![]() |
|||||||
|
Fusion Protein:BMPR1B-PDLIM5 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: BMPR1B-PDLIM5 | FusionPDB ID: 9916 | FusionGDB2.0 ID: 9916 | Hgene | Tgene | Gene symbol | BMPR1B | PDLIM5 | Gene ID | 658 | 10611 |
Gene name | bone morphogenetic protein receptor type 1B | PDZ and LIM domain 5 | |
Synonyms | ALK-6|ALK6|AMDD|BDA1D|BDA2|CDw293 | ENH|ENH1|L9|LIM | |
Cytomap | 4q22.3 | 4q22.3 | |
Type of gene | protein-coding | protein-coding | |
Description | bone morphogenetic protein receptor type-1BBMP type-1B receptorBMPR-1Bactivin receptor-like kinase 6bone morphogenetic protein receptor, type IBserine/threonine receptor kinase | PDZ and LIM domain protein 5enigma homologenigma-like LIM domain proteinenigma-like PDZ and LIM domains protein | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | O00238 Main function of 5'-partner protein: FUNCTION: On ligand binding, forms a receptor complex consisting of two type II and two type I transmembrane serine/threonine kinases. Type II receptors phosphorylate and activate type I receptors which autophosphorylate, then bind and activate SMAD transcriptional regulators. Receptor for BMP7/OP-1 and GDF5. Positively regulates chondrocyte differentiation through GDF5 interaction. {ECO:0000250|UniProtKB:P36898}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000264568, ENST00000394931, ENST00000440890, ENST00000515059, ENST00000502683, | ENST00000359265, ENST00000380176, ENST00000504489, ENST00000508216, ENST00000512274, ENST00000514743, ENST00000542407, ENST00000317968, ENST00000318007, ENST00000380180, ENST00000437932, ENST00000450793, ENST00000538141, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 14 X 13 X 6=1092 | 15 X 18 X 7=1890 |
# samples | 17 | 21 | |
** MAII score | log2(17/1092*10)=-2.68336620478215 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(21/1890*10)=-3.16992500144231 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: BMPR1B [Title/Abstract] AND PDLIM5 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: BMPR1B [Title/Abstract] AND PDLIM5 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | BMPR1B(96046272)-PDLIM5(95444875), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | BMPR1B-PDLIM5 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BMPR1B-PDLIM5 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BMPR1B-PDLIM5 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. BMPR1B-PDLIM5 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | BMPR1B | GO:0006468 | protein phosphorylation | 12065756 |
Hgene | BMPR1B | GO:0030509 | BMP signaling pathway | 18436533 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr4:96046272/chr4:95444875) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000515059 | BMPR1B | chr4 | 96046272 | + | ENST00000450793 | PDLIM5 | chr4 | 95444875 | + | 1477 | 868 | 283 | 1476 | 398 |
ENST00000515059 | BMPR1B | chr4 | 96046272 | + | ENST00000538141 | PDLIM5 | chr4 | 95444875 | + | 1417 | 868 | 283 | 1416 | 378 |
ENST00000515059 | BMPR1B | chr4 | 96046272 | + | ENST00000380180 | PDLIM5 | chr4 | 95444875 | + | 2611 | 868 | 283 | 1476 | 397 |
ENST00000515059 | BMPR1B | chr4 | 96046272 | + | ENST00000318007 | PDLIM5 | chr4 | 95444875 | + | 2551 | 868 | 283 | 1416 | 377 |
ENST00000515059 | BMPR1B | chr4 | 96046272 | + | ENST00000437932 | PDLIM5 | chr4 | 95444875 | + | 6395 | 868 | 283 | 2235 | 650 |
ENST00000515059 | BMPR1B | chr4 | 96046272 | + | ENST00000317968 | PDLIM5 | chr4 | 95444875 | + | 6719 | 868 | 283 | 2562 | 759 |
ENST00000440890 | BMPR1B | chr4 | 96046272 | + | ENST00000450793 | PDLIM5 | chr4 | 95444875 | + | 1305 | 696 | 21 | 1304 | 427 |
ENST00000440890 | BMPR1B | chr4 | 96046272 | + | ENST00000538141 | PDLIM5 | chr4 | 95444875 | + | 1245 | 696 | 21 | 1244 | 407 |
ENST00000440890 | BMPR1B | chr4 | 96046272 | + | ENST00000380180 | PDLIM5 | chr4 | 95444875 | + | 2439 | 696 | 21 | 1304 | 427 |
ENST00000440890 | BMPR1B | chr4 | 96046272 | + | ENST00000318007 | PDLIM5 | chr4 | 95444875 | + | 2379 | 696 | 21 | 1244 | 407 |
ENST00000440890 | BMPR1B | chr4 | 96046272 | + | ENST00000437932 | PDLIM5 | chr4 | 95444875 | + | 6223 | 696 | 21 | 2063 | 680 |
