![]() |
|||||||
|
Fusion Protein:BIRC2-YAP1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: BIRC2-YAP1 | FusionPDB ID: 9741 | FusionGDB2.0 ID: 9741 | Hgene | Tgene | Gene symbol | BIRC2 | YAP1 | Gene ID | 329 | 10413 |
Gene name | baculoviral IAP repeat containing 2 | Yes1 associated transcriptional regulator | |
Synonyms | API1|HIAP2|Hiap-2|MIHB|RNF48|c-IAP1|cIAP1 | COB1|YAP|YAP2|YAP65|YKI | |
Cytomap | 11q22.2 | 11q22.1 | |
Type of gene | protein-coding | protein-coding | |
Description | baculoviral IAP repeat-containing protein 2IAP homolog BIAP-2NFR2-TRAF signalling complex proteinRING finger protein 48RING-type E3 ubiquitin transferase BIRC2TNFR2-TRAF-signaling complex protein 2apoptosis inhibitor 1cellular inhibitor of apoptos | transcriptional coactivator YAP165 kDa Yes-associated proteinYes associated protein 1protein yorkie homologyes-associated protein 1yes-associated protein 2yes-associated protein YAP65 homologyorkie homolog | |
Modification date | 20200320 | 20200329 | |
UniProtAcc | Q13490 Main function of 5'-partner protein: FUNCTION: Multi-functional protein which regulates not only caspases and apoptosis, but also modulates inflammatory signaling and immunity, mitogenic kinase signaling, and cell proliferation, as well as cell invasion and metastasis. Acts as an E3 ubiquitin-protein ligase regulating NF-kappa-B signaling and regulates both canonical and non-canonical NF-kappa-B signaling by acting in opposite directions: acts as a positive regulator of the canonical pathway and suppresses constitutive activation of non-canonical NF-kappa-B signaling. The target proteins for its E3 ubiquitin-protein ligase activity include: RIPK1, RIPK2, RIPK3, RIPK4, CASP3, CASP7, CASP8, TRAF2, DIABLO/SMAC, MAP3K14/NIK, MAP3K5/ASK1, IKBKG/NEMO, IKBKE and MXD1/MAD1. Can also function as an E3 ubiquitin-protein ligase of the NEDD8 conjugation pathway, targeting effector caspases for neddylation and inactivation. Acts as an important regulator of innate immune signaling via regulation of Toll-like receptors (TLRs), Nodlike receptors (NLRs) and RIG-I like receptors (RLRs), collectively referred to as pattern recognition receptors (PRRs). Protects cells from spontaneous formation of the ripoptosome, a large multi-protein complex that has the capability to kill cancer cells in a caspase-dependent and caspase-independent manner. Suppresses ripoptosome formation by ubiquitinating RIPK1 and CASP8. Can stimulate the transcriptional activity of E2F1. Plays a role in the modulation of the cell cycle. {ECO:0000269|PubMed:15665297, ECO:0000269|PubMed:18082613, ECO:0000269|PubMed:21145488, ECO:0000269|PubMed:21653699, ECO:0000269|PubMed:21931591, ECO:0000269|PubMed:23453969}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000527910, ENST00000227758, ENST00000530675, ENST00000532672, | ENST00000282441, ENST00000345877, ENST00000524575, ENST00000526343, ENST00000531439, ENST00000537274, ENST00000528834, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 4 X 5 X 3=60 | 20 X 10 X 13=2600 |
# samples | 4 | 21 | |
** MAII score | log2(4/60*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(21/2600*10)=-3.63005039024969 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: BIRC2 [Title/Abstract] AND YAP1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: BIRC2 [Title/Abstract] AND YAP1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | BIRC2(102221674)-YAP1(102033187), # samples:1 YAP1(102080295)-BIRC2(102248226), # samples:1 YAP1(101985125)-BIRC2(102233626), # samples:1 YAP1(102080295)-BIRC2(102248227), # samples:1 YAP1(102080295)-BIRC2(102248410), # samples:1 YAP1(101985125)-BIRC2(102233627), # samples:1 YAP1(101985124)-BIRC2(102233626), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | BIRC2-YAP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BIRC2-YAP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BIRC2-YAP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. BIRC2-YAP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. YAP1-BIRC2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. YAP1-BIRC2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. YAP1-BIRC2 seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. YAP1-BIRC2 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. YAP1-BIRC2 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. YAP1-BIRC2 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | BIRC2 | GO:0000209 | protein polyubiquitination | 11907583 |
Hgene | BIRC2 | GO:0043066 | negative regulation of apoptotic process | 21525013 |
Hgene | BIRC2 | GO:0043161 | proteasome-mediated ubiquitin-dependent protein catabolic process | 11907583 |
Hgene | BIRC2 | GO:0051726 | regulation of cell cycle | 15665297 |
Hgene | BIRC2 | GO:1902523 | positive regulation of protein K63-linked ubiquitination | 21931591 |
Hgene | BIRC2 | GO:1902524 | positive regulation of protein K48-linked ubiquitination | 21931591 |
Hgene | BIRC2 | GO:1902527 | positive regulation of protein monoubiquitination | 21931591 |
Tgene | YAP1 | GO:0006974 | cellular response to DNA damage stimulus | 18280240 |
Tgene | YAP1 | GO:0008283 | cell proliferation | 17974916 |
Tgene | YAP1 | GO:0032570 | response to progesterone | 16772533 |
Tgene | YAP1 | GO:0033148 | positive regulation of intracellular estrogen receptor signaling pathway | 16772533 |
Tgene | YAP1 | GO:0045893 | positive regulation of transcription, DNA-templated | 20368466 |
Tgene | YAP1 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 25796446 |
Tgene | YAP1 | GO:0050767 | regulation of neurogenesis | 25433207 |
Tgene | YAP1 | GO:0050847 | progesterone receptor signaling pathway | 16772533 |
Tgene | YAP1 | GO:0060242 | contact inhibition | 17974916 |
Tgene | YAP1 | GO:0065003 | protein-containing complex assembly | 20368466 |
Tgene | YAP1 | GO:0071480 | cellular response to gamma radiation | 18280240 |
Tgene | YAP1 | GO:0072091 | regulation of stem cell proliferation | 25433207 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr11:102221674/chr11:102033187) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000530675 | BIRC2 | chr11 | 102221674 | - | ENST00000526343 | YAP1 | chr11 | 102033187 | + | 2445 | 1012 | 107 | 1792 | 561 |
ENST00000530675 | BIRC2 | chr11 | 102221674 | - | ENST00000282441 | YAP1 | chr11 | 102033187 | + | 5438 | 1012 | 107 | 1954 | 615 |
ENST00000530675 | BIRC2 | chr11 | 102221674 | - | ENST00000537274 | YAP1 | chr11 | 102033187 | + | 5402 | 1012 | 107 | 1918 | 603 |
ENST00000530675 | BIRC2 | chr11 | 102221674 | - | ENST00000345877 | YAP1 | chr11 | 102033187 | + | 5288 | 1012 | 107 | 1804 | 565 |
ENST00000530675 | BIRC2 | chr11 | 102221674 | - | ENST00000531439 | YAP1 | chr11 | 102033187 | + | 1930 | 1012 | 107 | 1906 | 599 |
ENST00000530675 | BIRC2 | chr11 | 102221674 | - | ENST00000524575 | YAP1 | chr11 | 102033187 | + | 2167 | 1012 | 107 | 1954 | 615 |
ENST00000227758 | BIRC2 | chr11 | 102221674 | - | ENST00000526343 | YAP1 | chr11 | 102033187 | + | 3827 | 2394 | 1399 | 3174 | 591 |
ENST00000227758 | BIRC2 | chr11 | 102221674 | - | ENST00000282441 | YAP1 | chr11 | 102033187 | + | 6820 | 2394 | 1399 | 3336 | 645 |
ENST00000227758 | BIRC2 | chr11 | 102221674 | - | ENST00000537274 | YAP1 | chr11 | 102033187 | + | 6784 | 2394 | 1399 | 3300 | 633 |
ENST00000227758 | BIRC2 | chr11 | 102221674 | - | ENST00000345877 | YAP1 | chr11 | 102033187 | + | 6670 | 2394 | 1399 | 3186 | 595 |
ENST00000227758 | BIRC2 | chr11 | 102221674 | - | ENST00000531439 | YAP1 | chr11 | 102033187 | + | 3312 | 2394 | 1399 | 3288 | 629 |
ENST00000227758 | BIRC2 | chr11 | 102221674 | - | ENST00000524575 | YAP1 | chr11 | 102033187 | + | 3549 | 2394 | 1399 | 3336 | 645 |
ENST00000532672 | BIRC2 | chr11 | 102221674 | - | ENST00000526343 | YAP1 | chr11 | 102033187 | + | 2702 | 1269 | 337 | 2049 | 570 |
ENST00000532672 | BIRC2 | chr11 | 102221674 | - | ENST00000282441 | YAP1 | chr11 | 102033187 | + | 5695 | 1269 | 337 | 2211 | 624 |
ENST00000532672 | BIRC2 | chr11 | 102221674 | - | ENST00000537274 | YAP1 | chr11 | 102033187 | + | 5659 | 1269 | 337 | 2175 | 612 |
ENST00000532672 | BIRC2 | chr11 | 102221674 | - | ENST00000345877 | YAP1 | chr11 | 102033187 | + | 5545 | 1269 | 337 | 2061 | 574 |
ENST00000532672 | BIRC2 | chr11 | 102221674 | - | ENST00000531439 | YAP1 | chr11 | 102033187 | + | 2187 | 1269 | 337 | 2163 | 608 |
ENST00000532672 | BIRC2 | chr11 | 102221674 | - | ENST00000524575 | YAP1 | chr11 | 102033187 | + | 2424 | 1269 | 337 | 2211 | 624 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000530675 | ENST00000526343 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.008159474 | 0.9918405 |
ENST00000530675 | ENST00000282441 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.000455909 | 0.9995441 |
ENST00000530675 | ENST00000537274 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.000492577 | 0.9995074 |
ENST00000530675 | ENST00000345877 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.000342792 | 0.99965715 |
ENST00000530675 | ENST00000531439 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.01710643 | 0.9828935 |
ENST00000530675 | ENST00000524575 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.01576899 | 0.98423105 |
ENST00000227758 | ENST00000526343 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.00225269 | 0.99774724 |
ENST00000227758 | ENST00000282441 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.000635193 | 0.9993648 |
ENST00000227758 | ENST00000537274 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.000838662 | 0.99916136 |
ENST00000227758 | ENST00000345877 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.000611062 | 0.99938893 |
ENST00000227758 | ENST00000531439 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.003594692 | 0.99640536 |
ENST00000227758 | ENST00000524575 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.003560928 | 0.99643904 |
ENST00000532672 | ENST00000526343 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.004611903 | 0.9953881 |
ENST00000532672 | ENST00000282441 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.000375365 | 0.9996246 |
ENST00000532672 | ENST00000537274 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.000281744 | 0.99971825 |
ENST00000532672 | ENST00000345877 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.000242082 | 0.99975795 |
ENST00000532672 | ENST00000531439 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.01062211 | 0.9893779 |
ENST00000532672 | ENST00000524575 | BIRC2 | chr11 | 102221674 | - | YAP1 | chr11 | 102033187 | + | 0.010105301 | 0.9898947 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for BIRC2-YAP1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
BIRC2 | chr11 | 102221674 | YAP1 | chr11 | 102033187 | 1012 | 301 | GDDPWVEHAKWFPSHIDQTTTWQDPR |
BIRC2 | chr11 | 102221674 | YAP1 | chr11 | 102033187 | 1269 | 310 | GDDPWVEHAKWFPSHIDQTTTWQDPR |
BIRC2 | chr11 | 102221674 | YAP1 | chr11 | 102033187 | 2394 | 331 | GDDPWVEHAKWFPSHIDQTTTWQDPR |
Top |
Potential FusionNeoAntigen Information of BIRC2-YAP1 in HLA I |
![]() |
BIRC2-YAP1_102221674_102033187.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B51:02 | HAKWFPSHI | 0.995 | 0.7216 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B52:01 | HAKWFPSHI | 0.9842 | 0.9818 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B51:01 | HAKWFPSHI | 0.9822 | 0.6677 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:01 | FPSHIDQTT | 0.9043 | 0.9358 | 11 | 20 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:03 | FPSHIDQTT | 0.8725 | 0.9461 | 11 | 20 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:02 | FPSHIDQTT | 0.7725 | 0.9742 | 11 | 20 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:04 | FPSHIDQTT | 0.7725 | 0.9742 | 11 | 20 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B15:18 | EHAKWFPSH | 0.3129 | 0.7912 | 6 | 15 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B15:37 | EHAKWFPSH | 0.1928 | 0.7896 | 6 | 15 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B57:01 | PSHIDQTTTW | 0.9981 | 0.9909 | 12 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B58:02 | PSHIDQTTTW | 0.9917 | 0.9662 | 12 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B38:01 | EHAKWFPSHI | 0.9898 | 0.9858 | 6 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B58:01 | PSHIDQTTTW | 0.9896 | 0.9789 | 12 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B38:01 | PSHIDQTTTW | 0.1206 | 0.9945 | 12 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:01 | FPSHIDQTTTW | 0.999 | 0.8619 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B53:01 | FPSHIDQTTTW | 0.9988 | 0.7117 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:05 | FPSHIDQTTTW | 0.9985 | 0.7898 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:08 | FPSHIDQTTTW | 0.9975 | 0.8557 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B15:18 | FPSHIDQTTTW | 0.9918 | 0.8649 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B38:02 | FPSHIDQTTTW | 0.7669 | 0.9969 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B38:01 | FPSHIDQTTTW | 0.7558 | 0.9972 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C15:06 | HAKWFPSHI | 0.9973 | 0.9757 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C06:03 | HAKWFPSHI | 0.9829 | 0.9974 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B51:07 | HAKWFPSHI | 0.9807 | 0.9744 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C12:04 | HAKWFPSHI | 0.9787 | 0.9975 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C12:12 | HAKWFPSHI | 0.9692 | 0.9811 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B51:08 | HAKWFPSHI | 0.92 | 0.5246 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:12 | FPSHIDQTT | 0.7725 | 0.9742 | 11 | 20 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C02:06 | HAKWFPSHI | 0.7263 | 0.9942 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B78:01 | FPSHIDQTT | 0.4363 | 0.7039 | 11 | 20 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B54:01 | FPSHIDQTTT | 0.9852 | 0.5043 | 11 | 21 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B44:06 | FPSHIDQTTTW | 0.9804 | 0.7304 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C15:02 | HAKWFPSHI | 0.9975 | 0.9641 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C03:17 | HAKWFPSHI | 0.9896 | 0.9877 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B51:13 | HAKWFPSHI | 0.9821 | 0.5016 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C06:17 | HAKWFPSHI | 0.9803 | 0.9974 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C06:02 | HAKWFPSHI | 0.9803 | 0.9974 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C16:04 | HAKWFPSHI | 0.98 | 0.9899 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B51:14 | HAKWFPSHI | 0.9753 | 0.6849 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B51:21 | HAKWFPSHI | 0.9696 | 0.6334 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C12:03 | HAKWFPSHI | 0.953 | 0.9918 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C12:02 | HAKWFPSHI | 0.9252 | 0.9852 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:77 | FPSHIDQTT | 0.9043 | 0.9358 | 11 | 20 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C16:02 | HAKWFPSHI | 0.7912 | 0.9937 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:09 | FPSHIDQTT | 0.7725 | 0.9742 | 11 | 20 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C06:08 | HAKWFPSHI | 0.6481 | 0.9974 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B67:01 | FPSHIDQTT | 0.5604 | 0.9071 | 11 | 20 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C02:10 | HAKWFPSHI | 0.5116 | 0.9944 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-C02:02 | HAKWFPSHI | 0.5116 | 0.9944 | 7 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B78:02 | FPSHIDQTT | 0.3917 | 0.7824 | 11 | 20 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B57:10 | PSHIDQTTTW | 0.9981 | 0.9909 | 12 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B57:04 | PSHIDQTTTW | 0.9961 | 0.9076 | 12 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B38:05 | EHAKWFPSHI | 0.9898 | 0.9858 | 6 | 16 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B38:05 | PSHIDQTTTW | 0.1206 | 0.9945 | 12 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:77 | FPSHIDQTTTW | 0.999 | 0.8619 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:23 | FPSHIDQTTTW | 0.999 | 0.8673 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:30 | FPSHIDQTTTW | 0.9986 | 0.8149 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:17 | FPSHIDQTTTW | 0.9986 | 0.8149 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B53:02 | FPSHIDQTTTW | 0.9974 | 0.7763 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B15:13 | FPSHIDQTTTW | 0.9967 | 0.964 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:11 | FPSHIDQTTTW | 0.9957 | 0.8978 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:24 | FPSHIDQTTTW | 0.9956 | 0.8028 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B35:43 | FPSHIDQTTTW | 0.9956 | 0.9313 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B15:08 | FPSHIDQTTTW | 0.9949 | 0.9305 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B15:11 | FPSHIDQTTTW | 0.9942 | 0.9429 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B51:05 | FPSHIDQTTTW | 0.9577 | 0.8454 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B51:09 | FPSHIDQTTTW | 0.9559 | 0.8743 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B51:06 | FPSHIDQTTTW | 0.9315 | 0.885 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-A25:01 | FPSHIDQTTTW | 0.8927 | 0.9817 | 11 | 22 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | HLA-B38:05 | FPSHIDQTTTW | 0.7558 | 0.9972 | 11 | 22 |
Top |
Potential FusionNeoAntigen Information of BIRC2-YAP1 in HLA II |
![]() |
BIRC2-YAP1_102221674_102033187.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | DRB1-0411 | FPSHIDQTTTWQDPR | 11 | 26 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | DRB1-0467 | FPSHIDQTTTWQDPR | 11 | 26 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | DRB1-0491 | FPSHIDQTTTWQDPR | 11 | 26 |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 | DRB1-1410 | FPSHIDQTTTWQDPR | 11 | 26 |
Top |
Fusion breakpoint peptide structures of BIRC2-YAP1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
1772 | EHAKWFPSHIDQTT | BIRC2 | YAP1 | chr11 | 102221674 | chr11 | 102033187 | 2394 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of BIRC2-YAP1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 1772 | EHAKWFPSHIDQTT | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 1772 | EHAKWFPSHIDQTT | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 1772 | EHAKWFPSHIDQTT | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 1772 | EHAKWFPSHIDQTT | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 1772 | EHAKWFPSHIDQTT | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 1772 | EHAKWFPSHIDQTT | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 1772 | EHAKWFPSHIDQTT | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 1772 | EHAKWFPSHIDQTT | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 1772 | EHAKWFPSHIDQTT | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 1772 | EHAKWFPSHIDQTT | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 1772 | EHAKWFPSHIDQTT | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of BIRC2-YAP1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 11 | 20 | FPSHIDQTT | TCCAAGTCACATCGATCAGACAACAAC |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 11 | 21 | FPSHIDQTTT | TCCAAGTCACATCGATCAGACAACAACATG |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 11 | 22 | FPSHIDQTTTW | TCCAAGTCACATCGATCAGACAACAACATGGCA |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 12 | 22 | PSHIDQTTTW | AAGTCACATCGATCAGACAACAACATGGCA |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 6 | 15 | EHAKWFPSH | ACATGCCAAGTGGTTTCCAAGTCACAT |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 6 | 16 | EHAKWFPSHI | ACATGCCAAGTGGTTTCCAAGTCACATCGA |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 7 | 16 | HAKWFPSHI | TGCCAAGTGGTTTCCAAGTCACATCGA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
BIRC2-YAP1 | chr11 | 102221674 | chr11 | 102033187 | 11 | 26 | FPSHIDQTTTWQDPR | TCCAAGTCACATCGATCAGACAACAACATGGCAGGACCCCAGGAA |
Top |
Information of the samples that have these potential fusion neoantigens of BIRC2-YAP1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | BIRC2-YAP1 | chr11 | 102221674 | ENST00000227758 | chr11 | 102033187 | ENST00000282441 | TCGA-CG-4443-01A |
Top |
Potential target of CAR-T therapy development for BIRC2-YAP1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to BIRC2-YAP1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to BIRC2-YAP1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |