![]() |
|||||||
|
Fusion Protein:UBE2D2-HINT1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: UBE2D2-HINT1 | FusionPDB ID: 96014 | FusionGDB2.0 ID: 96014 | Hgene | Tgene | Gene symbol | UBE2D2 | HINT1 | Gene ID | 7322 | 3094 |
Gene name | ubiquitin conjugating enzyme E2 D2 | histidine triad nucleotide binding protein 1 | |
Synonyms | E2(17)KB2|PUBC1|UBC4|UBC4/5|UBCH4|UBCH5B | HINT|NMAN|PKCI-1|PRKCNH1 | |
Cytomap | 5q31.2 | 5q23.3 | |
Type of gene | protein-coding | protein-coding | |
Description | ubiquitin-conjugating enzyme E2 D2(E3-independent) E2 ubiquitin-conjugating enzyme D2E2 ubiquitin-conjugating enzyme D2p53-regulated ubiquitin-conjugating enzyme 1ubiquitin carrier protein D2ubiquitin conjugating enzyme E2D 2ubiquitin-conjugating en | histidine triad nucleotide-binding protein 1adenosine 5'-monophosphoramidaseepididymis secretory sperm binding proteinprotein kinase C inhibitor 1protein kinase C-interacting protein 1 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | . | P49773 Main function of 5'-partner protein: FUNCTION: Hydrolyzes purine nucleotide phosphoramidates with a single phosphate group, including adenosine 5'monophosphoramidate (AMP-NH2), adenosine 5'monophosphomorpholidate (AMP-morpholidate) and guanosine 5'monophosphomorpholidate (GMP-morpholidate). Hydrolyzes lysyl-AMP (AMP-N-epsilon-(N-alpha-acetyl lysine methyl ester)) generated by lysine tRNA ligase, as well as Met-AMP, His-AMP and Asp-AMP, lysyl-GMP (GMP-N-epsilon-(N-alpha-acetyl lysine methyl ester)) and AMP-N-alanine methyl ester. Can also convert adenosine 5'-O-phosphorothioate and guanosine 5'-O-phosphorothioate to the corresponding nucleoside 5'-O-phosphates with concomitant release of hydrogen sulfide. In addition, functions as scaffolding protein that modulates transcriptional activation by the LEF1/TCF1-CTNNB1 complex and by the complex formed with MITF and CTNNB1. Modulates p53/TP53 levels and p53/TP53-mediated apoptosis. Modulates proteasomal degradation of target proteins by the SCF (SKP2-CUL1-F-box protein) E3 ubiquitin-protein ligase complex. {ECO:0000269|PubMed:15703176, ECO:0000269|PubMed:16014379, ECO:0000269|PubMed:16835243, ECO:0000269|PubMed:19112177, ECO:0000269|PubMed:22329685, ECO:0000269|PubMed:22647378, ECO:0000269|PubMed:9323207}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000253815, ENST00000398733, ENST00000505548, ENST00000511725, | ENST00000506207, ENST00000506908, ENST00000508488, ENST00000513012, ENST00000304043, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 18 X 9 X 11=1782 | 8 X 9 X 6=432 |
# samples | 23 | 10 | |
** MAII score | log2(23/1782*10)=-2.95379157057755 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(10/432*10)=-2.11103131238874 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: UBE2D2 [Title/Abstract] AND HINT1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: UBE2D2 [Title/Abstract] AND HINT1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | UBE2D2(138994202)-HINT1(130495304), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | UBE2D2-HINT1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. UBE2D2-HINT1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. UBE2D2-HINT1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. UBE2D2-HINT1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | UBE2D2 | GO:0000209 | protein polyubiquitination | 15247280 |
Hgene | UBE2D2 | GO:0016567 | protein ubiquitination | 9990509|14593114 |
Hgene | UBE2D2 | GO:0051865 | protein autoubiquitination | 21068390 |
Hgene | UBE2D2 | GO:0070936 | protein K48-linked ubiquitination | 20061386 |
Tgene | HINT1 | GO:0009154 | purine ribonucleotide catabolic process | 16835243 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr5:138994202/chr5:130495304) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000511725 | UBE2D2 | chr5 | 138994202 | + | ENST00000304043 | HINT1 | chr5 | 130495304 | - | 863 | 278 | 306 | 1 | 102 |
ENST00000253815 | UBE2D2 | chr5 | 138994202 | + | ENST00000304043 | HINT1 | chr5 | 130495304 | - | 1495 | 910 | 439 | 1074 | 211 |
ENST00000398733 | UBE2D2 | chr5 | 138994202 | + | ENST00000304043 | HINT1 | chr5 | 130495304 | - | 1331 | 746 | 478 | 56 | 140 |
ENST00000505548 | UBE2D2 | chr5 | 138994202 | + | ENST00000304043 | HINT1 | chr5 | 130495304 | - | 1060 | 475 | 64 | 639 | 191 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000511725 | ENST00000304043 | UBE2D2 | chr5 | 138994202 | + | HINT1 | chr5 | 130495304 | - | 0.8082786 | 0.19172138 |
ENST00000253815 | ENST00000304043 | UBE2D2 | chr5 | 138994202 | + | HINT1 | chr5 | 130495304 | - | 0.5089654 | 0.49103463 |
