![]() |
||||||
|
Translation Factor: FTSJ1 (NCBI Gene ID:24140) |
|
![]() |
Gene Information | Gene Name: FTSJ1 | Gene ID: 24140 | Gene Symbol | FTSJ1 | Gene ID | 24140 |
Gene Name | FtsJ RNA 2'-O-methyltransferase 1 | |
Synonyms | CDLIV|JM23|MRX44|MRX9|SPB1|TRMT7 | |
Cytomap | Xp11.23 | |
Type of Gene | protein-coding | |
Description | putative tRNA (cytidine(32)/guanosine(34)-2'-O)-methyltransferase2'-O-ribose RNA methyltransferase TRM7 homologFtsJ RNA methyltransferase homolog 1FtsJ-like protein 1cell division proteinputative ribosomal RNA methyltransferase 1rRNA (uridine-2'-O-) | |
Modification date | 20200313 | |
UniProtAcc | Q9UET6 |
![]() |
GO ID | GO term |
GO:0002181 | Cytoplasmic translation |
GO:0006412 | Translation |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
![]() |
Gene | Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25 |
FTSJ1 | >1119.25 |
Top |
|
![]() |
Gene | Title | PMID |
FTSJ1 | Loss of Ftsj1 perturbs codon-specific translation efficiency in the brain and is associated with X-linked intellectual disability | 33771871 |
Top |
|
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. For more annotations, please visit our ExonSkipDB. |
![]() |
![]() * Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser. |
ENST | Exon skip start (DNA) | Exon Skip end (DNA) | ORF |
ENST00000348411 | 48337004 | 48337095 | Frame-shift |
ENST00000348411 | 48337425 | 48337504 | Frame-shift |
ENST00000348411 | 48339538 | 48339591 | Frame-shift |
ENST00000348411 | 48340019 | 48340103 | In-frame |
ENST00000348411 | 48340984 | 48341182 | In-frame |
![]() |
ENST | Exon skip start (DNA) | Exon Skip end (DNA) | Len(transcript seq) | Exon skip start (mRNA) | Exon Skip end (mRNA) | Len(amino acid seq) | Exon skip start (AA) | Exon Skip end (AA) |
ENST00000348411 | 48340019 | 48340103 | 1909 | 895 | 978 | 329 | 190 | 218 |
ENST00000348411 | 48340984 | 48341182 | 1909 | 1083 | 1280 | 329 | 253 | 319 |
![]() |
UniProtAcc | Exon skip start (AA) | Exon Skip end (AA) | Function feature start (AA) | Function feature end (AA) | Functional feature type | Functional feature desc. |
Q9UET6 | 253 | 319 | 1 | 329 | Chain | ID=PRO_0000155575;Note=Putative tRNA (cytidine(32)/guanosine(34)-2'-O)-methyltransferase |
Q9UET6 | 190 | 218 | 1 | 329 | Chain | ID=PRO_0000155575;Note=Putative tRNA (cytidine(32)/guanosine(34)-2'-O)-methyltransferase |
Q9UET6 | 253 | 319 | 271 | 271 | Modified residue | Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244|PubMed:23186163;Dbxref=PMID:23186163 |
Top |
|
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |
Cancer type | Translation factor | FC | adj.pval |
CHOL | FTSJ1 | -3.25220415659806 | 0.00390625 |
BRCA | FTSJ1 | -2.30401801932705 | 3.67157769892739e-21 |
HNSC | FTSJ1 | 1.44084557286369 | 7.51780044083718e-06 |
Top |
|
![]() |
Cancer type | Gene | miRNA | TargetScan binding score (Context++ score percentile) | Coefficient | Pvalue |
![]() |
![]() |
Cancer type | Gene | methyl group b | methyl group a | DEG pval | avg methyl in b | avg methyl in a | avg exp in b | avg exp in a |
![]() |
![]() |
Cancer type | Gene | methyl group b | methyl group a | DEG pval | avg methyl in b | avg methyl in a | avg exp in b | avg exp in a |
KIRP | FTSJ1 | 2 | 3 | 0.0336718929140305 | 0.479787726449275 | 0.632595478723404 | -0.0492700100366942 | 0.134098360299438 |
LUSC | FTSJ1 | 2 | 3 | 0.0481154521577766 | 0.496679863379863 | 0.627701190476191 | -0.280120291003032 | -0.0968913264614889 |
![]() |
![]() |
Cancer type | Gene | Coefficient | Pvalue |
THCA | FTSJ1 | 0.055121085 | 0.023087804 |
Top |
|
![]() |
![]() |
Cancer type | Gene group | Translation factor | Correlated gene | Coefficient | Pvalue |
CHOL | Cell metabolism gene | FTSJ1 | IMPDH1 | 0.813449427 | 1.12E-11 |
CHOL | Cell metabolism gene | FTSJ1 | SLC16A3 | 0.817084954 | 7.60E-12 |
CHOL | Cell metabolism gene | FTSJ1 | MTHFD1L | 0.833808794 | 1.16E-12 |
CHOL | IUPHAR | FTSJ1 | IMPDH1 | 0.813449427 | 1.12E-11 |
CHOL | IUPHAR | FTSJ1 | SLC16A3 | 0.817084954 | 7.60E-12 |
CHOL | IUPHAR | FTSJ1 | PORCN | 0.838650225 | 6.44E-13 |
CHOL | IUPHAR | FTSJ1 | ATP13A2 | 0.859183575 | 4.28E-14 |
CHOL | TSG | FTSJ1 | DOK1 | 0.805970255 | 2.40E-11 |
READ | Epifactor | FTSJ1 | SUV39H1 | 0.819382083 | 1.23E-26 |
READ | IUPHAR | FTSJ1 | SUV39H1 | 0.819382083 | 1.23E-26 |
Top |
|
![]() Visit iCn3D. |
Top |
|
![]() * Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P)) |
![]() |
![]() |
![]() |
![]() * Edge colors based on TCGA cancer types. |
![]() |
![]() |
Cancer type | Translation factor | Interacting protein coding gene | FC | adj.pval |
KIRP | FTSJ1 | TRMT5 | 1.32530216969252 | 0.000177780166268349 |
KIRP | FTSJ1 | TRMT6 | 2.38633822741832 | 0.000306400004774332 |
LIHC | FTSJ1 | THADA | -1.13339097028465 | 0.000492443176754602 |
KICH | FTSJ1 | WDR12 | 1.27437010311891 | 0.000631332397460937 |
PRAD | FTSJ1 | TRMT1 | -1.09561440158795 | 0.000670334620795339 |
ESCA | FTSJ1 | TRMT6 | -3.11677766247045 | 0.0009765625 |
KICH | FTSJ1 | NIP7 | 1.61593435997618 | 0.00181567668914795 |
ESCA | FTSJ1 | WDR12 | -4.50085604434153 | 0.001953125 |
HNSC | FTSJ1 | WDR4 | 1.40430290315404 | 0.00289519683178696 |
LIHC | FTSJ1 | NIP7 | 1.00838669083295 | 0.0029470290722562 |
STAD | FTSJ1 | THADA | -1.57331994372488 | 0.0038655917160213 |
ESCA | FTSJ1 | TRMT1 | -1.05301872345036 | 0.0048828125 |
KIRP | FTSJ1 | WDR4 | -1.07321171369349 | 0.00608485564589501 |
CHOL | FTSJ1 | WDR4 | -4.70215860652879 | 0.0078125 |
BLCA | FTSJ1 | NSUN2 | -2.51121902266229 | 0.0180816650390625 |
CHOL | FTSJ1 | TRMT11 | -1.83882690193514 | 0.01953125 |
HNSC | FTSJ1 | TRMT1 | -2.49406344112889 | 0.0273726439852453 |
PRAD | FTSJ1 | TRMT11 | 1.06087533610535 | 0.0291755363147523 |
READ | FTSJ1 | THADA | -5.31783758832206 | 0.03125 |
BRCA | FTSJ1 | TRMT5 | -1.86961197293306 | 1.08510546514812e-15 |
THCA | FTSJ1 | THADA | -1.55083308133603 | 1.17810920709243e-05 |
STAD | FTSJ1 | TRMT1 | -1.43099332827803 | 1.17812305688858e-07 |
STAD | FTSJ1 | TRMT6 | -5.42863470282606 | 1.42958015203476e-07 |
KICH | FTSJ1 | NSUN2 | -2.58200515291966 | 1.50799751281738e-05 |
KIRP | FTSJ1 | TRMT1 | -4.30019224127311 | 1.72760337591171e-07 |
LUSC | FTSJ1 | WDR6 | 1.89763401280828 | 1.79996309233889e-05 |
LIHC | FTSJ1 | TRMT1 | -4.9843251745464 | 2.24402029682138e-06 |
LIHC | FTSJ1 | WDR12 | -3.16467679630325 | 2.54824448841554e-08 |
LUAD | FTSJ1 | WDR4 | -2.64746986542802 | 3.31565482735716e-09 |
LIHC | FTSJ1 | TRMT6 | -1.33049543742613 | 3.4520382341717e-07 |
PRAD | FTSJ1 | NSUN2 | -2.36603815702603 | 4.53339406712827e-08 |
KICH | FTSJ1 | TRMT1 | -3.45641483703651 | 4.54187393188476e-05 |
THCA | FTSJ1 | TRMT1 | -1.63955402041224 | 5.23348875771721e-06 |
KIRP | FTSJ1 | NIP7 | -4.87841949895948 | 5.4334755986929e-05 |
LUAD | FTSJ1 | TRMT5 | -5.3715861736951 | 5.47570214265305e-08 |
LIHC | FTSJ1 | WDR4 | -3.79209228883491 | 6.11213149202698e-08 |
KICH | FTSJ1 | THADA | 1.91638215821306 | 6.55651092529297e-06 |
STAD | FTSJ1 | WDR12 | -2.46721337744962 | 6.79492950439454e-06 |
LUSC | FTSJ1 | TRMT1 | -2.07250103719564 | 7.24218086307245e-08 |
![]() |
PPI interactors with FTSJ1 |
DMWD, CUL3, APP, WDR6, TMEM17, DYSF, CDC37, USP43, IBTK, SIRT6, GNL3L, MRM1, ZFP91, RPS19BP1, Cdc37, CHRM3, ORF28, DCAF13, NRAS, KRAS, APEX1, SUN2, WWP2, COL4A3BP, PLEKHA4, M, nsp4, ORF3a, ORF7b, S, HSCB, KIF14, PIK3R1, DNAJC5B, DNAJC5, PRKACA, ARF6, CXADR, LAMP1, LAMTOR1, CX3CL1, HCST, WDR5B, RPL36AL, NRP1, DPP4, TMPRSS11B, |
Top |
|
![]() |
Gene | Chr | Position | RefSeq | VarSeq | RefSeeq | VarType | Pathogenic | Disease | VarInfo |
FTSJ1 | chrX | 48336469 | T | A | single_nucleotide_variant | Pathogenic | Inborn_genetic_diseases | SO:0001583|missense_variant,SO:0001627|intron_variant | SO:0001583|missense_variant,SO:0001627|intron_variant |
FTSJ1 | chrX | 48336491 | ATGGC | A | Microsatellite | Pathogenic | not_provided | SO:0001589|frameshift_variant,SO:0001627|intron_variant | SO:0001589|frameshift_variant,SO:0001627|intron_variant |
FTSJ1 | chrX | 48336565 | C | G | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
FTSJ1 | chrX | 48336876 | G | C | single_nucleotide_variant | Likely_pathogenic | Inborn_genetic_diseases | SO:0001583|missense_variant,SO:0001627|intron_variant | SO:0001583|missense_variant,SO:0001627|intron_variant |
FTSJ1 | chrX | 48336902 | A | G | single_nucleotide_variant | Uncertain_significance | Inborn_genetic_diseases | SO:0001583|missense_variant,SO:0001627|intron_variant | SO:0001583|missense_variant,SO:0001627|intron_variant |
FTSJ1 | chrX | 48336905 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001583|missense_variant,SO:0001627|intron_variant | SO:0001583|missense_variant,SO:0001627|intron_variant |
FTSJ1 | chrX | 48336965 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
FTSJ1 | chrX | 48337003 | A | G | single_nucleotide_variant | Pathogenic | Mental_retardation_9,_X-linked | SO:0001574|splice_acceptor_variant,SO:0001627|intron_variant | SO:0001574|splice_acceptor_variant,SO:0001627|intron_variant |
FTSJ1 | chrX | 48337009 | C | T | single_nucleotide_variant | Pathogenic | Mental_retardation_9,_X-linked | SO:0001587|nonsense,SO:0001627|intron_variant | SO:0001587|nonsense,SO:0001627|intron_variant |
FTSJ1 | chrX | 48337018 | G | T | single_nucleotide_variant | Uncertain_significance | History_of_neurodevelopmental_disorder | SO:0001583|missense_variant,SO:0001627|intron_variant | SO:0001583|missense_variant,SO:0001627|intron_variant |
FTSJ1 | chrX | 48337054 | C | G | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant,SO:0001627|intron_variant | SO:0001583|missense_variant,SO:0001627|intron_variant |
FTSJ1 | chrX | 48337067 | TG | T | Deletion | Pathogenic | Mental_retardation_9,_X-linked | SO:0001589|frameshift_variant,SO:0001627|intron_variant | SO:0001589|frameshift_variant,SO:0001627|intron_variant |
FTSJ1 | chrX | 48337083 | G | T | single_nucleotide_variant | Benign | History_of_neurodevelopmental_disorder|not_specified|not_provided | SO:0001819|synonymous_variant,SO:0001627|intron_variant | SO:0001819|synonymous_variant,SO:0001627|intron_variant |
FTSJ1 | chrX | 48337086 | C | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant,SO:0001627|intron_variant | SO:0001819|synonymous_variant,SO:0001627|intron_variant |
FTSJ1 | chrX | 48337234 | T | C | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
FTSJ1 | chrX | 48337446 | C | T | single_nucleotide_variant | Benign | not_provided | SO:0001819|synonymous_variant,SO:0001623|5_prime_UTR_variant | SO:0001819|synonymous_variant,SO:0001623|5_prime_UTR_variant |
FTSJ1 | chrX | 48337447 | A | T | single_nucleotide_variant | Benign | not_provided | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant |
FTSJ1 | chrX | 48337450 | C | G | single_nucleotide_variant | Benign/Likely_benign | History_of_neurodevelopmental_disorder|not_specified|not_provided | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant |
FTSJ1 | chrX | 48337468 | C | T | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant |
FTSJ1 | chrX | 48337472 | C | T | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant | SO:0001583|missense_variant,SO:0001623|5_prime_UTR_variant |
FTSJ1 | chrX | 48339287 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
FTSJ1 | chrX | 48339537 | A | T | single_nucleotide_variant | Pathogenic | Intellectual_disability | SO:0001574|splice_acceptor_variant,SO:0001627|intron_variant | SO:0001574|splice_acceptor_variant,SO:0001627|intron_variant |
FTSJ1 | chrX | 48339586 | C | T | single_nucleotide_variant | Benign | History_of_neurodevelopmental_disorder|not_provided | SO:0001819|synonymous_variant,SO:0001627|intron_variant | SO:0001819|synonymous_variant,SO:0001627|intron_variant |
FTSJ1 | chrX | 48339696 | A | G | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
FTSJ1 | chrX | 48339730 | G | A | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
FTSJ1 | chrX | 48339780 | CCTCACCCGCTGTCTTTGCCT | C | Deletion | Uncertain_significance | Intellectual_disability | SO:0001627|intron_variant | SO:0001627|intron_variant |
FTSJ1 | chrX | 48339807 | C | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
FTSJ1 | chrX | 48339828 | G | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
FTSJ1 | chrX | 48339840 | C | T | single_nucleotide_variant | Benign | History_of_neurodevelopmental_disorder|not_specified|not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
FTSJ1 | chrX | 48339985 | C | T | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
FTSJ1 | chrX | 48340012 | C | T | single_nucleotide_variant | Benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
FTSJ1 | chrX | 48340028 | G | A | single_nucleotide_variant | Likely_benign | History_of_neurodevelopmental_disorder | SO:0001583|missense_variant | SO:0001583|missense_variant |
FTSJ1 | chrX | 48340048 | C | A | single_nucleotide_variant | Likely_benign | not_specified | SO:0001583|missense_variant | SO:0001583|missense_variant |
FTSJ1 | chrX | 48340102 | C | T | single_nucleotide_variant | Benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
FTSJ1 | chrX | 48340785 | C | G | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
FTSJ1 | chrX | 48340873 | G | A | single_nucleotide_variant | Benign/Likely_benign | History_of_neurodevelopmental_disorder|not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
FTSJ1 | chrX | 48340877 | C | T | single_nucleotide_variant | Uncertain_significance | Mental_retardation_9,_X-linked | SO:0001583|missense_variant | SO:0001583|missense_variant |
FTSJ1 | chrX | 48340987 | A | G | single_nucleotide_variant | Conflicting_interpretations_of_pathogenicity | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
FTSJ1 | chrX | 48340994 | G | A | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
FTSJ1 | chrX | 48341086 | C | G | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
FTSJ1 | chrX | 48341097 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
FTSJ1 | chrX | 48341097 | G | GC | Duplication | Likely_pathogenic | not_provided | SO:0001589|frameshift_variant | SO:0001589|frameshift_variant |
FTSJ1 | chrX | 48341118 | G | A | single_nucleotide_variant | Benign | History_of_neurodevelopmental_disorder|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
FTSJ1 | chrX | 48341166 | C | A | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
FTSJ1 | chrX | 48341414 | C | T | single_nucleotide_variant | Likely_benign | Intellectual_disability | SO:0001624|3_prime_UTR_variant | SO:0001624|3_prime_UTR_variant |
![]() |
![]() |
Gene | Cancer type | Chromosome | Start | End | RefSeeq | MutSeq | Mutation type | AAchange | # samples |
FTSJ1 | LUAD | chrX | 48340805 | 48340805 | C | A | Missense_Mutation | p.Q222K | 3 |
FTSJ1 | PAAD | chrX | 48339583 | 48339583 | C | T | Missense_Mutation | p.L136F | 3 |
FTSJ1 | LGG | chrX | 48339829 | 48339829 | G | T | Missense_Mutation | p.D162Y | 2 |
FTSJ1 | LUAD | chrX | 48341100 | 48341100 | C | A | Missense_Mutation | p.P290H | 2 |
FTSJ1 | UCEC | chrX | 48340894 | 48340894 | C | T | Silent | p.D253 | 2 |
FTSJ1 | PAAD | chrX | 48340860 | 48340860 | G | T | Missense_Mutation | 2 | |
FTSJ1 | STAD | chrX | 48337473 | 48337473 | G | A | Silent | p.A110A | 2 |
FTSJ1 | UCEC | chrX | 48341093 | 48341093 | A | G | Missense_Mutation | p.I290V | 2 |
FTSJ1 | PAAD | chrX | 48340860 | 48340860 | G | T | Missense_Mutation | p.S242I | 2 |
FTSJ1 | UCEC | chrX | 48341096 | 48341096 | C | T | Missense_Mutation | p.R291C | 2 |
FTSJ1 | LGG | chrX | 48337056 | 48337056 | A | G | Silent | 2 | |
FTSJ1 | LGG | chrX | 48339829 | 48339829 | G | T | Missense_Mutation | 2 | |
FTSJ1 | LUAD | chrX | 48339578 | 48339578 | A | C | Missense_Mutation | p.Q134P | 2 |
FTSJ1 | LUAD | chrX | 48336506 | 48336506 | G | T | Missense_Mutation | p.R24L | 2 |
FTSJ1 | LUAD | chrX | 48339704 | 48339704 | A | - | Frame_Shift_Del | p.K148fs | 2 |
FTSJ1 | SKCM | chrX | 48336904 | 48336904 | C | T | Silent | p.I63I | 2 |
FTSJ1 | UCEC | chrX | 48337472 | 48337472 | C | T | Missense_Mutation | p.A110V | 2 |
FTSJ1 | UCEC | chrX | 48337491 | 48337491 | C | T | Silent | p.D116 | 2 |
FTSJ1 | UCEC | chrX | 48339714 | 48339714 | G | A | Missense_Mutation | p.G151D | 2 |
FTSJ1 | UCEC | chrX | 48340102 | 48340102 | C | T | Silent | p.Y218 | 2 |
FTSJ1 | BLCA | chrX | 48340027 | 48340027 | C | T | Silent | p.F193F | 2 |
FTSJ1 | PAAD | chrX | 48339583 | 48339583 | C | T | Missense_Mutation | 2 | |
FTSJ1 | SKCM | chrX | 48337027 | 48337027 | G | A | Missense_Mutation | p.V72M | 1 |
FTSJ1 | COAD | chrX | 48340102 | 48340102 | C | A | Nonsense_Mutation | p.Y218X | 1 |
FTSJ1 | LGG | chrX | 48337016 | 48337016 | C | T | Missense_Mutation | p.S68F | 1 |
FTSJ1 | LUAD | chrX | 48339684 | 48339684 | A | T | Missense_Mutation | p.N141I | 1 |
FTSJ1 | COAD | chrX | 48340877 | 48340877 | C | T | Missense_Mutation | p.R246C | 1 |
FTSJ1 | LGG | chrX | 48337056 | 48337056 | A | G | Silent | p.P81P | 1 |
FTSJ1 | STAD | chrX | 48339902 | 48339902 | G | A | Missense_Mutation | p.R186Q | 1 |
FTSJ1 | COAD | chrX | 48340994 | 48340994 | G | A | Missense_Mutation | p.G255S | 1 |
FTSJ1 | STAD | chrX | 48340054 | 48340054 | C | T | Silent | p.P202P | 1 |
FTSJ1 | LUAD | chrX | 48339835 | 48339835 | A | G | Missense_Mutation | p.T164A | 1 |
FTSJ1 | ESCA | chrX | 48340858 | 48340858 | G | T | Silent | p.L241 | 1 |
FTSJ1 | PAAD | chrX | 48340860 | 48340860 | G | T | Missense_Mutation | p.S240I | 1 |
FTSJ1 | THCA | chrX | 48340054 | 48340054 | C | A | Silent | 1 | |
FTSJ1 | ESCA | chrX | 48340858 | 48340858 | G | T | Silent | 1 | |
FTSJ1 | SARC | chrX | 48336889 | 48336889 | G | T | Silent | 1 | |
FTSJ1 | LGG | chrX | 48337016 | 48337016 | C | T | Missense_Mutation | 1 | |
FTSJ1 | THYM | chrX | 48340028 | 48340028 | G | A | Missense_Mutation | 1 | |
FTSJ1 | GBM | chrX | 48337070 | 48337070 | T | C | Missense_Mutation | p.V86A | 1 |
FTSJ1 | SKCM | chrX | 48340019 | 48340019 | G | A | Splice_Site | . | 1 |
FTSJ1 | LIHC | chrX | 48341400 | 48341400 | A | G | Silent | 1 | |
FTSJ1 | THYM | chrX | 48340028 | 48340028 | G | A | Missense_Mutation | p.A194T | 1 |
FTSJ1 | GBM | chrX | 48337447 | 48337447 | A | T | Missense_Mutation | p.I102F | 1 |
FTSJ1 | LIHC | chrX | 48341394 | 48341394 | T | C | Silent | p.S326S | 1 |
FTSJ1 | LUAD | chrX | 48340805 | 48340805 | C | A | Missense_Mutation | p.Q224K | 1 |
FTSJ1 | GBM | chrX | 48336460 | 48336460 | C | T | Missense_Mutation | 1 | |
FTSJ1 | SKCM | chrX | 48341135 | 48341135 | C | T | Missense_Mutation | p.P302S | 1 |
FTSJ1 | LIHC | chrX | 48337080 | 48337080 | G | - | Frame_Shift_Del | p.Q89fs | 1 |
FTSJ1 | LUSC | chrX | 48340063 | 48340063 | C | T | Silent | p.F205F | 1 |
FTSJ1 | GBM | chrX | 48341022 | 48341022 | C | A | Missense_Mutation | 1 | |
FTSJ1 | SKCM | chrX | 48340019 | 48340019 | G | A | Splice_Site | 1 | |
FTSJ1 | LUAD | chrX | 48340055 | 48340055 | G | T | Nonsense_Mutation | p.E203* | 1 |
FTSJ1 | BLCA | chrX | 48340027 | 48340027 | C | T | Silent | 1 | |
FTSJ1 | OV | chrX | 48225817 | 48225817 | G | T | Silent | p.S246 | 1 |
FTSJ1 | KIRP | chrX | 48336439 | 48336439 | G | T | Nonsense_Mutation | 1 | |
FTSJ1 | SKCM | chrX | 48341089 | 48341089 | G | A | Silent | p.K286K | 1 |
FTSJ1 | LUAD | chrX | 48339589 | 48339589 | G | T | Missense_Mutation | p.A138S | 1 |
![]() * Click on the image to open the original image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() |
FusionGDB2 ID | Disease | Sample | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand |
80236 | N/A | AI557383 | FTSJ1 | chrX | 48339564 | - | FTSJ1 | chrX | 48339807 | + |
73255 | PCPG | TCGA-QR-A6GW-01A | FTSJ1 | chrX | 48337504 | + | QTRT1 | chr19 | 10822837 | + |
80236 | N/A | AI094968 | GABRB3 | chr15 | 26831828 | - | FTSJ1 | chrX | 48344693 | - |
80236 | N/A | AI675401 | NDUFAF7 | chr2 | 37460764 | - | FTSJ1 | chrX | 48344687 | - |
Top |
|
![]() |
![]() |
Cancer type | Translation factor | Coefficent | Hazard ratio | Wald test pval | Likelihool ratio pval | Logrank test pval | # samples |
Top |
|
![]() |
![]() |
Cancer type | Translation factor | pval | adj.p |
KIRP | FTSJ1 | 0.00809966814198768 | 0.23 |
KIRC | FTSJ1 | 0.0146884238785556 | 0.4 |
SARC | FTSJ1 | 0.0170192651201649 | 0.44 |
COAD | FTSJ1 | 0.0324529229447455 | 0.81 |
Top |
|
![]() |
![]() |
Cancer type | Translation factor | pval | adj.p |
LUAD | FTSJ1 | 0.0477007943971697 | 1 |
CESC | FTSJ1 | 0.0221627799871943 | 0.7 |
UCEC | FTSJ1 | 0.0258114812712554 | 0.77 |
THYM | FTSJ1 | 0.0217930785819886 | 0.7 |
SARC | FTSJ1 | 8.50797765869055e-05 | 0.0028 |
Top |
|
![]() (DrugBank Version 5.1.8 2021-05-08) |
UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
|
![]() (DisGeNet 4.0) |
Disease ID | Disease Name | # PubMeds | Disease source |
C3501611 | Mental Retardation, X-Linked Nonsyndromic | 7 | CLINGEN |
C0796215 | Mental Retardation, X-Linked 9 | 1 | CTD_human;GENOMICS_ENGLAND |
C2931498 | Mental Retardation, X-Linked 1 | 1 | ORPHANET |