Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:YBEY-ARID1A

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: YBEY-ARID1A
	FusionPDB ID: 99918
	FusionGDB2.0 ID: 99918
		Hgene	Tgene
	Gene symbol	YBEY	ARID1A
	Gene ID	54059	8289
	Gene name	ybeY metalloendoribonuclease	AT-rich interaction domain 1A
	Synonyms	C21orf57	B120\|BAF250\|BAF250a\|BM029\|C1orf4\|CSS2\|ELD\|MRD14\|OSA1\|P270\|SMARCF1\|hELD\|hOSA1
	Cytomap	21q22.3	1p36.11
	Type of gene	protein-coding	protein-coding
	Description	endoribonuclease YbeYputative metalloprotease C21orf57putative ribonucleaserRNA maturation factor homologybeY metallopeptidase (putative)	AT-rich interactive domain-containing protein 1AARID domain-containing protein 1AAT rich interactive domain 1A (SWI-like)BRG1-associated factor 250aOSA1 nuclear proteinSWI-like proteinSWI/SNF complex protein p270SWI/SNF-related, matrix-associated,
	Modification date	20200313	20200329
	UniProtAcc	.	O14497 Main function of 5'-partner protein: FUNCTION: Involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Component of SWI/SNF chromatin remodeling complexes that carry out key enzymatic activities, changing chromatin structure by altering DNA-histone contacts within a nucleosome in an ATP-dependent manner. Binds DNA non-specifically. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a postmitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to postmitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth (By similarity). {ECO:0000250\|UniProtKB:A2BH40, ECO:0000303\|PubMed:12672490, ECO:0000303\|PubMed:22952240, ECO:0000303\|PubMed:26601204}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000329319, ENST00000339195, ENST00000397691, ENST00000397692, ENST00000397694, ENST00000397701,	ENST00000540690, ENST00000324856, ENST00000374152, ENST00000457599,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	1 X 1 X 1=1	13 X 16 X 6=1248
	# samples	1	17
	** MAII score	log2(1/1*10)=3.32192809488736	log2(17/1248*10)=-2.87601128272455 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: YBEY [Title/Abstract] AND ARID1A [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: YBEY [Title/Abstract] AND ARID1A [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	YBEY(47716146)-ARID1A(27057762), # samples:1
Anticipated loss of major functional domain due to fusion event.	YBEY-ARID1A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. YBEY-ARID1A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	ARID1A	GO:0006337	nucleosome disassembly	8895581
Tgene	ARID1A	GO:0006338	chromatin remodeling	11726552
Tgene	ARID1A	GO:0030520	intracellular estrogen receptor signaling pathway	12200431
Tgene	ARID1A	GO:0030521	androgen receptor signaling pathway	12200431
Tgene	ARID1A	GO:0042921	glucocorticoid receptor signaling pathway	12200431
Tgene	ARID1A	GO:0045893	positive regulation of transcription, DNA-templated	12200431

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr21:47716146/chr1:27057762)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across YBEY (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ARID1A (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000397701	YBEY	chr21	47716146	+	ENST00000324856	ARID1A	chr1	27057762	+	7267	531	60	5918	1952
ENST00000397701	YBEY	chr21	47716146	+	ENST00000457599	ARID1A	chr1	27057762	+	5329	531	60	5267	1735
ENST00000397701	YBEY	chr21	47716146	+	ENST00000374152	ARID1A	chr1	27057762	+	5919	531	60	5918	1952
ENST00000397694	YBEY	chr21	47716146	+	ENST00000324856	ARID1A	chr1	27057762	+	7085	349	13	5736	1907
ENST00000397694	YBEY	chr21	47716146	+	ENST00000457599	ARID1A	chr1	27057762	+	5147	349	13	5085	1690
ENST00000397694	YBEY	chr21	47716146	+	ENST00000374152	ARID1A	chr1	27057762	+	5737	349	13	5736	1908
ENST00000397692	YBEY	chr21	47716146	+	ENST00000324856	ARID1A	chr1	27057762	+	6956	220	13	5607	1864
ENST00000397692	YBEY	chr21	47716146	+	ENST00000457599	ARID1A	chr1	27057762	+	5018	220	13	4956	1647
ENST00000397692	YBEY	chr21	47716146	+	ENST00000374152	ARID1A	chr1	27057762	+	5608	220	13	5607	1865
ENST00000329319	YBEY	chr21	47716146	+	ENST00000324856	ARID1A	chr1	27057762	+	7542	806	287	6193	1968
ENST00000329319	YBEY	chr21	47716146	+	ENST00000457599	ARID1A	chr1	27057762	+	5604	806	287	5542	1751
ENST00000329319	YBEY	chr21	47716146	+	ENST00000374152	ARID1A	chr1	27057762	+	6194	806	287	6193	1969
ENST00000339195	YBEY	chr21	47716146	+	ENST00000324856	ARID1A	chr1	27057762	+	7413	677	287	6064	1925
ENST00000339195	YBEY	chr21	47716146	+	ENST00000457599	ARID1A	chr1	27057762	+	5475	677	287	5413	1708
ENST00000339195	YBEY	chr21	47716146	+	ENST00000374152	ARID1A	chr1	27057762	+	6065	677	287	6064	1926
ENST00000397691	YBEY	chr21	47716146	+	ENST00000324856	ARID1A	chr1	27057762	+	7287	551	26	5938	1970
ENST00000397691	YBEY	chr21	47716146	+	ENST00000457599	ARID1A	chr1	27057762	+	5349	551	26	5287	1753
ENST00000397691	YBEY	chr21	47716146	+	ENST00000374152	ARID1A	chr1	27057762	+	5939	551	26	5938	1971

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000397701	ENST00000324856	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.003209668	0.99679035
ENST00000397701	ENST00000457599	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.006287613	0.99371237
ENST00000397701	ENST00000374152	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.007685851	0.99231416
ENST00000397694	ENST00000324856	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.003377627	0.9966223
ENST00000397694	ENST00000457599	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.006749898	0.99325013
ENST00000397694	ENST00000374152	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.007550878	0.99244916
ENST00000397692	ENST00000324856	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.003519565	0.9964804
ENST00000397692	ENST00000457599	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.006980725	0.9930193
ENST00000397692	ENST00000374152	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.007615468	0.99238455
ENST00000329319	ENST00000324856	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.003454091	0.996546
ENST00000329319	ENST00000457599	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.006217655	0.99378234
ENST00000329319	ENST00000374152	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.008020218	0.99197984
ENST00000339195	ENST00000324856	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.003543645	0.9964563
ENST00000339195	ENST00000457599	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.006406033	0.993594
ENST00000339195	ENST00000374152	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.008017844	0.99198216
ENST00000397691	ENST00000324856	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.003186745	0.99681324
ENST00000397691	ENST00000457599	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.006212464	0.9937875
ENST00000397691	ENST00000374152	YBEY	chr21	47716146	+	ARID1A	chr1	27057762	+	0.007444246	0.9925558

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for YBEY-ARID1A

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
YBEY	chr21	47716146	ARID1A	chr1	27057762	220	69	LGFTHGTEAEWQQSQTPHAQPSYQQQ
YBEY	chr21	47716146	ARID1A	chr1	27057762	349	112	LGFTHGTEAEWQQSQTPHAQPSYQQQ
YBEY	chr21	47716146	ARID1A	chr1	27057762	531	157	LGFTHGTEAEWQQSQTPHAQPSYQQQ
YBEY	chr21	47716146	ARID1A	chr1	27057762	551	175	LGFTHGTEAEWQQSQTPHAQPSYQQQ
YBEY	chr21	47716146	ARID1A	chr1	27057762	677	130	LGFTHGTEAEWQQSQTPHAQPSYQQQ
YBEY	chr21	47716146	ARID1A	chr1	27057762	806	173	LGFTHGTEAEWQQSQTPHAQPSYQQQ

Top

Potential FusionNeoAntigen Information of YBEY-ARID1A in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

YBEY-ARID1A_47716146_27057762.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B45:01	AEWQQSQTP	0.9956	0.9931	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B40:02	AEWQQSQTP	0.9945	0.552	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B50:02	AEWQQSQTP	0.9902	0.8579	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B44:05	AEWQQSQTP	0.8445	0.8441	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B44:03	AEWQQSQTP	0.7168	0.9575	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B41:01	AEWQQSQTP	0.5848	0.9646	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B40:05	AEWQQSQTP	0.5531	0.7276	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B50:01	AEWQQSQTP	0.4341	0.9023	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B50:02	EAEWQQSQTP	0.8222	0.793	7	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B45:01	EAEWQQSQTP	0.7065	0.9724	7	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B45:01	AEWQQSQTPHA	0.9984	0.9901	8	19
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B50:02	AEWQQSQTPHA	0.9978	0.82	8	19
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B45:01	TEAEWQQSQTP	0.9965	0.9777	6	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B50:02	TEAEWQQSQTP	0.9912	0.8018	6	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B41:01	TEAEWQQSQTP	0.9875	0.9743	6	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B41:01	AEWQQSQTPHA	0.9176	0.9567	8	19
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B50:01	AEWQQSQTPHA	0.8379	0.8469	8	19
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B40:06	AEWQQSQTP	0.9954	0.968	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B44:09	AEWQQSQTP	0.8659	0.8118	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B40:03	AEWQQSQTP	0.8341	0.6594	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B44:09	AEWQQSQTPH	0.9798	0.7349	8	18
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B40:06	AEWQQSQTPHA	0.9996	0.9578	8	19
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B40:04	AEWQQSQTP	0.9505	0.9209	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B44:26	AEWQQSQTP	0.7168	0.9575	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B44:07	AEWQQSQTP	0.7168	0.9575	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B44:13	AEWQQSQTP	0.7168	0.9575	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B41:03	AEWQQSQTP	0.5506	0.8038	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B50:04	AEWQQSQTP	0.4341	0.9023	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B50:05	AEWQQSQTP	0.4341	0.9023	8	17
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B18:11	TEAEWQQSQ	0.2932	0.7089	6	15
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B18:06	TEAEWQQSQ	0.2429	0.7256	6	15
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B50:04	AEWQQSQTPHA	0.8379	0.8469	8	19
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	HLA-B50:05	AEWQQSQTPHA	0.8379	0.8469	8	19

Top

Potential FusionNeoAntigen Information of YBEY-ARID1A in HLA II

YBEY-ARID1A_47716146_27057762.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0401	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0401	TEAEWQQSQTPHAQP	6	21
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0407	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0407	TEAEWQQSQTPHAQP	6	21
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0419	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0433	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0433	TEAEWQQSQTPHAQP	6	21
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0434	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0434	TEAEWQQSQTPHAQP	6	21
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0435	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0438	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0438	TEAEWQQSQTPHAQP	6	21
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0461	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0463	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0463	TEAEWQQSQTPHAQP	6	21
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0464	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0464	TEAEWQQSQTPHAQP	6	21
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0472	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0472	TEAEWQQSQTPHAQP	6	21
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0474	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0474	TEAEWQQSQTPHAQP	6	21
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0475	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0475	TEAEWQQSQTPHAQP	6	21
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0476	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0476	TEAEWQQSQTPHAQP	6	21
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB1-0902	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB3-0215	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB3-0215	TEAEWQQSQTPHAQP	6	21
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB3-0217	EAEWQQSQTPHAQPS	7	22
YBEY-ARID1A	chr21	47716146	chr1	27057762	806	DRB3-0217	TEAEWQQSQTPHAQP	6	21

Top

Fusion breakpoint peptide structures of YBEY-ARID1A

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9291	TEAEWQQSQTPHAQ	YBEY	ARID1A	chr21	47716146	chr1	27057762	806

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of YBEY-ARID1A

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9291	TEAEWQQSQTPHAQ	-7.02924	-7.14264
HLA-B14:02	3BVN	9291	TEAEWQQSQTPHAQ	-3.38077	-4.41607
HLA-B52:01	3W39	9291	TEAEWQQSQTPHAQ	-6.41355	-6.52695
HLA-B52:01	3W39	9291	TEAEWQQSQTPHAQ	-4.44188	-5.47718
HLA-A24:02	5HGA	9291	TEAEWQQSQTPHAQ	-7.76595	-8.80125
HLA-A24:02	5HGA	9291	TEAEWQQSQTPHAQ	-7.30892	-7.42232
HLA-B44:05	3DX8	9291	TEAEWQQSQTPHAQ	-5.65486	-5.76826
HLA-B44:05	3DX8	9291	TEAEWQQSQTPHAQ	-2.95775	-3.99305

Top

Vaccine Design for the FusionNeoAntigens of YBEY-ARID1A

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
YBEY-ARID1A	chr21	47716146	chr1	27057762	6	15	TEAEWQQSQ	ACGGAGGCAGAGTGGCAGCAGTCCCAG
YBEY-ARID1A	chr21	47716146	chr1	27057762	6	17	TEAEWQQSQTP	ACGGAGGCAGAGTGGCAGCAGTCCCAGACCCCT
YBEY-ARID1A	chr21	47716146	chr1	27057762	7	17	EAEWQQSQTP	GAGGCAGAGTGGCAGCAGTCCCAGACCCCT
YBEY-ARID1A	chr21	47716146	chr1	27057762	8	17	AEWQQSQTP	GCAGAGTGGCAGCAGTCCCAGACCCCT
YBEY-ARID1A	chr21	47716146	chr1	27057762	8	18	AEWQQSQTPH	GCAGAGTGGCAGCAGTCCCAGACCCCTCAT
YBEY-ARID1A	chr21	47716146	chr1	27057762	8	19	AEWQQSQTPHA	GCAGAGTGGCAGCAGTCCCAGACCCCTCATGCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
YBEY-ARID1A	chr21	47716146	chr1	27057762	6	21	TEAEWQQSQTPHAQP	ACGGAGGCAGAGTGGCAGCAGTCCCAGACCCCTCATGCCCAACCT
YBEY-ARID1A	chr21	47716146	chr1	27057762	7	22	EAEWQQSQTPHAQPS	GAGGCAGAGTGGCAGCAGTCCCAGACCCCTCATGCCCAACCTTCG

Top

Information of the samples that have these potential fusion neoantigens of YBEY-ARID1A

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	YBEY-ARID1A	chr21	47716146	ENST00000329319	chr1	27057762	ENST00000324856	TCGA-BR-8296-01A

Top

Potential target of CAR-T therapy development for YBEY-ARID1A

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to YBEY-ARID1A

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to YBEY-ARID1A

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	ARID1A	C0024623	Malignant neoplasm of stomach	3	CTD_human
Tgene	ARID1A	C0038356	Stomach Neoplasms	3	CTD_human
Tgene	ARID1A	C1708349	Hereditary Diffuse Gastric Cancer	3	CTD_human
Tgene	ARID1A	C2239176	Liver carcinoma	3	CTD_human
Tgene	ARID1A	C0033578	Prostatic Neoplasms	2	CTD_human
Tgene	ARID1A	C0376358	Malignant neoplasm of prostate	2	CTD_human
Tgene	ARID1A	C0001418	Adenocarcinoma	1	CTD_human
Tgene	ARID1A	C0005684	Malignant neoplasm of urinary bladder	1	CTD_human
Tgene	ARID1A	C0005695	Bladder Neoplasm	1	CTD_human
Tgene	ARID1A	C0006413	Burkitt Lymphoma	1	CTD_human
Tgene	ARID1A	C0007138	Carcinoma, Transitional Cell	1	CTD_human
Tgene	ARID1A	C0009402	Colorectal Carcinoma	1	CTD_human
Tgene	ARID1A	C0009404	Colorectal Neoplasms	1	CTD_human
Tgene	ARID1A	C0010606	Adenoid Cystic Carcinoma	1	CTD_human
Tgene	ARID1A	C0014170	Endometrial Neoplasms	1	CTD_human
Tgene	ARID1A	C0027708	Nephroblastoma	1	CTD_human
Tgene	ARID1A	C0027819	Neuroblastoma	1	CTD_human
Tgene	ARID1A	C0036920	Sezary Syndrome	1	CTD_human
Tgene	ARID1A	C0079772	T-Cell Lymphoma	1	CTD_human
Tgene	ARID1A	C0079773	Lymphoma, T-Cell, Cutaneous	1	CTD_human
Tgene	ARID1A	C0205641	Adenocarcinoma, Basal Cell	1	CTD_human
Tgene	ARID1A	C0205642	Adenocarcinoma, Oxyphilic	1	CTD_human
Tgene	ARID1A	C0205643	Carcinoma, Cribriform	1	CTD_human
Tgene	ARID1A	C0205644	Carcinoma, Granular Cell	1	CTD_human
Tgene	ARID1A	C0205645	Adenocarcinoma, Tubular	1	CTD_human
Tgene	ARID1A	C0206656	Embryonal Rhabdomyosarcoma	1	CTD_human
Tgene	ARID1A	C0206698	Cholangiocarcinoma	1	CTD_human
Tgene	ARID1A	C0265338	Coffin-Siris syndrome	1	CTD_human;GENOMICS_ENGLAND
Tgene	ARID1A	C0279628	Adenocarcinoma Of Esophagus	1	CTD_human
Tgene	ARID1A	C0343640	African Burkitt's lymphoma	1	CTD_human
Tgene	ARID1A	C0345905	Intrahepatic Cholangiocarcinoma	1	CTD_human
Tgene	ARID1A	C0376407	Granulomatous Slack Skin	1	CTD_human
Tgene	ARID1A	C0476089	Endometrial Carcinoma	1	CTD_human
Tgene	ARID1A	C0920269	Microsatellite Instability	1	CTD_human
Tgene	ARID1A	C1721098	Replication Error Phenotype	1	CTD_human
Tgene	ARID1A	C2930471	Bilateral Wilms Tumor	1	CTD_human
Tgene	ARID1A	C2931822	Nasopharyngeal carcinoma	1	CTD_human
Tgene	ARID1A	C3805278	Extrahepatic Cholangiocarcinoma	1	CTD_human
Tgene	ARID1A	C4721444	Burkitt Leukemia	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)