ENST00000398733 | ENST00000304043 | UBE2D2 | chr5 | 138994202 | + | HINT1 | chr5 | 130495304 | - | 0.21419843 | 0.7858016 |
ENST00000505548 | ENST00000304043 | UBE2D2 | chr5 | 138994202 | + | HINT1 | chr5 | 130495304 | - | 0.9046853 | 0.09531466 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for UBE2D2-HINT1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
UBE2D2 | chr5 | 138994202 | HINT1 | chr5 | 130495304 | 475 | 137 | DDMFHWQATIMGPLLGHLMIVGKKCA |
UBE2D2 | chr5 | 138994202 | HINT1 | chr5 | 130495304 | 910 | 157 | DDMFHWQATIMGPLLGHLMIVGKKCA |
Top |
Potential FusionNeoAntigen Information of UBE2D2-HINT1 in HLA I |
![]() |
UBE2D2-HINT1_138994202_130495304.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-A02:04 | IMGPLLGHL | 0.9742 | 0.8371 | 9 | 18 |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-A02:17 | IMGPLLGHL | 0.9694 | 0.7296 | 9 | 18 |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-A80:01 | TIMGPLLGH | 0.5988 | 0.6165 | 8 | 17 |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-B81:01 | GPLLGHLMI | 0.0749 | 0.7146 | 11 | 20 |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-A03:25 | ATIMGPLLGH | 0.9216 | 0.5465 | 7 | 17 |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-A03:12 | ATIMGPLLGH | 0.9179 | 0.5648 | 7 | 17 |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-C01:30 | MGPLLGHLM | 0.9509 | 0.9705 | 10 | 19 |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-C01:17 | MGPLLGHLM | 0.8035 | 0.9693 | 10 | 19 |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-A03:01 | ATIMGPLLGH | 0.9216 | 0.5465 | 7 | 17 |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-C01:02 | MGPLLGHLM | 0.7898 | 0.9699 | 10 | 19 |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-B35:13 | QATIMGPLL | 0.7713 | 0.9525 | 6 | 15 |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-C01:03 | MGPLLGHLM | 0.7053 | 0.9615 | 10 | 19 |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-B59:01 | GPLLGHLMI | 0.6069 | 0.5088 | 11 | 20 |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-B55:04 | GPLLGHLMI | 0.4769 | 0.5182 | 11 | 20 |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 | HLA-A69:01 | TIMGPLLGHL | 0.8304 | 0.9035 | 8 | 18 |
Top |
Potential FusionNeoAntigen Information of UBE2D2-HINT1 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of UBE2D2-HINT1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
7159 | QATIMGPLLGHLMI | UBE2D2 | HINT1 | chr5 | 138994202 | chr5 | 130495304 | 910 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of UBE2D2-HINT1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 7159 | QATIMGPLLGHLMI | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 7159 | QATIMGPLLGHLMI | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 7159 | QATIMGPLLGHLMI | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 7159 | QATIMGPLLGHLMI | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 7159 | QATIMGPLLGHLMI | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 7159 | QATIMGPLLGHLMI | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 7159 | QATIMGPLLGHLMI | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 7159 | QATIMGPLLGHLMI | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 7159 | QATIMGPLLGHLMI | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 7159 | QATIMGPLLGHLMI | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 7159 | QATIMGPLLGHLMI | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of UBE2D2-HINT1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 10 | 19 | MGPLLGHLM | ATGGGGCCACTTCTTGGACACTTAATG |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 11 | 20 | GPLLGHLMI | GGGCCACTTCTTGGACACTTAATGATT |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 6 | 15 | QATIMGPLL | CAAGCTACAATAATGGGGCCACTTCTT |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 7 | 17 | ATIMGPLLGH | GCTACAATAATGGGGCCACTTCTTGGACAC |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 8 | 17 | TIMGPLLGH | ACAATAATGGGGCCACTTCTTGGACAC |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 8 | 18 | TIMGPLLGHL | ACAATAATGGGGCCACTTCTTGGACACTTA |
UBE2D2-HINT1 | chr5 | 138994202 | chr5 | 130495304 | 9 | 18 | IMGPLLGHL | ATAATGGGGCCACTTCTTGGACACTTA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of UBE2D2-HINT1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | UBE2D2-HINT1 | chr5 | 138994202 | ENST00000253815 | chr5 | 130495304 | ENST00000304043 | TCGA-EW-A1OV |
Top |
Potential target of CAR-T therapy development for UBE2D2-HINT1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to UBE2D2-HINT1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to UBE2D2-HINT1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |