|
||||||
|
Translation Factor: WARS2 (NCBI Gene ID:10352) |
|
Gene Summary |
| Gene Information | Gene Name: WARS2 | Gene ID: 10352 | Gene Symbol | WARS2 | Gene ID | 10352 |
| Gene Name | tryptophanyl tRNA synthetase 2, mitochondrial | |
| Synonyms | NEMMLAS|TrpRS|mtTrpRS | |
| Cytomap | 1p12 | |
| Type of Gene | protein-coding | |
| Description | tryptophan--tRNA ligase, mitochondrial(Mt)TrpRStryptophan tRNA ligase 2, mitochondrial | |
| Modification date | 20200313 | |
| UniProtAcc | Q9UGM6 | |
Child GO biological process term(s) under GO:0006412 |
| GO ID | GO term |
| GO:0032543 | Mitochondrial translation |
| GO:0006418 | tRNA aminoacylation for protein translation |
| GO:0006412 | Translation |
Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
Inferred gene age of translation factor. |
| Gene | Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25 |
| WARS2 | >1119.25 |
Top |
|
We searched PubMed using 'WARS2[title] AND translation [title] AND human.' |
| Gene | Title | PMID |
| WARS2 | . | . |
Top |
|
Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. For more annotations, please visit our ExonSkipDB. |
![]() |
Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure. * Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser. |
| ENST | Exon skip start (DNA) | Exon Skip end (DNA) | ORF |
| ENST00000235521 | 119584886 | 119584972 | Frame-shift |
| ENST00000235521 | 119618972 | 119619230 | In-frame |
Exon skipping position in the amino acid sequence. |
| ENST | Exon skip start (DNA) | Exon Skip end (DNA) | Len(transcript seq) | Exon skip start (mRNA) | Exon Skip end (mRNA) | Len(amino acid seq) | Exon skip start (AA) | Exon Skip end (AA) |
| ENST00000235521 | 119618972 | 119619230 | 2817 | 118 | 375 | 360 | 30 | 116 |
Potentially (partially) lost protein functional features of UniProt. |
| UniProtAcc | Exon skip start (AA) | Exon Skip end (AA) | Function feature start (AA) | Function feature end (AA) | Functional feature type | Functional feature desc. |
| Q9UGM6 | 30 | 116 | 19 | 360 | Chain | ID=PRO_0000035828;Note=Tryptophan--tRNA ligase%2C mitochondrial |
| Q9UGM6 | 30 | 116 | 48 | 51 | Nucleotide binding | Note=ATP;Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5EKD |
| Q9UGM6 | 30 | 116 | 42 | 42 | Binding site | Note=ATP;Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5EKD |
| Q9UGM6 | 30 | 116 | 45 | 45 | Natural variant | ID=VAR_079734;Note=In NEMMLAS. G->V;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:28905505;Dbxref=PMID:28905505 |
| Q9UGM6 | 30 | 116 | 50 | 50 | Natural variant | ID=VAR_028848;Note=G->S;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:15489334;Dbxref=dbSNP:rs11552864,PMID:15489334 |
| Q9UGM6 | 30 | 116 | 77 | 77 | Natural variant | ID=VAR_079735;Note=In NEMMLAS%3B unknown pathological significance. H->Q;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:28905505;Dbxref=dbSNP:rs766501807,PMID:28905505 |
| Q9UGM6 | 30 | 116 | 100 | 100 | Natural variant | ID=VAR_079736;Note=In NEMMLAS. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:28650581;Dbxref=PMID:28650581 |
| Q9UGM6 | 30 | 116 | 37 | 41 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5EKD |
| Q9UGM6 | 30 | 116 | 43 | 45 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5EKD |
| Q9UGM6 | 30 | 116 | 49 | 54 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5EKD |
| Q9UGM6 | 30 | 116 | 56 | 65 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5EKD |
| Q9UGM6 | 30 | 116 | 69 | 73 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5EKD |
| Q9UGM6 | 30 | 116 | 75 | 78 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5EKD |
| Q9UGM6 | 30 | 116 | 85 | 102 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5EKD |
| Q9UGM6 | 30 | 116 | 106 | 108 | Turn | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5EKD |
| Q9UGM6 | 30 | 116 | 109 | 113 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5EKD |
| Q9UGM6 | 30 | 116 | 114 | 116 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:5EKD |
Top |
|
Gene expression level across TCGA pancancer |
![]() |
Gene expression level across GTEx pantissue |
![]() |
Expression level of gene isoforms across TCGA pancancer |
![]() |
Expression level of gene isoforms across GTEx pantissue |
![]() |
Cancer(tissue) type-specific expression level of Translation factor using z-score distriution |
![]() |
Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples) |
![]() |
| Cancer type | Translation factor | FC | adj.pval |
| PRAD | WARS2 | 2.22021907294155 | 3.33417295851411e-06 |
Top |
|
Translation factor expression regulation through miRNA binding |
| Cancer type | Gene | miRNA | TargetScan binding score (Context++ score percentile) | Coefficient | Pvalue |
| ESCA | WARS2 | hsa-miR-9-5p | 86 | -0.339546529419947 | 0.00247780535528675 |
Translation factor expression regulation through methylation in the promoter of Translation factor |
![]() |
| Cancer type | Gene | methyl group b | methyl group a | DEG pval | avg methyl in b | avg methyl in a | avg exp in b | avg exp in a |
Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation) |
![]() |
| Cancer type | Gene | methyl group b | methyl group a | DEG pval | avg methyl in b | avg methyl in a | avg exp in b | avg exp in a |
Translation factor expression regulation through copy number variation of Translation factor |
![]() |
| Cancer type | Gene | Coefficient | Pvalue |
Top |
|
Strongly correlated genes belong to cellular important gene groups with WARS2 (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green) |
![]() |
| Cancer type | Gene group | Translation factor | Correlated gene | Coefficient | Pvalue |
| KICH | Cell metabolism gene | WARS2 | SSR1 | 0.800267163 | 1.79E-21 |
| KICH | Epifactor | WARS2 | HDAC2 | 0.807604112 | 4.02E-22 |
| KICH | IUPHAR | WARS2 | HDAC2 | 0.807604112 | 4.02E-22 |
| KICH | TSG | WARS2 | IFT88 | 0.833433605 | 1.20E-24 |
Top |
|
Protein 3D structureVisit iCn3D. |
Top |
|
Protein-protein interaction networks * Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P)) |
![]() |
Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P)) |
![]() |
![]() * Edge colors based on TCGA cancer types. |
* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P)) |
![]() |
| Cancer type | Translation factor | Interacting protein coding gene | FC | adj.pval |
| STAD | WARS2 | LARS2 | -3.14243034518345 | 0.00019507110118866 |
| STAD | WARS2 | YARS | -6.49411565641968 | 0.000280400272458792 |
| KIRP | WARS2 | PARS2 | 1.16452168188224 | 0.000471815001219511 |
| HNSC | WARS2 | YARS | 1.29642872422682 | 0.000481783007217019 |
| THCA | WARS2 | LARS2 | 1.46480152873302 | 0.000495104848866816 |
| STAD | WARS2 | AARS | -1.37044043826934 | 0.000657554250210524 |
| BLCA | WARS2 | PARS2 | -2.53947468245316 | 0.002838134765625 |
| THCA | WARS2 | WARS | 2.95768973159174 | 0.00305071956645465 |
| HNSC | WARS2 | YARS2 | 1.51758504797514 | 0.00498432417884942 |
| KIRC | WARS2 | WARS | -3.93324665771133 | 0.00591357067334741 |
| STAD | WARS2 | CDH5 | 2.00605684119557 | 0.0148032568395138 |
| ESCA | WARS2 | YARS2 | -2.00710684466974 | 0.0185546875 |
| READ | WARS2 | WARS | -1.7125292902591 | 0.03125 |
| STAD | WARS2 | IARS2 | -1.36774073274524 | 0.0324882394634187 |
| PRAD | WARS2 | PARS2 | -1.46158282673459 | 0.0436765184075403 |
| LUAD | WARS2 | PARS2 | -3.49187010929807 | 1.06715530949094e-10 |
| BRCA | WARS2 | LARS2 | -5.48583270161281 | 1.12177735729832e-06 |
| THCA | WARS2 | YARS | -1.52851760350795 | 1.38467683131598e-09 |
| LUAD | WARS2 | SARS2 | -1.6825303693262 | 1.52668366875458e-07 |
| BRCA | WARS2 | IARS2 | 1.50870900515201 | 2.53632294696759e-14 |
| LUAD | WARS2 | LARS2 | -1.17851720308655 | 2.81164525558733e-06 |
| KICH | WARS2 | YARS | -2.00632816869948 | 2.98023223876953e-07 |
| LUSC | WARS2 | PARS2 | -2.93653902690081 | 3.1117120779415e-08 |
| BRCA | WARS2 | YARS | -2.58863291399932 | 3.63754942015711e-21 |
| LUSC | WARS2 | WARS | -1.79063789640973 | 4.0549719008113e-07 |
| KICH | WARS2 | LARS2 | 1.44112931619469 | 4.17232513427734e-06 |
| LUAD | WARS2 | WARS | -1.3247218686619 | 4.20890892730867e-05 |
| BRCA | WARS2 | CDH5 | -1.807083202754 | 4.22798866054525e-23 |
| LUAD | WARS2 | AARS | -6.1139400689607 | 4.40386642176516e-08 |
| LUAD | WARS2 | CDH5 | -2.18549136229301 | 4.67307812889392e-11 |
| KIRC | WARS2 | SARS2 | 1.02423405449982 | 8.65930768143138e-05 |
| STAD | WARS2 | NARS2 | -1.47625969382721 | 9.99853946268559e-05 |
Protein-protein interactors with this translation factor (BIOGRID-3.4.160) |
| PPI interactors with WARS2 |
| APP, RMND5A, Naa11, WARS2, EFTUD2, MRM1, PDK1, TRMT61B, KRAS, HSCB, C21orf33, C6orf203, GFM1, GRSF1, ICT1, MDH2, MRRF, MTIF2, MTIF3, PMPCB, SSBP1, TBRG4, TSFM, CLPP, COX8A, CS, PDHA1, |
Top |
|
Clinically associated variants from ClinVar. |
| Gene | Chr | Position | RefSeq | VarSeq | RefSeeq | VarType | Pathogenic | Disease | VarInfo |
| WARS2 | chr1 | 119575297 | C | G | single_nucleotide_variant | Benign | not_provided | SO:0001624|3_prime_UTR_variant | SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119575538 | A | G | single_nucleotide_variant | Benign | not_provided | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119575587 | C | A | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001587|nonsense,SO:0001624|3_prime_UTR_variant | SO:0001587|nonsense,SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119575601 | G | A | single_nucleotide_variant | Uncertain_significance | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119575679 | T | A | single_nucleotide_variant | Uncertain_significance | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures|Inborn_genetic_diseases|not_provided | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119575687 | C | T | single_nucleotide_variant | Benign | not_provided | SO:0001819|synonymous_variant,SO:0001624|3_prime_UTR_variant | SO:0001819|synonymous_variant,SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119575718 | G | A | single_nucleotide_variant | Uncertain_significance | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119575818 | C | G | single_nucleotide_variant | Benign | not_provided | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119575819 | CG | C | Deletion | Uncertain_significance | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures|Inborn_genetic_diseases | SO:0001589|frameshift_variant,SO:0001624|3_prime_UTR_variant | SO:0001589|frameshift_variant,SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119575826 | T | C | single_nucleotide_variant | Conflicting_interpretations_of_pathogenicity | not_provided | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119575838 | G | A | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119575863 | G | A | single_nucleotide_variant | Uncertain_significance | Inborn_genetic_diseases|not_provided | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119575902 | G | A | single_nucleotide_variant | Likely_pathogenic | not_provided | SO:0001587|nonsense,SO:0001624|3_prime_UTR_variant | SO:0001587|nonsense,SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119575933 | C | T | single_nucleotide_variant | Benign | not_provided | SO:0001819|synonymous_variant,SO:0001624|3_prime_UTR_variant | SO:0001819|synonymous_variant,SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119575934 | G | C | single_nucleotide_variant | Uncertain_significance | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant | SO:0001583|missense_variant,SO:0001624|3_prime_UTR_variant |
| WARS2 | chr1 | 119576730 | C | A | single_nucleotide_variant | Pathogenic | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures | SO:0001583|missense_variant,SO:0001587|nonsense | SO:0001583|missense_variant,SO:0001587|nonsense |
| WARS2 | chr1 | 119576820 | C | G | single_nucleotide_variant | Pathogenic | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures | SO:0001583|missense_variant | SO:0001583|missense_variant |
| WARS2 | chr1 | 119576904 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| WARS2 | chr1 | 119584915 | G | A | single_nucleotide_variant | Uncertain_significance | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures | SO:0001583|missense_variant,SO:0001627|intron_variant | SO:0001583|missense_variant,SO:0001627|intron_variant |
| WARS2 | chr1 | 119584919 | T | C | single_nucleotide_variant | Benign | not_provided | SO:0001819|synonymous_variant,SO:0001627|intron_variant | SO:0001819|synonymous_variant,SO:0001627|intron_variant |
| WARS2 | chr1 | 119584949 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001819|synonymous_variant,SO:0001627|intron_variant | SO:0001819|synonymous_variant,SO:0001627|intron_variant |
| WARS2 | chr1 | 119584950 | T | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001583|missense_variant,SO:0001627|intron_variant | SO:0001583|missense_variant,SO:0001627|intron_variant |
| WARS2 | chr1 | 119588230 | C | T | single_nucleotide_variant | Uncertain_significance | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures | SO:0001583|missense_variant | SO:0001583|missense_variant |
| WARS2 | chr1 | 119591855 | TGTCTGGGGCAGTCGGAGGACAACCTGGGCCACCAAGCGGCCCAACTCCAGGGGAAAACCATCTCCCTTCTGGCTCCCCCATCTGCTGTTTTCTCCGTATTTCAATAGTTTCTCTTTTCAGTCTCCTTTTGCTGGTTCCTCCCCTTTAACCTGACTTCTTAATTGCTGACACCCAGGTTTCAGTCTTTGTTTCTTCTATTGTTTTTTATACCCACTCCCTTTGCAATATCACATCATCTCACTGCTTTAAGTAAA | T | Deletion | Pathogenic | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures | SO:0001574|splice_acceptor_variant,SO:0001575|splice_donor_variant,SO:0001582|initiatior_codon_variant,SO:0001627|intron_variant | SO:0001574|splice_acceptor_variant,SO:0001575|splice_donor_variant,SO:0001582|initiatior_codon_variant,SO:0001627|intron_variant |
| WARS2 | chr1 | 119618970 | G | A | single_nucleotide_variant | Uncertain_significance | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures | SO:0001627|intron_variant | SO:0001627|intron_variant |
| WARS2 | chr1 | 119618995 | CT | C | Deletion | Pathogenic | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures | SO:0001589|frameshift_variant,SO:0001627|intron_variant | SO:0001589|frameshift_variant,SO:0001627|intron_variant |
| WARS2 | chr1 | 119619004 | G | A | single_nucleotide_variant | Uncertain_significance | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures | SO:0001583|missense_variant,SO:0001627|intron_variant | SO:0001583|missense_variant,SO:0001627|intron_variant |
| WARS2 | chr1 | 119619020 | CAAG | C | Microsatellite | Conflicting_interpretations_of_pathogenicity | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures|Inborn_genetic_diseases | SO:0001822|inframe_deletion,SO:0001627|intron_variant | SO:0001822|inframe_deletion,SO:0001627|intron_variant |
| WARS2 | chr1 | 119619073 | T | C | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant,SO:0001627|intron_variant | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant,SO:0001627|intron_variant |
| WARS2 | chr1 | 119619172 | C | T | single_nucleotide_variant | Likely_pathogenic | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant,SO:0001627|intron_variant | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant,SO:0001627|intron_variant |
| WARS2 | chr1 | 119619174 | C | G | single_nucleotide_variant | Benign | not_provided | SO:0001819|synonymous_variant,SO:0001623|5_prime_UTR_variant,SO:0001627|intron_variant | SO:0001819|synonymous_variant,SO:0001623|5_prime_UTR_variant,SO:0001627|intron_variant |
| WARS2 | chr1 | 119619178 | T | C | single_nucleotide_variant | Uncertain_significance | Inborn_genetic_diseases | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant,SO:0001627|intron_variant | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant,SO:0001627|intron_variant |
| WARS2 | chr1 | 119619187 | C | A | single_nucleotide_variant | Pathogenic | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant,SO:0001627|intron_variant | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant,SO:0001627|intron_variant |
| WARS2 | chr1 | 119619448 | G | T | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| WARS2 | chr1 | 119683063 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001619|non-coding_transcript_variant,SO:0001623|5_prime_UTR_variant,SO:0001627|intron_variant | SO:0001619|non-coding_transcript_variant,SO:0001623|5_prime_UTR_variant,SO:0001627|intron_variant |
| WARS2 | chr1 | 119683231 | A | C | single_nucleotide_variant | Conflicting_interpretations_of_pathogenicity | Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures|not_provided | SO:0001583|missense_variant,SO:0001619|non-coding_transcript_variant,SO:0001623|5_prime_UTR_variant | SO:0001583|missense_variant,SO:0001619|non-coding_transcript_variant,SO:0001623|5_prime_UTR_variant |
| WARS2 | chr1 | 119683390 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001619|non-coding_transcript_variant | SO:0001619|non-coding_transcript_variant |
nsSNVs with sample frequency (size of circle) from TCGA 33 cancers. |
SNVs and Indels |
| Gene | Cancer type | Chromosome | Start | End | RefSeeq | MutSeq | Mutation type | AAchange | # samples |
| WARS2 | LUAD | chr1 | 119619185 | 119619185 | T | C | Missense_Mutation | p.I46V | 7 |
| WARS2 | SARC | chr1 | 119575715 | 119575715 | C | T | Missense_Mutation | p.R301H | 4 |
| WARS2 | BRCA | chr1 | 119683237 | 119683237 | C | A | Nonsense_Mutation | p.E11* | 4 |
| WARS2 | COAD | chr1 | 119575743 | 119575743 | G | A | Missense_Mutation | p.R292C | 4 |
| WARS2 | LGG | chr1 | 119576827 | 119576827 | G | A | Silent | p.H175H | 3 |
| WARS2 | ESCA | chr1 | 119575957 | 119575957 | T | C | Silent | p.L220L | 3 |
| WARS2 | HNSC | chr1 | 119683180 | 119683180 | G | A | Nonsense_Mutation | p.Q30* | 3 |
| WARS2 | HNSC | chr1 | 119575787 | 119575787 | G | A | Missense_Mutation | p.A277V | 3 |
| WARS2 | UCEC | chr1 | 119575637 | 119575637 | T | C | Missense_Mutation | p.D327G | 3 |
| WARS2 | ACC | chr1 | 119683258 | 119683258 | G | A | Missense_Mutation | p.H4Y | 3 |
| WARS2 | LIHC | chr1 | 119575613 | 119575613 | A | - | Frame_Shift_Del | p.L335fs | 3 |
| WARS2 | STAD | chr1 | 119619170 | 119619170 | T | C | Missense_Mutation | p.N51D | 2 |
| WARS2 | SARC | chr1 | 119575715 | 119575715 | C | T | Missense_Mutation | 2 | |
| WARS2 | UCEC | chr1 | 119588247 | 119588247 | G | A | Silent | p.C129 | 2 |
| WARS2 | ESCA | chr1 | 119683180 | 119683180 | G | T | Missense_Mutation | 2 | |
| WARS2 | LUAD | chr1 | 119576771 | 119576771 | T | A | Missense_Mutation | p.Q194L | 2 |
| WARS2 | STAD | chr1 | 119575735 | 119575735 | G | A | Silent | p.S294S | 2 |
| WARS2 | STAD | chr1 | 119575767 | 119575767 | C | T | Missense_Mutation | 2 | |
| WARS2 | SKCM | chr1 | 119575949 | 119575949 | G | A | Missense_Mutation | p.P223L | 2 |
| WARS2 | STAD | chr1 | 119619106 | 119619106 | C | T | Missense_Mutation | 2 | |
| WARS2 | STAD | chr1 | 119575803 | 119575803 | C | T | Missense_Mutation | p.V272M | 2 |
| WARS2 | HNSC | chr1 | 119619197 | 119619197 | G | T | Missense_Mutation | p.Q42K | 2 |
| WARS2 | SKCM | chr1 | 119576822 | 119576822 | G | A | Missense_Mutation | p.P177L | 2 |
| WARS2 | STAD | chr1 | 119575767 | 119575767 | C | T | Missense_Mutation | p.G284R | 2 |
| WARS2 | STAD | chr1 | 119575732 | 119575732 | C | T | Silent | p.A295A | 2 |
| WARS2 | SKCM | chr1 | 119619093 | 119619093 | G | A | Silent | p.L76L | 2 |
| WARS2 | LGG | chr1 | 119576827 | 119576827 | G | A | Silent | 2 | |
| WARS2 | STAD | chr1 | 119619106 | 119619106 | C | T | Missense_Mutation | p.S72N | 2 |
| WARS2 | SKCM | chr1 | 119575597 | 119575597 | T | C | Silent | p.A340A | 2 |
| WARS2 | HNSC | chr1 | 119619152 | 119619152 | C | G | Missense_Mutation | p.E57Q | 2 |
| WARS2 | STAD | chr1 | 119575812 | 119575812 | G | A | Missense_Mutation | p.R269C | 2 |
| WARS2 | LUAD | chr1 | 119575683 | 119575683 | C | A | Nonsense_Mutation | p.E312* | 2 |
| WARS2 | STAD | chr1 | 119584963 | 119584963 | T | C | Missense_Mutation | p.T147A | 2 |
| WARS2 | HNSC | chr1 | 119575733 | 119575733 | G | A | Missense_Mutation | p.A295V | 2 |
| WARS2 | STAD | chr1 | 119575742 | 119575742 | C | T | Missense_Mutation | p.R292H | 2 |
| WARS2 | HNSC | chr1 | 119575893 | 119575893 | C | A | Missense_Mutation | p.D242Y | 2 |
| WARS2 | STAD | chr1 | 119575586 | 119575586 | T | G | Missense_Mutation | p.E344A | 2 |
| WARS2 | UCEC | chr1 | 119575710 | 119575710 | T | C | Missense_Mutation | p.K303E | 2 |
| WARS2 | ESCA | chr1 | 119683180 | 119683180 | G | T | Missense_Mutation | p.Q30K | 2 |
| WARS2 | STAD | chr1 | 119575804 | 119575804 | G | A | Silent | p.G271G | 2 |
| WARS2 | UCEC | chr1 | 119584944 | 119584944 | C | T | Missense_Mutation | p.G153D | 2 |
| WARS2 | LGG | chr1 | 119683216 | 119683216 | C | T | Missense_Mutation | p.A18T | 2 |
| WARS2 | ESCA | chr1 | 119575742 | 119575742 | C | A | Missense_Mutation | p.R292L | 1 |
| WARS2 | LIHC | chr1 | 119619206 | 119619206 | A | - | Frame_Shift_Del | p.S39fs | 1 |
| WARS2 | HNSC | chr1 | 119575787 | 119575787 | G | A | Missense_Mutation | 1 | |
| WARS2 | LUSC | chr1 | 119575589 | 119575589 | T | C | Missense_Mutation | p.K343R | 1 |
| WARS2 | SKCM | chr1 | 119619088 | 119619088 | G | A | Missense_Mutation | p.S78F | 1 |
| WARS2 | BLCA | chr1 | 119588231 | 119588231 | G | A | Nonsense_Mutation | p.R135* | 1 |
| WARS2 | LGG | chr1 | 119575933 | 119575933 | C | T | Silent | p.S228S | 1 |
| WARS2 | HNSC | chr1 | 119575875 | 119575875 | C | A | Missense_Mutation | p.V248L | 1 |
| WARS2 | OV | chr1 | 119377371 | 119377371 | C | G | Missense_Mutation | p.D257H | 1 |
| WARS2 | LUAD | chr1 | 119575582 | 119575582 | T | C | Silent | p.L345L | 1 |
| WARS2 | STAD | chr1 | 119575543 | 119575543 | A | G | Silent | p.G358G | 1 |
| WARS2 | HNSC | chr1 | 119575854 | 119575854 | C | T | Missense_Mutation | p.V255M | 1 |
| WARS2 | PCPG | chr1 | 119575971 | 119575971 | T | A | Nonsense_Mutation | p.K216X | 1 |
| WARS2 | CESC | chr1 | 119683254 | 119683254 | G | A | Missense_Mutation | 1 | |
| WARS2 | LGG | chr1 | 119618995 | 119618996 | - | T | Frame_Shift_Ins | p.H109fs | 1 |
| WARS2 | ESCA | chr1 | 119575742 | 119575742 | C | A | Missense_Mutation | 1 | |
| WARS2 | PCPG | chr1 | 119575971 | 119575971 | T | A | Nonsense_Mutation | p.K216* | 1 |
| WARS2 | CESC | chr1 | 119683254 | 119683254 | G | A | Missense_Mutation | p.S5L | 1 |
| WARS2 | LGG | chr1 | 119575933 | 119575933 | C | T | Silent | 1 | |
| WARS2 | HNSC | chr1 | 119575893 | 119575893 | C | A | Missense_Mutation | 1 | |
| WARS2 | LUAD | chr1 | 119575634 | 119575634 | T | C | Missense_Mutation | p.K328R | 1 |
| WARS2 | PCPG | chr1 | 119575971 | 119575971 | T | A | Nonsense_Mutation | 1 | |
| WARS2 | COAD | chr1 | 119575775 | 119575775 | G | A | Missense_Mutation | p.A281V | 1 |
| WARS2 | HNSC | chr1 | 119575875 | 119575875 | C | A | Missense_Mutation | 1 | |
| WARS2 | LUAD | chr1 | 119575563 | 119575563 | C | A | Nonsense_Mutation | p.E352* | 1 |
| WARS2 | STAD | chr1 | 119575832 | 119575832 | A | G | Missense_Mutation | p.V262A | 1 |
| WARS2 | PRAD | chr1 | 119584902 | 119584902 | T | C | Missense_Mutation | p.D167G | 1 |
| WARS2 | COAD | chr1 | 119575862 | 119575862 | C | T | Missense_Mutation | p.R252H | 1 |
| WARS2 | LGG | chr1 | 119683216 | 119683216 | C | T | Missense_Mutation | 1 | |
| WARS2 | HNSC | chr1 | 119619152 | 119619152 | C | G | Missense_Mutation | 1 | |
| WARS2 | UCEC | chr1 | 119588247 | 119588247 | G | A | Silent | p.C129C | 1 |
| WARS2 | SKCM | chr1 | 119575560 | 119575560 | C | T | Missense_Mutation | p.V353M | 1 |
| WARS2 | PRAD | chr1 | 119575758 | 119575758 | C | T | Missense_Mutation | p.V287M | 1 |
| WARS2 | COAD | chr1 | 119575923 | 119575923 | G | T | Missense_Mutation | p.P232T | 1 |
| WARS2 | LIHC | chr1 | 119575853 | 119575853 | A | G | Missense_Mutation | 1 | |
| WARS2 | HNSC | chr1 | 119619197 | 119619197 | G | T | Missense_Mutation | 1 | |
| WARS2 | LUAD | chr1 | 119575622 | 119575622 | T | A | Missense_Mutation | p.E332V | 1 |
| WARS2 | SKCM | chr1 | 119575778 | 119575778 | G | A | Missense_Mutation | p.A280V | 1 |
| WARS2 | COAD | chr1 | 119619180 | 119619180 | G | T | Silent | p.L47L | 1 |
| WARS2 | LIHC | chr1 | 119683215 | 119683215 | G | T | Missense_Mutation | p.A18E | 1 |
| WARS2 | HNSC | chr1 | 119584949 | 119584949 | G | A | Silent | 1 | |
| WARS2 | LUAD | chr1 | 119575623 | 119575623 | C | G | Missense_Mutation | p.E332Q | 1 |
| WARS2 | READ | chr1 | 119576743 | 119576743 | G | T | Missense_Mutation | p.F203L | 1 |
| WARS2 | UCEC | chr1 | 119575967 | 119575968 | - | C | Frame_Shift_Ins | p.V217fs | 1 |
| WARS2 | SKCM | chr1 | 119575764 | 119575764 | G | A | Missense_Mutation | p.L285F | 1 |
| WARS2 | LIHC | chr1 | 119619130 | 119619131 | - | C | Frame_Shift_Ins | p.*64fs | 1 |
| WARS2 | HNSC | chr1 | 119575733 | 119575733 | G | A | Missense_Mutation | 1 | |
| WARS2 | LUSC | chr1 | 119575726 | 119575726 | C | T | Missense_Mutation | p.M297I | 1 |
| WARS2 | READ | chr1 | 119619219 | 119619219 | C | A | Missense_Mutation | p.K34N | 1 |
| WARS2 | SKCM | chr1 | 119575903 | 119575903 | G | A | Silent | p.V238V | 1 |
| WARS2 | KIRC | chr1 | 119575670 | 119575670 | G | C | Missense_Mutation | p.P316R | 1 |
| WARS2 | HNSC | chr1 | 119575854 | 119575854 | C | T | Missense_Mutation | 1 | |
| WARS2 | LUSC | chr1 | 119584928 | 119584928 | G | A | Silent | p.L158L | 1 |
| WARS2 | SARC | chr1 | 119575960 | 119575960 | G | T | Silent | 1 | |
| WARS2 | SKCM | chr1 | 119575902 | 119575902 | G | A | Nonsense_Mutation | p.R239* | 1 |
| WARS2 | BLCA | chr1 | 119618975 | 119618975 | G | C | Missense_Mutation | 1 |
Copy number variation (CNV) of WARS2 * Click on the image to open the original image in a new window. |
![]() |
Fusion gene breakpoints (product of the structural variants (SVs)) across WARS2 * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Fusion genes with this translation factor from FusionGDB2.0. |
| FusionGDB2 ID | Disease | Sample | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand |
| 97953 | TGCT | TCGA-2G-AAG3 | FAM157C | chr16 | 90182891 | + | WARS2 | chr1 | 119619230 | - |
| 97953 | HNSC | TCGA-CV-6937-01A | KIAA1549L | chr11 | 33596419 | + | WARS2 | chr1 | 119619230 | - |
| 97953 | BRCA | TCGA-BH-A0B2-01A | PPP1R21 | chr2 | 48725874 | + | WARS2 | chr1 | 119619230 | - |
| 97953 | SKCM | TCGA-WE-AAA3-06A | SEC22B | chr1 | 145096621 | - | WARS2 | chr1 | 119619230 | - |
| 97954 | N/A | AI672033 | VAV3 | chr1 | 108417521 | - | WARS2 | chr1 | 119588287 | - |
| 98706 | BRCA | TCGA-B6-A0IG-01A | WARS2 | chr1 | 119618972 | - | ASIC2 | chr17 | 31749746 | + |
| 98706 | N/A | AF179143 | WARS2 | chr1 | 119612650 | + | CDKN1B | chr12 | 12871392 | + |
| 100995 | LUAD | TCGA-55-A490-01A | WARS2 | chr1 | 119683178 | - | DLG2 | chr11 | 84865695 | - |
| 98706 | LIHC | TCGA-BC-A216-01A | WARS2 | chr1 | 119584887 | - | HMGCS2 | chr1 | 120307249 | - |
| 98706 | SKCM | TCGA-D3-A5GS-06A | WARS2 | chr1 | 119618973 | - | NTNG1 | chr1 | 107979287 | + |
| 98706 | SKCM | TCGA-D3-A5GS-06A | WARS2 | chr1 | 119618973 | - | NTNG1 | chr1 | 108023233 | + |
| 102365 | BLCA | TCGA-G2-A3IE-01A | WARS2 | chr1 | 119683178 | - | OXR1 | chr8 | 107371704 | + |
| 100805 | LUSC | TCGA-60-2725-01A | WARS2 | chr1 | 119618973 | - | PHGDH | chr1 | 120263793 | + |
| 99889 | KIRC | TCGA-CJ-4894-01A | WARS2 | chr1 | 119683178 | - | REG4 | chr1 | 120337308 | - |
| 98706 | DLBC | TCGA-GR-7353 | WARS2 | chr1 | 119683177 | - | RPF1 | chr1 | 84961564 | + |
| 98706 | DLBC | TCGA-GR-7353-01A | WARS2 | chr1 | 119683178 | - | RPF1 | chr1 | 84961565 | + |
| 98706 | PRAD | TCGA-HC-8265 | WARS2 | chr1 | 119683177 | - | SEC22B | chr1 | 145103907 | + |
| 98706 | ACC | TCGA-OR-A5LO-01A | WARS2 | chr1 | 119576718 | - | TBX15 | chr1 | 119474455 | - |
| 98706 | BRCA | TCGA-AO-A12B-01A | WARS2 | chr1 | 119584887 | - | TBX15 | chr1 | 119474455 | - |
| 98706 | LUSC | TCGA-22-4591 | WARS2 | chr1 | 119683178 | - | TBX15 | chr1 | 119474455 | - |
| 98706 | CESC | TCGA-C5-A7X5-01A | WARS2 | chr1 | 119618973 | - | TMEM87B | chr2 | 112832489 | + |
| 98706 | CESC | TCGA-C5-A7X5-01A | WARS2 | chr1 | 119618973 | - | TMEM87B | chr2 | 112838634 | + |
| 102208 | BRCA | TCGA-E9-A243 | WARS2 | chr1 | 119618972 | - | TPST1 | chr7 | 65817491 | + |
| 102208 | BRCA | TCGA-E9-A243-01A | WARS2 | chr1 | 119618973 | - | TPST1 | chr7 | 65817492 | + |
| 98706 | CESC | TCGA-C5-A7X5-01A | WARS2 | chr1 | 119618973 | - | ZAR1 | chr4 | 48496118 | + |
Top |
|
Kaplan-Meier plots with logrank tests of overall survival (OS) |
![]() |
| Cancer type | Translation factor | Coefficent | Hazard ratio | Wald test pval | Likelihool ratio pval | Logrank test pval | # samples |
Top |
|
Differential gene expression between female and male. (Wilcoxon test, pval<0.05) |
![]() |
| Cancer type | Translation factor | pval | adj.p |
| LUAD | WARS2 | 0.00266890131030878 | 0.075 |
| HNSC | WARS2 | 0.0298965000007549 | 0.81 |
Top |
|
Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05) |
![]() |
| Cancer type | Translation factor | pval | adj.p |
| TGCT | WARS2 | 0.048558483969533 | 1 |
| THCA | WARS2 | 0.00403409813072414 | 0.13 |
| KICH | WARS2 | 0.0074993502901798 | 0.24 |
| LAML | WARS2 | 0.0136208386534913 | 0.42 |
| ACC | WARS2 | 0.0134647621256628 | 0.42 |
Top |
|
Drugs targeting genes involved in this translation factor. (DrugBank Version 5.1.8 2021-05-08) |
| UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
|
Diseases associated with this translation factor. (DisGeNet 4.0) |
| Disease ID | Disease Name | # PubMeds | Disease source |
| C4540192 | NEURODEVELOPMENTAL DISORDER, MITOCHONDRIAL, WITH ABNORMAL MOVEMENTS AND LACTIC ACIDOSIS, WITH OR WITHOUT SEIZURES | 3 | GENOMICS_ENGLAND;UNIPROT |