Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:WRB-BACE2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: WRB-BACE2
	FusionPDB ID: 99392
	FusionGDB2.0 ID: 99392
		Hgene	Tgene
	Gene symbol	WRB	BACE2
	Gene ID	7485	25825
	Gene name	guided entry of tail-anchored proteins factor 1	beta-secretase 2
	Synonyms	CHD5\|WRB	AEPLC\|ALP56\|ASP1\|ASP21\|BAE2\|CDA13\|CEAP1\|DRAP
	Cytomap	21q22.2	21q22.2-q22.3
	Type of gene	protein-coding	protein-coding
	Description	tail-anchored protein insertion receptor WRBcongenital heart disease 5 proteintryptophan rich basic protein	beta-secretase 256 kDa aspartic-like proteaseDown syndrome region aspartic proteaseSLCO3A1/BACE2 fusionaspartyl protease 1beta-site APP-cleaving enzyme 2beta-site amyloid beta A4 precursor protein-cleaving enzyme 2memapsin-1membrane-associated asp
	Modification date	20200313	20200313
	UniProtAcc	.	Q9Y5Z0 Main function of 5'-partner protein: FUNCTION: Responsible for the proteolytic processing of the amyloid precursor protein (APP). Cleaves APP, between residues 690 and 691, leading to the generation and extracellular release of beta-cleaved soluble APP, and a corresponding cell-associated C-terminal fragment which is later released by gamma-secretase. It has also been shown that it can cleave APP between residues 671 and 672. Responsible also for the proteolytic processing of CLTRN in pancreatic beta cells (PubMed:21907142). {ECO:0000269\|PubMed:10591213, ECO:0000269\|PubMed:11083922, ECO:0000269\|PubMed:11423558, ECO:0000269\|PubMed:15857888, ECO:0000269\|PubMed:16816112, ECO:0000269\|PubMed:21907142}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000466787, ENST00000333781, ENST00000380708, ENST00000398753, ENST00000541890,	ENST00000328735, ENST00000330333, ENST00000347667, ENST00000466122,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 4 X 6=144	14 X 9 X 8=1008
	# samples	8	14
	** MAII score	log2(8/144*10)=-0.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(14/1008*10)=-2.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: WRB [Title/Abstract] AND BACE2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: WRB [Title/Abstract] AND BACE2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	WRB(40763762)-BACE2(42647298), # samples:1
Anticipated loss of major functional domain due to fusion event.	WRB-BACE2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. WRB-BACE2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. WRB-BACE2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. WRB-BACE2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. WRB-BACE2 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. WRB-BACE2 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	BACE2	GO:0006509	membrane protein ectodomain proteolysis	10591213

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr21:40763762/chr21:42647298)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across WRB (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across BACE2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000333781	WRB	chr21	40763762	+	ENST00000328735	BACE2	chr21	42647298	+	1704	477	42	533	163
ENST00000333781	WRB	chr21	40763762	+	ENST00000347667	BACE2	chr21	42647298	+	7625	477	42	533	163
ENST00000541890	WRB	chr21	40763762	+	ENST00000328735	BACE2	chr21	42647298	+	1594	367	31	423	130
ENST00000541890	WRB	chr21	40763762	+	ENST00000347667	BACE2	chr21	42647298	+	7515	367	5241	5639	132
ENST00000398753	WRB	chr21	40763762	+	ENST00000328735	BACE2	chr21	42647298	+	1560	333	99	389	96
ENST00000398753	WRB	chr21	40763762	+	ENST00000347667	BACE2	chr21	42647298	+	7481	333	5207	5605	132
ENST00000380708	WRB	chr21	40763762	+	ENST00000328735	BACE2	chr21	42647298	+	1552	325	22	381	119
ENST00000380708	WRB	chr21	40763762	+	ENST00000347667	BACE2	chr21	42647298	+	7473	325	5199	5597	132

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000333781	ENST00000328735	WRB	chr21	40763762	+	BACE2	chr21	42647298	+	0.007438407	0.99256164
ENST00000333781	ENST00000347667	WRB	chr21	40763762	+	BACE2	chr21	42647298	+	0.020456072	0.979544
ENST00000541890	ENST00000328735	WRB	chr21	40763762	+	BACE2	chr21	42647298	+	0.009720334	0.99027973
ENST00000541890	ENST00000347667	WRB	chr21	40763762	+	BACE2	chr21	42647298	+	0.020141406	0.97985864
ENST00000398753	ENST00000328735	WRB	chr21	40763762	+	BACE2	chr21	42647298	+	0.030714843	0.9692852
ENST00000398753	ENST00000347667	WRB	chr21	40763762	+	BACE2	chr21	42647298	+	0.11893239	0.88106763
ENST00000380708	ENST00000328735	WRB	chr21	40763762	+	BACE2	chr21	42647298	+	0.017907001	0.982093
ENST00000380708	ENST00000347667	WRB	chr21	40763762	+	BACE2	chr21	42647298	+	0.12228572	0.8777142

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for WRB-BACE2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
WRB	chr21	40763762	BACE2	chr21	42647298	325	100	KIKWVISVAFYVLQKLQVLQCLKFPG
WRB	chr21	40763762	BACE2	chr21	42647298	333	77	KIKWVISVAFYVLQKLQVLQCLKFPG
WRB	chr21	40763762	BACE2	chr21	42647298	367	111	KIKWVISVAFYVLQKLQVLQCLKFPG
WRB	chr21	40763762	BACE2	chr21	42647298	477	144	KIKWVISVAFYVLQKLQVLQCLKFPG

Top

Potential FusionNeoAntigen Information of WRB-BACE2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

WRB-BACE2_40763762_42647298.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B08:01	VLQKLQVL	0.9967	0.6302	11	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B08:01	YVLQKLQVL	0.9982	0.524	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B15:17	VAFYVLQKL	0.9909	0.8688	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B15:16	VAFYVLQKL	0.9782	0.7282	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B52:01	VAFYVLQKL	0.9775	0.9067	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:21	YVLQKLQVL	0.9578	0.6676	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:30	YVLQKLQVL	0.9534	0.5321	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:24	YVLQKLQVL	0.9534	0.5321	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:67	YVLQKLQVL	0.9534	0.5321	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:60	YVLQKLQVL	0.9524	0.5049	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:11	YVLQKLQVL	0.9506	0.5577	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:04	YVLQKLQVL	0.9467	0.6465	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B14:02	YVLQKLQVL	0.9223	0.8417	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B14:01	YVLQKLQVL	0.9223	0.8417	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:29	YVLQKLQVL	0.9171	0.5354	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:20	YVLQKLQVL	0.8903	0.5336	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:38	YVLQKLQVL	0.886	0.623	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:16	YVLQKLQVL	0.8491	0.5309	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:13	YVLQKLQVL	0.7752	0.6628	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:27	YVLQKLQVL	0.7697	0.5228	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B13:01	YVLQKLQVL	0.1641	0.9518	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:07	VAFYVLQKL	0.9992	0.972	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C15:06	VAFYVLQKL	0.9989	0.887	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C15:04	VAFYVLQKL	0.9989	0.857	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:19	VAFYVLQKL	0.9989	0.9816	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B42:02	YVLQKLQVL	0.9989	0.5162	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:08	VAFYVLQKL	0.9988	0.8861	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:19	YVLQKLQVL	0.9987	0.9869	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C15:04	YVLQKLQVL	0.9984	0.8294	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:07	YVLQKLQVL	0.9984	0.9725	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:08	YVLQKLQVL	0.9979	0.8635	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C15:06	YVLQKLQVL	0.9977	0.8902	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C04:06	VAFYVLQKL	0.9955	0.8588	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C04:06	YVLQKLQVL	0.9908	0.9351	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C08:13	YVLQKLQVL	0.9855	0.9606	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C08:04	YVLQKLQVL	0.9855	0.9606	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C04:14	YVLQKLQVL	0.9832	0.9253	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C06:03	YVLQKLQVL	0.9811	0.9871	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C12:12	YVLQKLQVL	0.9788	0.8762	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C12:04	YVLQKLQVL	0.9765	0.991	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B51:07	VAFYVLQKL	0.9702	0.7713	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C12:12	VAFYVLQKL	0.9624	0.8845	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C06:03	VAFYVLQKL	0.9591	0.9904	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C12:04	VAFYVLQKL	0.9583	0.9925	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:07	YVLQKLQVL	0.9564	0.5336	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:01	YVLQKLQVL	0.9534	0.5321	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C12:16	YVLQKLQVL	0.9447	0.9635	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C08:13	VAFYVLQKL	0.939	0.9406	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C08:04	VAFYVLQKL	0.939	0.9406	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:14	VAFYVLQKL	0.8874	0.9549	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:05	YVLQKLQVL	0.8872	0.9354	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B15:04	YVLQKLQVL	0.8675	0.8723	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C08:03	YVLQKLQVL	0.8576	0.9811	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:13	YVLQKLQVL	0.8523	0.9077	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:10	YVLQKLQVL	0.8463	0.9266	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:80	YVLQKLQVL	0.8247	0.9238	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:67	YVLQKLQVL	0.8247	0.9238	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C02:06	YVLQKLQVL	0.8203	0.9686	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:46	YVLQKLQVL	0.8194	0.8634	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:14	YVLQKLQVL	0.8056	0.9594	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:29	YVLQKLQVL	0.8048	0.9255	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:19	YVLQKLQVL	0.7903	0.7227	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B14:03	YVLQKLQVL	0.7597	0.7505	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C01:17	YVLQKLQVL	0.7459	0.9353	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:27	YVLQKLQVL	0.7388	0.946	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B15:04	LQKLQVLQC	0.7077	0.8364	12	21
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:95	YVLQKLQVL	0.6954	0.7171	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C02:06	VAFYVLQKL	0.6563	0.9713	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B39:10	YVLQKLQVL	0.6366	0.8482	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C08:03	VAFYVLQKL	0.5405	0.9757	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C01:30	YVLQKLQVL	0.439	0.97	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:05	FYVLQKLQV	0.2989	0.9475	9	18
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:29	FYVLQKLQV	0.1496	0.868	9	18
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C12:16	FYVLQKLQV	0.1464	0.9472	9	18
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:13	FYVLQKLQV	0.0979	0.8802	9	18
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B08:18	VLQKLQVL	0.9967	0.6302	11	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B08:12	VLQKLQVL	0.942	0.7291	11	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C14:03	AFYVLQKL	0.8099	0.9322	8	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C14:02	AFYVLQKL	0.8099	0.9322	8	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:04	YVLQKLQVL	0.999	0.989	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:03	YVLQKLQVL	0.999	0.989	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C15:09	VAFYVLQKL	0.9989	0.857	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:02	VAFYVLQKL	0.9988	0.9655	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:04	VAFYVLQKL	0.9988	0.9827	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:03	VAFYVLQKL	0.9988	0.9827	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:67	YVLQKLQVL	0.9985	0.9817	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C15:05	VAFYVLQKL	0.9984	0.9129	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C15:09	YVLQKLQVL	0.9984	0.8294	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:67	VAFYVLQKL	0.9983	0.9725	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B08:18	YVLQKLQVL	0.9982	0.524	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C15:02	VAFYVLQKL	0.9982	0.8562	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:05	VAFYVLQKL	0.9979	0.9029	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:17	VAFYVLQKL	0.9978	0.9647	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:17	YVLQKLQVL	0.9978	0.9707	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:05	YVLQKLQVL	0.9974	0.9075	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C15:05	YVLQKLQVL	0.9968	0.898	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C15:02	YVLQKLQVL	0.9962	0.84	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C16:04	YVLQKLQVL	0.9927	0.9665	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C16:01	YVLQKLQVL	0.9886	0.9661	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C12:03	YVLQKLQVL	0.9877	0.9716	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C04:04	YVLQKLQVL	0.9866	0.9104	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C06:02	YVLQKLQVL	0.9861	0.9899	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C06:17	YVLQKLQVL	0.9861	0.9899	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C16:02	YVLQKLQVL	0.9848	0.9846	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:06	YVLQKLQVL	0.9755	0.9884	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:04	YVLQKLQVL	0.975	0.9574	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A30:01	SVAFYVLQK	0.974	0.6239	6	15
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C06:06	YVLQKLQVL	0.9731	0.9856	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:02	YVLQKLQVL	0.9678	0.9699	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C16:04	VAFYVLQKL	0.9665	0.973	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C12:03	VAFYVLQKL	0.9649	0.9728	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:06	VAFYVLQKL	0.9643	0.9832	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:14	YVLQKLQVL	0.9592	0.5949	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:06	YVLQKLQVL	0.9578	0.6676	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C16:02	VAFYVLQKL	0.9484	0.988	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C12:02	YVLQKLQVL	0.9444	0.968	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C06:02	VAFYVLQKL	0.9374	0.9915	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C06:17	VAFYVLQKL	0.9374	0.9915	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:22	YVLQKLQVL	0.9353	0.6872	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-A02:03	YVLQKLQVL	0.93	0.6339	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C16:01	VAFYVLQKL	0.9231	0.9638	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B08:12	YVLQKLQVL	0.9207	0.5976	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B35:13	VAFYVLQKL	0.8877	0.9021	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B15:73	YVLQKLQVL	0.8833	0.9217	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C12:02	VAFYVLQKL	0.8736	0.9635	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:17	YVLQKLQVL	0.8582	0.9492	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C08:01	YVLQKLQVL	0.8576	0.9811	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C18:01	YVLQKLQVL	0.8544	0.9208	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B35:13	YVLQKLQVL	0.8351	0.8898	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C06:08	YVLQKLQVL	0.8295	0.9883	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C02:10	YVLQKLQVL	0.8256	0.976	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C02:02	YVLQKLQVL	0.8256	0.976	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:02	YVLQKLQVL	0.8247	0.9238	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B15:30	YVLQKLQVL	0.7901	0.8621	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C06:08	VAFYVLQKL	0.7815	0.9893	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C01:03	YVLQKLQVL	0.7551	0.8744	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C01:02	YVLQKLQVL	0.7333	0.9312	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B07:13	YVLQKLQVL	0.7094	0.8237	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:01	YVLQKLQVL	0.6958	0.7035	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C17:01	VAFYVLQKL	0.6435	0.8551	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C02:10	VAFYVLQKL	0.6237	0.9802	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C02:02	VAFYVLQKL	0.6237	0.9802	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C17:01	YVLQKLQVL	0.5727	0.9018	10	19
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C08:01	VAFYVLQKL	0.5405	0.9757	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C04:04	FYVLQKLQV	0.4016	0.8244	9	18
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C06:02	FYVLQKLQV	0.3549	0.9858	9	18
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C06:17	FYVLQKLQV	0.3549	0.9858	9	18
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C06:08	FYVLQKLQV	0.2258	0.9836	9	18
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-B07:13	VAFYVLQKL	0.1985	0.7748	7	16
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C06:06	FYVLQKLQV	0.1625	0.9816	9	18
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:17	FYVLQKLQV	0.1312	0.9406	9	18
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C03:67	FYVLQKLQV	0.0983	0.9821	9	18
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C07:04	FYVLQKLQV	0.088	0.8983	9	18
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C14:02	FYVLQKLQV	0.0637	0.9388	9	18
WRB-BACE2	chr21	40763762	chr21	42647298	477	HLA-C14:03	FYVLQKLQV	0.0637	0.9388	9	18

Top

Potential FusionNeoAntigen Information of WRB-BACE2 in HLA II

WRB-BACE2_40763762_42647298.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
WRB-BACE2	chr21	40763762	chr21	42647298	477	DRB1-0704	KIKWVISVAFYVLQK	0	15

Top

Fusion breakpoint peptide structures of WRB-BACE2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9138	SVAFYVLQKLQVLQ	WRB	BACE2	chr21	40763762	chr21	42647298	477

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of WRB-BACE2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9138	SVAFYVLQKLQVLQ	-7.15543	-7.26883
HLA-B14:02	3BVN	9138	SVAFYVLQKLQVLQ	-4.77435	-5.80965
HLA-B52:01	3W39	9138	SVAFYVLQKLQVLQ	-6.80875	-6.92215
HLA-B52:01	3W39	9138	SVAFYVLQKLQVLQ	-4.20386	-5.23916
HLA-A11:01	4UQ2	9138	SVAFYVLQKLQVLQ	-7.5194	-8.5547
HLA-A11:01	4UQ2	9138	SVAFYVLQKLQVLQ	-6.9601	-7.0735
HLA-A24:02	5HGA	9138	SVAFYVLQKLQVLQ	-7.52403	-7.63743
HLA-A24:02	5HGA	9138	SVAFYVLQKLQVLQ	-5.82433	-6.85963
HLA-B27:05	6PYJ	9138	SVAFYVLQKLQVLQ	-3.28285	-4.31815
HLA-B44:05	3DX8	9138	SVAFYVLQKLQVLQ	-5.91172	-6.94702
HLA-B44:05	3DX8	9138	SVAFYVLQKLQVLQ	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of WRB-BACE2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
WRB-BACE2	chr21	40763762	chr21	42647298	10	19	YVLQKLQVL	GTATTGCAGAAATTGCAGGTGCTGCAG
WRB-BACE2	chr21	40763762	chr21	42647298	11	19	VLQKLQVL	TTGCAGAAATTGCAGGTGCTGCAG
WRB-BACE2	chr21	40763762	chr21	42647298	12	21	LQKLQVLQC	CAGAAATTGCAGGTGCTGCAGTGTCTG
WRB-BACE2	chr21	40763762	chr21	42647298	6	15	SVAFYVLQK	GTCGCTTTCTACGTATTGCAGAAATTG
WRB-BACE2	chr21	40763762	chr21	42647298	7	16	VAFYVLQKL	GCTTTCTACGTATTGCAGAAATTGCAG
WRB-BACE2	chr21	40763762	chr21	42647298	8	16	AFYVLQKL	TTCTACGTATTGCAGAAATTGCAG
WRB-BACE2	chr21	40763762	chr21	42647298	9	18	FYVLQKLQV	TACGTATTGCAGAAATTGCAGGTGCTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
WRB-BACE2	chr21	40763762	chr21	42647298	0	15	KIKWVISVAFYVLQK	ATAAAATGGGTGATAAGTGTCGCTTTCTACGTATTGCAGAAATTG

Top

Information of the samples that have these potential fusion neoantigens of WRB-BACE2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
PRAD	WRB-BACE2	chr21	40763762	ENST00000333781	chr21	42647298	ENST00000328735	TCGA-G9-6353-01A

Top

Potential target of CAR-T therapy development for WRB-BACE2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Hgene

WRB

chr21:40763762

chr21:42647298

ENST00000333781

9_29

112

175.0

Transmembrane

Helical

Hgene

WRB

chr21:40763762

chr21:42647298

ENST00000380708

9_29

141.0

Transmembrane

Helical

Hgene

WRB

chr21:40763762

chr21:42647298

ENST00000398753

9_29

141.0

Transmembrane

Helical

Tgene

BACE2

chr21:40763762

chr21:42647298

ENST00000328735

474_494

397.0

Transmembrane

Helical

Tgene

BACE2

chr21:40763762

chr21:42647298

ENST00000330333

474_494

519.0

Transmembrane

Helical

Tgene

BACE2

chr21:40763762

chr21:42647298

ENST00000347667

474_494

469.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to WRB-BACE2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to WRB-BACE2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)