB3_10488890_16275724.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-B39:01	IHIAHKVDF	0.9073	0.6004	6	15
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-B38:01	IHIAHKVDF	0.8767	0.7625	6	15
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-B38:02	IHIAHKVDF	0.8578	0.795	6	15
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-B39:12	IHIAHKVDF	0.932	0.6139	6	15
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-B39:05	IHIAHKVDF	0.8108	0.5856	6	15
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-C07:29	IHIAHKVDF	0.7198	0.8101	6	15
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-C07:13	IHIAHKVDF	0.6567	0.7262	6	15
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-C07:67	IHIAHKVDF	0.6057	0.7895	6	15
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-C07:80	IHIAHKVDF	0.6057	0.7895	6	15
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-C07:10	IHIAHKVDF	0.546	0.8345	6	15
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-C07:46	IHIAHKVDF	0.5245	0.6086	6	15
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-B39:31	IHIAHKVDF	0.9065	0.6052	6	15
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-B38:05	IHIAHKVDF	0.8767	0.7625	6	15
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-C07:17	IHIAHKVDF	0.6602	0.9254	6	15
TYK2-CIB3	chr19	10488890	chr19	16275724	675	HLA-C07:02	IHIAHKVDF	0.6057	0.7895	6	15

Top

Potential FusionNeoAntigen Information of TYK2-CIB3 in HLA II

TYK2-CIB3_10488890_16275724.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1113	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1113	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1117	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1134	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1152	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1331	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1343	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1344	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1354	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1377	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1377	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1401	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1401	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1404	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1404	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1405	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1407	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1408	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1411	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1411	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1416	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1417	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1418	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1423	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1426	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1426	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1428	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1428	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1428	AEEVCIHIAHKVDFN	1	16
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1431	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1431	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1432	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1432	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1433	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1434	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1435	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1435	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1438	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1438	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1439	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1443	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1445	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1450	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1450	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1454	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1454	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1455	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1455	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1456	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1458	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1458	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1459	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1460	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1460	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1461	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1461	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1462	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1462	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1464	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1464	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1465	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1465	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1468	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1470	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1470	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1471	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1471	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1472	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1472	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1475	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1475	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1481	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1482	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1482	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1486	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1486	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1487	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1487	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1488	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1488	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1490	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1490	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1491	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1495	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1495	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1496	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1497	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1497	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1499	EVCIHIAHKVDFNND	3	18
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1499	EEVCIHIAHKVDFNN	2	17
TYK2-CIB3	chr19	10488890	chr19	16275724	675	DRB1-1510	AEEVCIHIAHKVDFN	1	16

Top

Fusion breakpoint peptide structures of TYK2-CIB3

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3711	IHIAHKVDFNNDDY	TYK2	CIB3	chr19	10488890	chr19	16275724	675

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TYK2-CIB3

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3711	IHIAHKVDFNNDDY	-7.9962	-8.1096
HLA-B14:02	3BVN	3711	IHIAHKVDFNNDDY	-5.70842	-6.74372
HLA-B52:01	3W39	3711	IHIAHKVDFNNDDY	-6.83737	-6.95077
HLA-B52:01	3W39	3711	IHIAHKVDFNNDDY	-4.4836	-5.5189
HLA-A11:01	4UQ2	3711	IHIAHKVDFNNDDY	-10.0067	-10.1201
HLA-A11:01	4UQ2	3711	IHIAHKVDFNNDDY	-9.03915	-10.0745
HLA-A24:02	5HGA	3711	IHIAHKVDFNNDDY	-6.56204	-6.67544
HLA-A24:02	5HGA	3711	IHIAHKVDFNNDDY	-5.42271	-6.45801
HLA-B44:05	3DX8	3711	IHIAHKVDFNNDDY	-7.85648	-8.89178
HLA-B44:05	3DX8	3711	IHIAHKVDFNNDDY	-5.3978	-5.5112
HLA-A02:01	6TDR	3711	IHIAHKVDFNNDDY	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of TYK2-CIB3

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TYK2-CIB3	chr19	10488890	chr19	16275724	6	15	IHIAHKVDF	TCCACATTGCACATAAAGTTGATTTTA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TYK2-CIB3	chr19	10488890	chr19	16275724	1	16	AEEVCIHIAHKVDFN	CTGAGGAAGTCTGCATCCACATTGCACATAAAGTTGATTTTAACA
TYK2-CIB3	chr19	10488890	chr19	16275724	2	17	EEVCIHIAHKVDFNN	AGGAAGTCTGCATCCACATTGCACATAAAGTTGATTTTAACAACG
TYK2-CIB3	chr19	10488890	chr19	16275724	3	18	EVCIHIAHKVDFNND	AAGTCTGCATCCACATTGCACATAAAGTTGATTTTAACAACGACG

Top

Information of the samples that have these potential fusion neoantigens of TYK2-CIB3

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SARC	TYK2-CIB3	chr19	10488890	ENST00000525621	chr19	16275724	ENST00000269878	TCGA-DX-A3LY-01B

Top

Potential target of CAR-T therapy development for TYK2-CIB3

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TYK2-CIB3

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TYK2-CIB3

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)