ENST00000440890 | BMPR1B | chr4 | 96046272 | + | ENST00000317968 | PDLIM5 | chr4 | 95444875 | + | 6547 | 696 | 21 | 2390 | 789 |
ENST00000264568 | BMPR1B | chr4 | 96046272 | + | ENST00000450793 | PDLIM5 | chr4 | 95444875 | + | 1348 | 739 | 154 | 1347 | 398 |
ENST00000264568 | BMPR1B | chr4 | 96046272 | + | ENST00000538141 | PDLIM5 | chr4 | 95444875 | + | 1288 | 739 | 154 | 1287 | 378 |
ENST00000264568 | BMPR1B | chr4 | 96046272 | + | ENST00000380180 | PDLIM5 | chr4 | 95444875 | + | 2482 | 739 | 154 | 1347 | 397 |
ENST00000264568 | BMPR1B | chr4 | 96046272 | + | ENST00000318007 | PDLIM5 | chr4 | 95444875 | + | 2422 | 739 | 154 | 1287 | 377 |
ENST00000264568 | BMPR1B | chr4 | 96046272 | + | ENST00000437932 | PDLIM5 | chr4 | 95444875 | + | 6266 | 739 | 154 | 2106 | 650 |
ENST00000264568 | BMPR1B | chr4 | 96046272 | + | ENST00000317968 | PDLIM5 | chr4 | 95444875 | + | 6590 | 739 | 154 | 2433 | 759 |
ENST00000394931 | BMPR1B | chr4 | 96046272 | + | ENST00000450793 | PDLIM5 | chr4 | 95444875 | + | 1264 | 655 | 70 | 1263 | 398 |
ENST00000394931 | BMPR1B | chr4 | 96046272 | + | ENST00000538141 | PDLIM5 | chr4 | 95444875 | + | 1204 | 655 | 70 | 1203 | 378 |
ENST00000394931 | BMPR1B | chr4 | 96046272 | + | ENST00000380180 | PDLIM5 | chr4 | 95444875 | + | 2398 | 655 | 70 | 1263 | 397 |
ENST00000394931 | BMPR1B | chr4 | 96046272 | + | ENST00000318007 | PDLIM5 | chr4 | 95444875 | + | 2338 | 655 | 70 | 1203 | 377 |
ENST00000394931 | BMPR1B | chr4 | 96046272 | + | ENST00000437932 | PDLIM5 | chr4 | 95444875 | + | 6182 | 655 | 70 | 2022 | 650 |
ENST00000394931 | BMPR1B | chr4 | 96046272 | + | ENST00000317968 | PDLIM5 | chr4 | 95444875 | + | 6506 | 655 | 70 | 2349 | 759 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000515059 | ENST00000450793 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.003290941 | 0.996709 |
ENST00000515059 | ENST00000538141 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.006014159 | 0.99398583 |
ENST00000515059 | ENST00000380180 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.000892169 | 0.9991078 |
ENST00000515059 | ENST00000318007 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.000578535 | 0.9994215 |
ENST00000515059 | ENST00000437932 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.000184341 | 0.99981564 |
ENST00000515059 | ENST00000317968 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.000143122 | 0.9998568 |
ENST00000440890 | ENST00000450793 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.005948861 | 0.99405116 |
ENST00000440890 | ENST00000538141 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.012143407 | 0.9878566 |
ENST00000440890 | ENST00000380180 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.00122264 | 0.99877733 |
ENST00000440890 | ENST00000318007 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.000943338 | 0.99905664 |
ENST00000440890 | ENST00000437932 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.001067456 | 0.99893254 |
ENST00000440890 | ENST00000317968 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.000842878 | 0.9991571 |
ENST00000264568 | ENST00000450793 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.002952625 | 0.99704736 |
ENST00000264568 | ENST00000538141 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.004879628 | 0.99512035 |
ENST00000264568 | ENST00000380180 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.000744861 | 0.9992551 |
ENST00000264568 | ENST00000318007 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.000455665 | 0.9995443 |
ENST00000264568 | ENST00000437932 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.000185484 | 0.99981457 |
ENST00000264568 | ENST00000317968 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.00013664 | 0.9998634 |
ENST00000394931 | ENST00000450793 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.0027716 | 0.99722844 |
ENST00000394931 | ENST00000538141 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.004804289 | 0.9951957 |
ENST00000394931 | ENST00000380180 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.000699557 | 0.9993005 |
