Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:UTP14A-BACE2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: UTP14A-BACE2
	FusionPDB ID: 97703
	FusionGDB2.0 ID: 97703
		Hgene	Tgene
	Gene symbol	UTP14A	BACE2
	Gene ID	10813	25825
	Gene name	UTP14A small subunit processome component	beta-secretase 2
	Synonyms	NYCO16\|SDCCAG16\|Utp14\|dJ537K23.3	AEPLC\|ALP56\|ASP1\|ASP21\|BAE2\|CDA13\|CEAP1\|DRAP
	Cytomap	Xq26.1	21q22.2-q22.3
	Type of gene	protein-coding	protein-coding
	Description	U3 small nucleolar RNA-associated protein 14 homolog AUTP14, U3 small nucleolar ribonucleoprotein, homolog AUTP14A small subunit (SSU) processome componentantigen NY-CO-16serologically defined colon cancer antigen 16	beta-secretase 256 kDa aspartic-like proteaseDown syndrome region aspartic proteaseSLCO3A1/BACE2 fusionaspartyl protease 1beta-site APP-cleaving enzyme 2beta-site amyloid beta A4 precursor protein-cleaving enzyme 2memapsin-1membrane-associated asp
	Modification date	20200313	20200313
	UniProtAcc	.	Q9Y5Z0 Main function of 5'-partner protein: FUNCTION: Responsible for the proteolytic processing of the amyloid precursor protein (APP). Cleaves APP, between residues 690 and 691, leading to the generation and extracellular release of beta-cleaved soluble APP, and a corresponding cell-associated C-terminal fragment which is later released by gamma-secretase. It has also been shown that it can cleave APP between residues 671 and 672. Responsible also for the proteolytic processing of CLTRN in pancreatic beta cells (PubMed:21907142). {ECO:0000269\|PubMed:10591213, ECO:0000269\|PubMed:11083922, ECO:0000269\|PubMed:11423558, ECO:0000269\|PubMed:15857888, ECO:0000269\|PubMed:16816112, ECO:0000269\|PubMed:21907142}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000371042, ENST00000371051, ENST00000394422, ENST00000425117, ENST00000498179,	ENST00000466122, ENST00000328735, ENST00000330333, ENST00000347667,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 5 X 2=50	14 X 9 X 8=1008
	# samples	5	14
	** MAII score	log2(5/50*10)=0	log2(14/1008*10)=-2.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: UTP14A [Title/Abstract] AND BACE2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: UTP14A [Title/Abstract] AND BACE2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	UTP14A(129059088)-BACE2(42598234), # samples:1
Anticipated loss of major functional domain due to fusion event.	UTP14A-BACE2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. UTP14A-BACE2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	BACE2	GO:0006509	membrane protein ectodomain proteolysis	10591213

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chrX:129059088/chr21:42598234)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across UTP14A (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across BACE2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000425117	UTP14A	chrX	129059088	+	ENST00000328735	BACE2	chr21	42598234	+	3372	1365	78	2201	707
ENST00000425117	UTP14A	chrX	129059088	+	ENST00000330333	BACE2	chr21	42598234	+	3541	1365	78	2567	829
ENST00000425117	UTP14A	chrX	129059088	+	ENST00000347667	BACE2	chr21	42598234	+	9312	1365	78	2417	779
ENST00000394422	UTP14A	chrX	129059088	+	ENST00000328735	BACE2	chr21	42598234	+	3466	1459	16	2295	759
ENST00000394422	UTP14A	chrX	129059088	+	ENST00000330333	BACE2	chr21	42598234	+	3635	1459	16	2661	881
ENST00000394422	UTP14A	chrX	129059088	+	ENST00000347667	BACE2	chr21	42598234	+	9406	1459	16	2511	831
ENST00000371051	UTP14A	chrX	129059088	+	ENST00000328735	BACE2	chr21	42598234	+	3393	1386	117	2222	701
ENST00000371051	UTP14A	chrX	129059088	+	ENST00000330333	BACE2	chr21	42598234	+	3562	1386	117	2588	823
ENST00000371051	UTP14A	chrX	129059088	+	ENST00000347667	BACE2	chr21	42598234	+	9333	1386	117	2438	773
ENST00000371042	UTP14A	chrX	129059088	+	ENST00000328735	BACE2	chr21	42598234	+	2934	927	0	1763	587
ENST00000371042	UTP14A	chrX	129059088	+	ENST00000330333	BACE2	chr21	42598234	+	3103	927	0	2129	709
ENST00000371042	UTP14A	chrX	129059088	+	ENST00000347667	BACE2	chr21	42598234	+	8874	927	0	1979	659

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000425117	ENST00000328735	UTP14A	chrX	129059088	+	BACE2	chr21	42598234	+	0.003219083	0.9967809
ENST00000425117	ENST00000330333	UTP14A	chrX	129059088	+	BACE2	chr21	42598234	+	0.002213604	0.9977864
ENST00000425117	ENST00000347667	UTP14A	chrX	129059088	+	BACE2	chr21	42598234	+	0.000578253	0.9994217
ENST00000394422	ENST00000328735	UTP14A	chrX	129059088	+	BACE2	chr21	42598234	+	0.003894656	0.9961054
ENST00000394422	ENST00000330333	UTP14A	chrX	129059088	+	BACE2	chr21	42598234	+	0.001995924	0.998004
ENST00000394422	ENST00000347667	UTP14A	chrX	129059088	+	BACE2	chr21	42598234	+	0.000579073	0.999421
ENST00000371051	ENST00000328735	UTP14A	chrX	129059088	+	BACE2	chr21	42598234	+	0.00611094	0.9938891
ENST00000371051	ENST00000330333	UTP14A	chrX	129059088	+	BACE2	chr21	42598234	+	0.003699963	0.99630004
ENST00000371051	ENST00000347667	UTP14A	chrX	129059088	+	BACE2	chr21	42598234	+	0.000783053	0.9992169
ENST00000371042	ENST00000328735	UTP14A	chrX	129059088	+	BACE2	chr21	42598234	+	0.003236872	0.9967631
ENST00000371042	ENST00000330333	UTP14A	chrX	129059088	+	BACE2	chr21	42598234	+	0.002117746	0.9978822
ENST00000371042	ENST00000347667	UTP14A	chrX	129059088	+	BACE2	chr21	42598234	+	0.000537175	0.9994628

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for UTP14A-BACE2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
UTP14A	chrX	129059088	BACE2	chr21	42598234	1365	429	SVKSLAVPTIEELAGTPHSYIDTYFD
UTP14A	chrX	129059088	BACE2	chr21	42598234	1386	423	SVKSLAVPTIEELAGTPHSYIDTYFD
UTP14A	chrX	129059088	BACE2	chr21	42598234	1459	481	SVKSLAVPTIEELAGTPHSYIDTYFD
UTP14A	chrX	129059088	BACE2	chr21	42598234	927	309	SVKSLAVPTIEELAGTPHSYIDTYFD

Top

Potential FusionNeoAntigen Information of UTP14A-BACE2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

UTP14A-BACE2_129059088_42598234.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:01	ELAGTPHSY	0.9912	0.9368	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B45:01	EELAGTPHS	0.9788	0.9803	10	19
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:25	ELAGTPHSY	0.9697	0.9635	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:02	ELAGTPHSY	0.9673	0.9633	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B50:02	EELAGTPHS	0.962	0.7966	10	19
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:08	ELAGTPHSY	0.9551	0.8583	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:01	ELAGTPHSY	0.8738	0.9206	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:05	ELAGTPHSY	0.5247	0.7177	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B46:01	ELAGTPHSY	0.4408	0.5827	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:18	ELAGTPHSY	0.3992	0.8784	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:03	EELAGTPHSY	0.9993	0.9772	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:02	EELAGTPHSY	0.9988	0.5027	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:05	EELAGTPHSY	0.9971	0.7716	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:01	EELAGTPHSY	0.99	0.8457	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B47:01	EELAGTPHSY	0.988	0.6524	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:02	EELAGTPHSY	0.9074	0.9607	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:01	IEELAGTPHSY	0.9996	0.9283	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B47:01	IEELAGTPHSY	0.9993	0.6135	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:03	EELAGTPHSYI	0.9991	0.9742	10	21
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:03	IEELAGTPHSY	0.9984	0.9614	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:25	IEELAGTPHSY	0.9972	0.9612	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:02	IEELAGTPHSY	0.9962	0.9641	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:01	IEELAGTPHSY	0.9948	0.7815	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:21	ELAGTPHSY	0.9666	0.9528	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:07	ELAGTPHSY	0.9289	0.7799	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:31	ELAGTPHSY	0.8891	0.9249	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:05	ELAGTPHSY	0.8481	0.9208	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:04	ELAGTPHSY	0.6489	0.9561	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-C02:06	LAGTPHSYI	0.5821	0.977	12	21
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:08	ELAGTPHSY	0.1415	0.5783	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-C03:14	ELAGTPHSY	0.0195	0.9911	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:09	EELAGTPHSY	0.9993	0.6796	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:08	EELAGTPHSY	0.9991	0.5865	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:21	EELAGTPHSY	0.8979	0.9496	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:31	EELAGTPHSY	0.8921	0.8854	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:10	EELAGTPHSY	0.7917	0.7161	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:07	IEELAGTPHSY	0.9995	0.7723	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:05	IEELAGTPHSY	0.9972	0.9208	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:31	IEELAGTPHSY	0.996	0.9299	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:11	LAGTPHSY	0.9963	0.9389	12	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-C03:02	LAGTPHSY	0.9941	0.973	12	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-C12:02	LAGTPHSY	0.9721	0.9824	12	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-C16:02	LAGTPHSY	0.969	0.9957	12	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-C16:04	LAGTPHSY	0.96	0.9895	12	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-C16:01	LAGTPHSY	0.891	0.9901	12	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-A25:01	ELAGTPHSY	0.9939	0.9435	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:33	ELAGTPHSY	0.9912	0.9368	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:34	ELAGTPHSY	0.9912	0.9368	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:125	ELAGTPHSY	0.9912	0.9368	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:27	ELAGTPHSY	0.9897	0.9418	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:135	ELAGTPHSY	0.9887	0.9331	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:11	ELAGTPHSY	0.9844	0.9091	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:08	ELAGTPHSY	0.9825	0.9119	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:50	ELAGTPHSY	0.9786	0.9453	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:43	ELAGTPHSY	0.9783	0.918	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:12	ELAGTPHSY	0.9741	0.9596	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:39	ELAGTPHSY	0.9684	0.9324	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:11	ELAGTPHSY	0.9545	0.9469	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:35	ELAGTPHSY	0.918	0.9043	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:53	ELAGTPHSY	0.8797	0.9239	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:77	ELAGTPHSY	0.8738	0.9206	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:23	ELAGTPHSY	0.8735	0.9272	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:20	ELAGTPHSY	0.866	0.9426	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:20	ELAGTPHSY	0.8582	0.9385	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:28	ELAGTPHSY	0.7936	0.942	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:13	ELAGTPHSY	0.7401	0.8566	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:24	ELAGTPHSY	0.6515	0.9296	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:30	ELAGTPHSY	0.5966	0.8661	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:17	ELAGTPHSY	0.5966	0.8661	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:04	ELAGTPHSY	0.3908	0.9463	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-C12:02	ELAGTPHSY	0.3711	0.9792	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B48:02	ELAGTPHSY	0.2785	0.9311	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B07:13	LAGTPHSYI	0.1802	0.7925	12	21
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:06	ELAGTPHSY	0.1534	0.9469	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:07	ELAGTPHSY	0.1178	0.9144	11	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:07	EELAGTPHSY	0.9993	0.9772	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:26	EELAGTPHSY	0.9993	0.9772	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:13	EELAGTPHSY	0.9993	0.9772	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:22	EELAGTPHSY	0.9988	0.5027	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:04	EELAGTPHSY	0.9951	0.858	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:07	EELAGTPHSY	0.9929	0.8128	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:08	EELAGTPHSY	0.9918	0.92	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:05	EELAGTPHSY	0.99	0.8457	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:06	EELAGTPHSY	0.9878	0.8484	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:03	EELAGTPHSY	0.9853	0.84	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-A68:02	ELAGTPHSYI	0.981	0.5637	11	21
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:11	EELAGTPHSY	0.9438	0.8963	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:08	EELAGTPHSY	0.9425	0.8979	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:53	EELAGTPHSY	0.9348	0.9189	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:12	EELAGTPHSY	0.929	0.9467	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:11	EELAGTPHSY	0.915	0.8452	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:20	EELAGTPHSY	0.8617	0.911	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-A25:01	EELAGTPHSY	0.4897	0.8912	10	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:34	IEELAGTPHSY	0.9996	0.9283	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:33	IEELAGTPHSY	0.9996	0.9283	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:27	IEELAGTPHSY	0.9996	0.9013	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:125	IEELAGTPHSY	0.9996	0.9283	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:135	IEELAGTPHSY	0.9995	0.9295	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:50	IEELAGTPHSY	0.9995	0.9188	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:35	IEELAGTPHSY	0.9994	0.8677	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:53	IEELAGTPHSY	0.9993	0.9046	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:26	EELAGTPHSYI	0.9991	0.9742	10	21
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:07	EELAGTPHSYI	0.9991	0.9742	10	21
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:13	EELAGTPHSYI	0.9991	0.9742	10	21
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:12	IEELAGTPHSY	0.999	0.8394	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:26	IEELAGTPHSY	0.9984	0.9614	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:07	IEELAGTPHSY	0.9984	0.9614	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B44:13	IEELAGTPHSY	0.9984	0.9614	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:20	IEELAGTPHSY	0.997	0.9347	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B15:39	IEELAGTPHSY	0.997	0.894	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:11	IEELAGTPHSY	0.9969	0.8526	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:04	IEELAGTPHSY	0.9966	0.8169	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:28	IEELAGTPHSY	0.9964	0.9336	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:08	IEELAGTPHSY	0.9961	0.9183	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B35:20	IEELAGTPHSY	0.9952	0.9427	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:06	IEELAGTPHSY	0.9951	0.7958	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:05	IEELAGTPHSY	0.9948	0.7815	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:03	IEELAGTPHSY	0.9934	0.7768	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B48:02	IEELAGTPHSY	0.9925	0.9287	9	20
UTP14A-BACE2	chrX	129059088	chr21	42598234	927	HLA-B18:11	EELAGTPHSYI	0.9454	0.8267	10	21

Top

Potential FusionNeoAntigen Information of UTP14A-BACE2 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of UTP14A-BACE2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10199	VPTIEELAGTPHSY	UTP14A	BACE2	chrX	129059088	chr21	42598234	927

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of UTP14A-BACE2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10199	VPTIEELAGTPHSY	-7.15543	-7.26883
HLA-B14:02	3BVN	10199	VPTIEELAGTPHSY	-4.77435	-5.80965
HLA-B52:01	3W39	10199	VPTIEELAGTPHSY	-6.80875	-6.92215
HLA-B52:01	3W39	10199	VPTIEELAGTPHSY	-4.20386	-5.23916
HLA-A11:01	4UQ2	10199	VPTIEELAGTPHSY	-7.5194	-8.5547
HLA-A11:01	4UQ2	10199	VPTIEELAGTPHSY	-6.9601	-7.0735
HLA-A24:02	5HGA	10199	VPTIEELAGTPHSY	-7.52403	-7.63743
HLA-A24:02	5HGA	10199	VPTIEELAGTPHSY	-5.82433	-6.85963
HLA-B27:05	6PYJ	10199	VPTIEELAGTPHSY	-3.28285	-4.31815
HLA-B44:05	3DX8	10199	VPTIEELAGTPHSY	-5.91172	-6.94702
HLA-B44:05	3DX8	10199	VPTIEELAGTPHSY	-4.24346	-4.35686
HLA-B35:01	1A1N	10199	VPTIEELAGTPHSY	-5.9251	-6.0385
HLA-B35:01	1A1N	10199	VPTIEELAGTPHSY	-4.80237	-5.83767

Top

Vaccine Design for the FusionNeoAntigens of UTP14A-BACE2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
UTP14A-BACE2	chrX	129059088	chr21	42598234	10	19	EELAGTPHS	GAGGAGCTGGCAGGAACCCCGCACTCC
UTP14A-BACE2	chrX	129059088	chr21	42598234	10	20	EELAGTPHSY	GAGGAGCTGGCAGGAACCCCGCACTCCTAC
UTP14A-BACE2	chrX	129059088	chr21	42598234	10	21	EELAGTPHSYI	GAGGAGCTGGCAGGAACCCCGCACTCCTACATA
UTP14A-BACE2	chrX	129059088	chr21	42598234	11	20	ELAGTPHSY	GAGCTGGCAGGAACCCCGCACTCCTAC
UTP14A-BACE2	chrX	129059088	chr21	42598234	11	21	ELAGTPHSYI	GAGCTGGCAGGAACCCCGCACTCCTACATA
UTP14A-BACE2	chrX	129059088	chr21	42598234	12	20	LAGTPHSY	CTGGCAGGAACCCCGCACTCCTAC
UTP14A-BACE2	chrX	129059088	chr21	42598234	12	21	LAGTPHSYI	CTGGCAGGAACCCCGCACTCCTACATA
UTP14A-BACE2	chrX	129059088	chr21	42598234	9	20	IEELAGTPHSY	ATAGAGGAGCTGGCAGGAACCCCGCACTCCTAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of UTP14A-BACE2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
N/A	UTP14A-BACE2	chrX	129059088	ENST00000371042	chr21	42598234	ENST00000328735	DA568103

Top

Potential target of CAR-T therapy development for UTP14A-BACE2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

BACE2

chrX:129059088

chr21:42598234

ENST00000328735

474_494

397.0

Transmembrane

Helical

Tgene

BACE2

chrX:129059088

chr21:42598234

ENST00000330333

474_494

519.0

Transmembrane

Helical

Tgene

BACE2

chrX:129059088

chr21:42598234

ENST00000347667

474_494

469.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to UTP14A-BACE2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to UTP14A-BACE2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)