Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:WIPI1-BPTF

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: WIPI1-BPTF
	FusionPDB ID: 99302
	FusionGDB2.0 ID: 99302
		Hgene	Tgene
	Gene symbol	WIPI1	BPTF
	Gene ID	55062	2186
	Gene name	WD repeat domain, phosphoinositide interacting 1	bromodomain PHD finger transcription factor
	Synonyms	ATG18\|ATG18A\|WIPI49	FAC1\|FALZ\|NEDDFL\|NURF301
	Cytomap	17q24.2	17q24.2
	Type of gene	protein-coding	protein-coding
	Description	WD repeat domain phosphoinositide-interacting protein 1WIPI-1 alphaatg18 protein homolog	nucleosome-remodeling factor subunit BPTFbromodomain and PHD domain transcription factorbromodomain and PHD finger-containing transcription factorfetal Alz-50 clone 1 proteinfetal Alz-50 reactive clone 1fetal Alzheimer antigennucleosome remodeling f
	Modification date	20200320	20200313
	UniProtAcc	.	Q12830 Main function of 5'-partner protein: FUNCTION: Histone-binding component of NURF (nucleosome-remodeling factor), a complex which catalyzes ATP-dependent nucleosome sliding and facilitates transcription of chromatin. Specifically recognizes H3 tails trimethylated on 'Lys-4' (H3K4me3), which mark transcription start sites of virtually all active genes. May also regulate transcription through direct binding to DNA or transcription factors.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000262139, ENST00000546360, ENST00000589459,	ENST00000577770, ENST00000306378, ENST00000321892, ENST00000335221, ENST00000424123,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	4 X 3 X 3=36	23 X 23 X 6=3174
	# samples	4	26
	** MAII score	log2(4/36*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(26/3174*10)=-3.60971859980673 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: WIPI1 [Title/Abstract] AND BPTF [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: WIPI1 [Title/Abstract] AND BPTF [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	WIPI1(66446869)-BPTF(65955657), # samples:1
Anticipated loss of major functional domain due to fusion event.	WIPI1-BPTF seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. WIPI1-BPTF seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. WIPI1-BPTF seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. WIPI1-BPTF seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	WIPI1	GO:0009267	cellular response to starvation	28561066
Hgene	WIPI1	GO:0048203	vesicle targeting, trans-Golgi to endosome	15020712
Tgene	BPTF	GO:0000122	negative regulation of transcription by RNA polymerase II	10727212
Tgene	BPTF	GO:0006338	chromatin remodeling	14609955

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:66446869/chr17:65955657)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across WIPI1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across BPTF (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000262139	WIPI1	chr17	66446869	-	ENST00000335221	BPTF	chr17	65955657	+	3260	333	0	1169	389
ENST00000262139	WIPI1	chr17	66446869	-	ENST00000321892	BPTF	chr17	65955657	+	3260	333	0	1169	389
ENST00000262139	WIPI1	chr17	66446869	-	ENST00000306378	BPTF	chr17	65955657	+	2035	333	0	1169	389
ENST00000262139	WIPI1	chr17	66446869	-	ENST00000424123	BPTF	chr17	65955657	+	1170	333	0	1169	389
ENST00000546360	WIPI1	chr17	66446869	-	ENST00000335221	BPTF	chr17	65955657	+	3235	308	32	1144	370
ENST00000546360	WIPI1	chr17	66446869	-	ENST00000321892	BPTF	chr17	65955657	+	3235	308	32	1144	370
ENST00000546360	WIPI1	chr17	66446869	-	ENST00000306378	BPTF	chr17	65955657	+	2010	308	32	1144	370
ENST00000546360	WIPI1	chr17	66446869	-	ENST00000424123	BPTF	chr17	65955657	+	1145	308	32	1144	371

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000262139	ENST00000335221	WIPI1	chr17	66446869	-	BPTF	chr17	65955657	+	0.000449388	0.99955064
ENST00000262139	ENST00000321892	WIPI1	chr17	66446869	-	BPTF	chr17	65955657	+	0.000449388	0.99955064
ENST00000262139	ENST00000306378	WIPI1	chr17	66446869	-	BPTF	chr17	65955657	+	0.001184204	0.9988158
ENST00000262139	ENST00000424123	WIPI1	chr17	66446869	-	BPTF	chr17	65955657	+	0.005554614	0.9944454
ENST00000546360	ENST00000335221	WIPI1	chr17	66446869	-	BPTF	chr17	65955657	+	0.000325143	0.9996749
ENST00000546360	ENST00000321892	WIPI1	chr17	66446869	-	BPTF	chr17	65955657	+	0.000325143	0.9996749
ENST00000546360	ENST00000306378	WIPI1	chr17	66446869	-	BPTF	chr17	65955657	+	0.000757643	0.9992424
ENST00000546360	ENST00000424123	WIPI1	chr17	66446869	-	BPTF	chr17	65955657	+	0.003886626	0.9961133

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for WIPI1-BPTF

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
WIPI1	chr17	66446869	BPTF	chr17	65955657	308	91	SYSSNILSIRLNRQEELKRDLKIKKE
WIPI1	chr17	66446869	BPTF	chr17	65955657	333	110	SYSSNILSIRLNRQEELKRDLKIKKE

Top

Potential FusionNeoAntigen Information of WIPI1-BPTF in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

WIPI1-BPTF_66446869_65955657.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B27:04	IRLNRQEEL	0.9998	0.6692	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B27:05	IRLNRQEEL	0.9998	0.8326	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B14:01	IRLNRQEEL	0.9964	0.7068	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B14:02	IRLNRQEEL	0.9964	0.7068	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B39:01	IRLNRQEEL	0.9879	0.9367	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B38:02	IRLNRQEEL	0.9536	0.9575	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B39:13	RQEELKRDL	0.6468	0.8052	12	21
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B13:01	RQEELKRDL	0.6442	0.8821	12	21
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:05	IRLNRQEEL	0.9975	0.9623	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:95	IRLNRQEEL	0.9947	0.6984	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:27	IRLNRQEEL	0.9931	0.934	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B39:09	IRLNRQEEL	0.9918	0.6853	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:29	IRLNRQEEL	0.9899	0.9497	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:13	IRLNRQEEL	0.9885	0.8796	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B27:03	IRLNRQEEL	0.987	0.8555	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B39:12	IRLNRQEEL	0.9845	0.9421	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:46	IRLNRQEEL	0.9824	0.8093	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:19	IRLNRQEEL	0.9565	0.7096	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:10	IRLNRQEEL	0.9538	0.932	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:67	IRLNRQEEL	0.9536	0.9115	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:80	IRLNRQEEL	0.9536	0.9115	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B39:08	RQEELKRDL	0.6927	0.8225	12	21
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B14:03	IRLNRQEEL	0.6393	0.7859	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C12:16	IRLNRQEEL	0.2226	0.9588	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B27:10	IRLNRQEEL	0.9998	0.8377	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B27:08	IRLNRQEEL	0.9998	0.6932	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B27:06	IRLNRQEEL	0.9997	0.6492	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B27:09	IRLNRQEEL	0.9997	0.7755	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:01	IRLNRQEEL	0.9963	0.6688	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B39:31	IRLNRQEEL	0.9879	0.9372	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:17	IRLNRQEEL	0.9858	0.9542	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C06:08	IRLNRQEEL	0.9802	0.9833	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:04	IRLNRQEEL	0.9623	0.9564	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:02	IRLNRQEEL	0.9536	0.9115	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C07:22	IRLNRQEEL	0.9285	0.7618	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-B39:02	RQEELKRDL	0.7606	0.8045	12	21
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C06:06	IRLNRQEEL	0.5084	0.9895	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C06:17	IRLNRQEEL	0.4593	0.9941	8	17
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	HLA-C06:02	IRLNRQEEL	0.4593	0.9941	8	17

Top

Potential FusionNeoAntigen Information of WIPI1-BPTF in HLA II

WIPI1-BPTF_66446869_65955657.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0301	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0303	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0303	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0303	NILSIRLNRQEELKR	4	19
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0303	LSIRLNRQEELKRDL	6	21
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0307	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0313	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0318	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0320	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0322	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0328	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0330	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0332	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0334	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0336	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0338	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0338	NILSIRLNRQEELKR	4	19
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0338	LSIRLNRQEELKRDL	6	21
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0344	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0346	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0348	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0350	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0352	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-0354	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-1107	NRQEELKRDLKIKKE	11	26
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-1438	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-1438	NILSIRLNRQEELKR	4	19
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-1439	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-1448	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-1449	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-1450	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-1450	NILSIRLNRQEELKR	4	19
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-1470	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-1475	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-1476	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-1479	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-1493	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB1-1493	NILSIRLNRQEELKR	4	19
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB3-0201	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB3-0204	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB3-0224	ILSIRLNRQEELKRD	5	20
WIPI1-BPTF	chr17	66446869	chr17	65955657	333	DRB3-0301	ILSIRLNRQEELKRD	5	20

Top

Fusion breakpoint peptide structures of WIPI1-BPTF

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5635	LSIRLNRQEELKRD	WIPI1	BPTF	chr17	66446869	chr17	65955657	333

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of WIPI1-BPTF

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5635	LSIRLNRQEELKRD	-7.9962	-8.1096
HLA-B14:02	3BVN	5635	LSIRLNRQEELKRD	-5.70842	-6.74372
HLA-B52:01	3W39	5635	LSIRLNRQEELKRD	-6.83737	-6.95077
HLA-B52:01	3W39	5635	LSIRLNRQEELKRD	-4.4836	-5.5189
HLA-A11:01	4UQ2	5635	LSIRLNRQEELKRD	-10.0067	-10.1201
HLA-A11:01	4UQ2	5635	LSIRLNRQEELKRD	-9.03915	-10.0745
HLA-A24:02	5HGA	5635	LSIRLNRQEELKRD	-6.56204	-6.67544
HLA-A24:02	5HGA	5635	LSIRLNRQEELKRD	-5.42271	-6.45801
HLA-B44:05	3DX8	5635	LSIRLNRQEELKRD	-7.85648	-8.89178
HLA-B44:05	3DX8	5635	LSIRLNRQEELKRD	-5.3978	-5.5112
HLA-A02:01	6TDR	5635	LSIRLNRQEELKRD	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of WIPI1-BPTF

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
WIPI1-BPTF	chr17	66446869	chr17	65955657	12	21	RQEELKRDL	CAAGAAGAGCTGAAGAGAGACCTGAAA
WIPI1-BPTF	chr17	66446869	chr17	65955657	8	17	IRLNRQEEL	AGGCTGAACCGGCAAGAAGAGCTGAAG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
WIPI1-BPTF	chr17	66446869	chr17	65955657	11	26	NRQEELKRDLKIKKE	CGGCAAGAAGAGCTGAAGAGAGACCTGAAAATTAAGAAAGAAAAA
WIPI1-BPTF	chr17	66446869	chr17	65955657	4	19	NILSIRLNRQEELKR	ATCTTGTCCATAAGGCTGAACCGGCAAGAAGAGCTGAAGAGAGAC
WIPI1-BPTF	chr17	66446869	chr17	65955657	5	20	ILSIRLNRQEELKRD	TTGTCCATAAGGCTGAACCGGCAAGAAGAGCTGAAGAGAGACCTG
WIPI1-BPTF	chr17	66446869	chr17	65955657	6	21	LSIRLNRQEELKRDL	TCCATAAGGCTGAACCGGCAAGAAGAGCTGAAGAGAGACCTGAAA

Top

Information of the samples that have these potential fusion neoantigens of WIPI1-BPTF

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	WIPI1-BPTF	chr17	66446869	ENST00000262139	chr17	65955657	ENST00000306378	TCGA-BH-A0DE-01A

Top

Potential target of CAR-T therapy development for WIPI1-BPTF

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to WIPI1-BPTF

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to WIPI1-BPTF

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)