ENST00000394931 | ENST00000318007 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.000437878 | 0.9995621 |
ENST00000394931 | ENST00000437932 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.000181262 | 0.99981874 |
ENST00000394931 | ENST00000317968 | BMPR1B | chr4 | 96046272 | + | PDLIM5 | chr4 | 95444875 | + | 0.000132542 | 0.99986744 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for BMPR1B-PDLIM5 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
BMPR1B | chr4 | 96046272 | PDLIM5 | chr4 | 95444875 | 655 | 193 | EQSQSSGSGSGLPLLLKDGGKAAQAN |
BMPR1B | chr4 | 96046272 | PDLIM5 | chr4 | 95444875 | 696 | 223 | EQSQSSGSGSGLPLLLKDGGKAAQAN |
BMPR1B | chr4 | 96046272 | PDLIM5 | chr4 | 95444875 | 739 | 193 | EQSQSSGSGSGLPLLLKDGGKAAQAN |
BMPR1B | chr4 | 96046272 | PDLIM5 | chr4 | 95444875 | 868 | 193 | EQSQSSGSGSGLPLLLKDGGKAAQAN |
Top |
Potential FusionNeoAntigen Information of BMPR1B-PDLIM5 in HLA I |
![]() |
BMPR1B-PDLIM5_96046272_95444875.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
BMPR1B-PDLIM5 | chr4 | 96046272 | chr4 | 95444875 | 739 | HLA-C15:06 | SGSGLPLLL | 0.996 | 0.971 | 7 | 16 |
BMPR1B-PDLIM5 | chr4 | 96046272 | chr4 | 95444875 | 739 | HLA-C02:06 | SGSGLPLLL | 0.5161 | 0.9807 | 7 | 16 |
BMPR1B-PDLIM5 | chr4 | 96046272 | chr4 | 95444875 | 739 | HLA-C15:05 | SGSGLPLLL | 0.9961 | 0.98 | 7 | 16 |
BMPR1B-PDLIM5 | chr4 | 96046272 | chr4 | 95444875 | 739 | HLA-C15:02 | SGSGLPLLL | 0.9948 | 0.9699 | 7 | 16 |
BMPR1B-PDLIM5 | chr4 | 96046272 | chr4 | 95444875 | 739 | HLA-C17:01 | SGSGLPLLL | 0.6696 | 0.9893 | 7 | 16 |
BMPR1B-PDLIM5 | chr4 | 96046272 | chr4 | 95444875 | 739 | HLA-B07:13 | SGSGLPLLL | 0.1508 | 0.8314 | 7 | 16 |
Top |
Potential FusionNeoAntigen Information of BMPR1B-PDLIM5 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of BMPR1B-PDLIM5 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
3125 | GSGSGLPLLLKDGG | BMPR1B | PDLIM5 | chr4 | 96046272 | chr4 | 95444875 | 739 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of BMPR1B-PDLIM5 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 3125 | GSGSGLPLLLKDGG | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 3125 | GSGSGLPLLLKDGG | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 3125 | GSGSGLPLLLKDGG | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 3125 | GSGSGLPLLLKDGG | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 3125 | GSGSGLPLLLKDGG | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 3125 | GSGSGLPLLLKDGG | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 3125 | GSGSGLPLLLKDGG | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 3125 | GSGSGLPLLLKDGG | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 3125 | GSGSGLPLLLKDGG | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 3125 | GSGSGLPLLLKDGG | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 3125 | GSGSGLPLLLKDGG | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of BMPR1B-PDLIM5 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
BMPR1B-PDLIM5 | chr4 | 96046272 | chr4 | 95444875 | 7 | 16 | SGSGLPLLL | TCAGGCCTCCCTCTGCTGCTAAAAGAT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of BMPR1B-PDLIM5 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | BMPR1B-PDLIM5 | chr4 | 96046272 | ENST00000264568 | chr4 | 95444875 | ENST00000317968 | TCGA-A7-A26J-01A |
Top |
Potential target of CAR-T therapy development for BMPR1B-PDLIM5 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Hgene | BMPR1B | chr4:96046272 | chr4:95444875 | ENST00000264568 | + | 6 | 11 | 127_148 | 195 | 503.0 | Transmembrane | Helical |
Hgene | BMPR1B | chr4:96046272 | chr4:95444875 | ENST00000394931 | + | 5 | 10 | 127_148 | 195 | 503.0 | Transmembrane | Helical |
Hgene | BMPR1B | chr4:96046272 | chr4:95444875 | ENST00000440890 | + | 6 | 11 | 127_148 | 225 | 533.0 | Transmembrane | Helical |
Hgene | BMPR1B | chr4:96046272 | chr4:95444875 | ENST00000515059 | + | 8 | 13 | 127_148 | 195 | 503.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to BMPR1B-PDLIM5 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to BMPR1B-PDLIM5 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |