Home

Download

Statistics

Examples

Help

Contact

	Gene Summary
	Translation studies in PubMed
	Exon Skipping Events
	Expression
	Expression Regulation
	Associated Genes
	Protein 3D Structure
	Protein-Protein Interaction
	Mutations
	Prognostic Analysis
	Gender Association
	Age Association
	Related Drugs
	Related Diseases

Translation Factor: EIF2AK4 (NCBI Gene ID:440275)

Gene Summary

Gene Summary

Gene Information	Gene Name: EIF2AK4
	Gene ID: 440275
	Gene Symbol	EIF2AK4
	Gene ID	440275
	Gene Name	eukaryotic translation initiation factor 2 alpha kinase 4
	Synonyms	GCN2\|PVOD2
	Cytomap	15q15.1
	Type of Gene	protein-coding
	Description	eIF-2-alpha kinase GCN2GCN2 eIF2alpha kinaseGCN2-like proteingeneral control nonderepressible 2
	Modification date	20200313
	UniProtAcc	Q9P2K8

Child GO biological process term(s) under GO:0006412

GO ID	GO term
GO:0017148	Negative regulation of translation
GO:0006417	Regulation of translation
GO:0005840	Ribosome
GO:0045727	Positive regulation of translation
GO:0006413	Translational initiation
GO:0006412	Translation

Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Inferred gene age of translation factor.

Gene	Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25
EIF2AK4	>1119.25

Top

Translation Studies in PubMed

We searched PubMed using 'EIF2AK4[title] AND translation [title] AND human.'

Gene	Title	PMID
EIF2AK4	.	.

Top

Exon Skipping Events

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.
For more annotations, please visit our ExonSkipDB.

Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.

ENST	Exon skip start (DNA)	Exon Skip end (DNA)	ORF
ENST00000263791	40231705	40231818	Frame-shift
ENST00000263791	40246104	40246185	In-frame
ENST00000263791	40257886	40258044	Frame-shift
ENST00000263791	40270278	40270348	Frame-shift
ENST00000263791	40278005	40278089	In-frame
ENST00000263791	40300227	40300396	Frame-shift
ENST00000263791	40308702	40308873	In-frame
ENST00000263791	40311293	40311401	In-frame
ENST00000263791	40318177	40318290	Frame-shift
ENST00000263791	40321606	40321665	Frame-shift
ENST00000263791	40322559	40322657	Frame-shift
ENST00000263791	40324369	40324438	In-frame
ENST00000263791	40324957	40325002	In-frame

Exon skipping position in the amino acid sequence.

ENST	Exon skip start (DNA)	Exon Skip end (DNA)	Len(transcript seq)	Exon skip start (mRNA)	Exon Skip end (mRNA)	Len(amino acid seq)	Exon skip start (AA)	Exon Skip end (AA)
ENST00000263791	40278005	40278089	5516	2363	2446	1649	773	801
ENST00000263791	40308702	40308873	5516	3803	3973	1649	1253	1310
ENST00000263791	40311293	40311401	5516	4109	4216	1649	1355	1391
ENST00000263791	40324369	40324438	5516	4703	4771	1649	1553	1576
ENST00000263791	40324957	40325002	5516	4772	4816	1649	1576	1591

Potentially (partially) lost protein functional features of UniProt.

UniProtAcc

Exon skip start (AA)

Exon Skip end (AA)

Function feature start (AA)

Function feature end (AA)

Functional feature type

Functional feature desc.

Top

Expression

Gene expression level across TCGA pancancer

Gene expression level across GTEx pantissue

Expression level of gene isoforms across TCGA pancancer

Expression level of gene isoforms across GTEx pantissue

Cancer(tissue) type-specific expression level of Translation factor using z-score distriution

Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples)

Cancer type	Translation factor	FC	adj.pval
LIHC	EIF2AK4	-4.60322890059861	0.00188131470650586
LUSC	EIF2AK4	1.88005113022765	0.00283162168555847

Top

Expression Regulation

Translation factor expression regulation through miRNA binding

Cancer type

Gene

miRNA

TargetScan binding score (Context++ score percentile)

Coefficient

Pvalue

Translation factor expression regulation through methylation in the promoter of Translation factor

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation)

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through copy number variation of Translation factor

Cancer type	Gene	Coefficient	Pvalue
STAD	EIF2AK4	-0.094579938	0.016872023
LAML	EIF2AK4	0.030732195	0.038863573

Top

Associated Genes

Strongly correlated genes belong to cellular important gene groups with EIF2AK4 (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green)

Cancer type	Gene group	Translation factor	Correlated gene	Coefficient	Pvalue
DLBC	CGC	EIF2AK4	ABL1	0.825328069	5.36E-13
DLBC	IUPHAR	EIF2AK4	ABL1	0.825328069	5.36E-13
DLBC	Kinase	EIF2AK4	ABL1	0.825328069	5.36E-13
DLBC	TF	EIF2AK4	KLF13	0.827913971	3.92E-13
THYM	Cell metabolism gene	EIF2AK4	PIK3C2A	0.818712069	1.08E-30
THYM	CGC	EIF2AK4	AFF4	0.800136068	2.08E-28
THYM	CGC	EIF2AK4	SETBP1	0.822949364	3.00E-31
THYM	Epifactor	EIF2AK4	KDM3B	0.800018669	2.15E-28
THYM	Epifactor	EIF2AK4	ZMYND11	0.826878326	8.83E-32
THYM	Epifactor	EIF2AK4	BMI1	0.832756608	1.34E-32
THYM	IUPHAR	EIF2AK4	KDM3B	0.800018669	2.15E-28
THYM	IUPHAR	EIF2AK4	SLC35F5	0.801034637	1.64E-28
THYM	IUPHAR	EIF2AK4	SLC35A5	0.801936094	1.28E-28
THYM	IUPHAR	EIF2AK4	PIK3C2A	0.818712069	1.08E-30
THYM	IUPHAR	EIF2AK4	ZMYND11	0.826878326	8.83E-32
THYM	TF	EIF2AK4	SETBP1	0.822949364	3.00E-31
THYM	TSG	EIF2AK4	KDM3B	0.800018669	2.15E-28
THYM	TSG	EIF2AK4	RNF111	0.813331293	5.28E-30
THYM	TSG	EIF2AK4	ZMYND11	0.826878326	8.83E-32
UCS	Cell metabolism gene	EIF2AK4	PIK3C2A	0.818712069	1.08E-30
UCS	CGC	EIF2AK4	AFF4	0.800136068	2.08E-28
UCS	CGC	EIF2AK4	SETBP1	0.822949364	3.00E-31
UCS	Epifactor	EIF2AK4	KDM3B	0.800018669	2.15E-28
UCS	Epifactor	EIF2AK4	ZMYND11	0.826878326	8.83E-32
UCS	Epifactor	EIF2AK4	BMI1	0.832756608	1.34E-32
UCS	IUPHAR	EIF2AK4	KDM3B	0.800018669	2.15E-28
UCS	IUPHAR	EIF2AK4	SLC35F5	0.801034637	1.64E-28
UCS	IUPHAR	EIF2AK4	SLC35A5	0.801936094	1.28E-28
UCS	IUPHAR	EIF2AK4	PIK3C2A	0.818712069	1.08E-30
UCS	IUPHAR	EIF2AK4	ZMYND11	0.826878326	8.83E-32
UCS	TF	EIF2AK4	SETBP1	0.822949364	3.00E-31
UCS	TSG	EIF2AK4	KDM3B	0.800018669	2.15E-28
UCS	TSG	EIF2AK4	RNF111	0.813331293	5.28E-30
UCS	TSG	EIF2AK4	ZMYND11	0.826878326	8.83E-32
UVM	Cell metabolism gene	EIF2AK4	AGPS	0.80451787	2.50E-19
UVM	Cell metabolism gene	EIF2AK4	EDEM3	0.805158859	2.23E-19
UVM	Cell metabolism gene	EIF2AK4	POLR2B	0.805249051	2.19E-19
UVM	Cell metabolism gene	EIF2AK4	SMG1	0.805708637	2.02E-19
UVM	Cell metabolism gene	EIF2AK4	CDK8	0.809627483	9.86E-20
UVM	Cell metabolism gene	EIF2AK4	YAP1	0.809865263	9.44E-20
UVM	Cell metabolism gene	EIF2AK4	PPAT	0.810664583	8.14E-20
UVM	Cell metabolism gene	EIF2AK4	COL4A3BP	0.811828474	6.55E-20
UVM	Cell metabolism gene	EIF2AK4	PPARA	0.811981256	6.37E-20
UVM	Cell metabolism gene	EIF2AK4	GPD2	0.812762416	5.50E-20
UVM	Cell metabolism gene	EIF2AK4	NUP50	0.819706899	1.45E-20
UVM	Cell metabolism gene	EIF2AK4	POLD3	0.82036151	1.28E-20
UVM	Cell metabolism gene	EIF2AK4	NUPL1	0.821042763	1.11E-20
UVM	Cell metabolism gene	EIF2AK4	PIKFYVE	0.821273576	1.07E-20
UVM	Cell metabolism gene	EIF2AK4	SPTLC1	0.825969754	4.15E-21
UVM	Cell metabolism gene	EIF2AK4	CLOCK	0.82731845	3.15E-21
UVM	Cell metabolism gene	EIF2AK4	PIK3CA	0.828182279	2.63E-21
UVM	Cell metabolism gene	EIF2AK4	XPO1	0.828928224	2.26E-21
UVM	Cell metabolism gene	EIF2AK4	DIS3	0.830717204	1.55E-21
UVM	Cell metabolism gene	EIF2AK4	RANBP2	0.85013761	1.98E-23
UVM	Cell metabolism gene	EIF2AK4	MED17	0.85214413	1.22E-23
UVM	Cell metabolism gene	EIF2AK4	PIK3C3	0.878204564	1.06E-26
UVM	Cell metabolism gene	EIF2AK4	HIF1A	0.88838214	4.30E-28
UVM	CGC	EIF2AK4	RGPD3	0.805223526	2.20E-19
UVM	CGC	EIF2AK4	CREB1	0.805615218	2.05E-19
UVM	CGC	EIF2AK4	BMPR1A	0.805890868	1.95E-19
UVM	CGC	EIF2AK4	NF1	0.806909763	1.62E-19
UVM	CGC	EIF2AK4	IL6ST	0.809906781	9.37E-20
UVM	CGC	EIF2AK4	CDC73	0.817595348	2.19E-20
UVM	CGC	EIF2AK4	AFF4	0.818156478	1.96E-20
UVM	CGC	EIF2AK4	PALB2	0.818847247	1.72E-20
UVM	CGC	EIF2AK4	SF3B1	0.822957737	7.62E-21
UVM	CGC	EIF2AK4	CUL3	0.825599731	4.47E-21
UVM	CGC	EIF2AK4	ERCC4	0.827455868	3.06E-21
UVM	CGC	EIF2AK4	PIK3CA	0.828182279	2.63E-21
UVM	CGC	EIF2AK4	XPO1	0.828928224	2.26E-21
UVM	CGC	EIF2AK4	ARID2	0.830450853	1.64E-21
UVM	CGC	EIF2AK4	SMAD4	0.831438318	1.33E-21
UVM	CGC	EIF2AK4	FBXO11	0.835080223	6.12E-22
UVM	CGC	EIF2AK4	MYO5A	0.840581179	1.82E-22
UVM	CGC	EIF2AK4	STRN	0.842349132	1.22E-22
UVM	CGC	EIF2AK4	ATF1	0.842627376	1.15E-22
UVM	CGC	EIF2AK4	BIRC6	0.85004896	2.02E-23
UVM	CGC	EIF2AK4	RANBP2	0.85013761	1.98E-23
UVM	CGC	EIF2AK4	STAG1	0.856802492	3.83E-24
UVM	CGC	EIF2AK4	USP8	0.869488552	1.32E-25
UVM	CGC	EIF2AK4	KDM5A	0.878499168	9.69E-27
UVM	CGC	EIF2AK4	HIF1A	0.88838214	4.30E-28
UVM	Epifactor	EIF2AK4	WAC	0.800018199	5.53E-19
UVM	Epifactor	EIF2AK4	CHUK	0.800092036	5.46E-19
UVM	Epifactor	EIF2AK4	SUPT16H	0.802337908	3.68E-19
UVM	Epifactor	EIF2AK4	REST	0.802587936	3.52E-19
UVM	Epifactor	EIF2AK4	LEO1	0.803149762	3.19E-19
UVM	Epifactor	EIF2AK4	USP12	0.803782711	2.85E-19
UVM	Epifactor	EIF2AK4	ERCC6	0.80422975	2.63E-19
UVM	Epifactor	EIF2AK4	FAM175B	0.806695578	1.69E-19
UVM	Epifactor	EIF2AK4	RCOR1	0.806945957	1.61E-19
UVM	Epifactor	EIF2AK4	UHRF2	0.80710634	1.56E-19
UVM	Epifactor	EIF2AK4	ATF2	0.807531578	1.45E-19
UVM	Epifactor	EIF2AK4	SMEK1	0.811317697	7.21E-20
UVM	Epifactor	EIF2AK4	UCHL5	0.811743369	6.66E-20
UVM	Epifactor	EIF2AK4	CTR9	0.811849975	6.53E-20
UVM	Epifactor	EIF2AK4	CHD9	0.813538699	4.75E-20
UVM	Epifactor	EIF2AK4	ZMYND11	0.816187891	2.87E-20
UVM	Epifactor	EIF2AK4	CDC73	0.817595348	2.19E-20
UVM	Epifactor	EIF2AK4	HAT1	0.8181652	1.96E-20
UVM	Epifactor	EIF2AK4	CUL2	0.821087433	1.11E-20
UVM	Epifactor	EIF2AK4	SF3B1	0.822957737	7.62E-21
UVM	Epifactor	EIF2AK4	SMEK2	0.82314763	7.33E-21
UVM	Epifactor	EIF2AK4	YY1	0.824978589	5.07E-21
UVM	Epifactor	EIF2AK4	CUL3	0.825599731	4.47E-21
UVM	Epifactor	EIF2AK4	CLOCK	0.82731845	3.15E-21
UVM	Epifactor	EIF2AK4	UBR2	0.828083592	2.69E-21
UVM	Epifactor	EIF2AK4	PPP4R2	0.829065586	2.19E-21
UVM	Epifactor	EIF2AK4	ARID2	0.830450853	1.64E-21
UVM	Epifactor	EIF2AK4	PARG	0.837963092	3.26E-22
UVM	Epifactor	EIF2AK4	EPC2	0.842264334	1.24E-22
UVM	Epifactor	EIF2AK4	ZRANB3	0.844121522	8.14E-23
UVM	Epifactor	EIF2AK4	HMG20A	0.844293721	7.82E-23
UVM	Epifactor	EIF2AK4	INO80	0.852859862	1.02E-23
UVM	Epifactor	EIF2AK4	USP3	0.863053145	7.60E-25
UVM	Epifactor	EIF2AK4	EPC1	0.86731889	2.41E-25
UVM	Epifactor	EIF2AK4	MGA	0.87149568	7.51E-26
UVM	Epifactor	EIF2AK4	KDM5A	0.878499168	9.69E-27
UVM	IUPHAR	EIF2AK4	CHUK	0.800092036	5.46E-19
UVM	IUPHAR	EIF2AK4	PTPRG	0.801784937	4.06E-19
UVM	IUPHAR	EIF2AK4	ADAM17	0.802563486	3.54E-19
UVM	IUPHAR	EIF2AK4	RIOK1	0.803877538	2.80E-19
UVM	IUPHAR	EIF2AK4	SMG1	0.805708637	2.02E-19
UVM	IUPHAR	EIF2AK4	BMPR1A	0.805890868	1.95E-19
UVM	IUPHAR	EIF2AK4	IDE	0.806107707	1.88E-19
UVM	IUPHAR	EIF2AK4	MAPK6	0.807605485	1.43E-19
UVM	IUPHAR	EIF2AK4	CDK8	0.809627483	9.86E-20
UVM	IUPHAR	EIF2AK4	IL6ST	0.809906781	9.37E-20
UVM	IUPHAR	EIF2AK4	PPAT	0.810664583	8.14E-20
UVM	IUPHAR	EIF2AK4	PPARA	0.811981256	6.37E-20
UVM	IUPHAR	EIF2AK4	RIOK3	0.812611442	5.66E-20
UVM	IUPHAR	EIF2AK4	ZMYND11	0.816187891	2.87E-20
UVM	IUPHAR	EIF2AK4	TTBK2	0.817728675	2.13E-20
UVM	IUPHAR	EIF2AK4	MAP3K2	0.817915367	2.06E-20
UVM	IUPHAR	EIF2AK4	HAT1	0.8181652	1.96E-20
UVM	IUPHAR	EIF2AK4	PIKFYVE	0.821273576	1.07E-20
UVM	IUPHAR	EIF2AK4	SCYL2	0.824410699	5.69E-21
UVM	IUPHAR	EIF2AK4	SPTLC1	0.825969754	4.15E-21
UVM	IUPHAR	EIF2AK4	CLOCK	0.82731845	3.15E-21
UVM	IUPHAR	EIF2AK4	PIK3CA	0.828182279	2.63E-21
UVM	IUPHAR	EIF2AK4	XPO1	0.828928224	2.26E-21
UVM	IUPHAR	EIF2AK4	FBXO11	0.835080223	6.12E-22
UVM	IUPHAR	EIF2AK4	USP14	0.838288481	3.03E-22
UVM	IUPHAR	EIF2AK4	TNKS2	0.840433512	1.88E-22
UVM	IUPHAR	EIF2AK4	NR2C1	0.840629175	1.80E-22
UVM	IUPHAR	EIF2AK4	HIPK3	0.847641563	3.58E-23
UVM	IUPHAR	EIF2AK4	BIRC6	0.85004896	2.02E-23
UVM	IUPHAR	EIF2AK4	MAPK8	0.855796526	4.93E-24
UVM	IUPHAR	EIF2AK4	TRPM7	0.86155235	1.13E-24
UVM	IUPHAR	EIF2AK4	PIK3C3	0.878204564	1.06E-26
UVM	IUPHAR	EIF2AK4	KDM5A	0.878499168	9.69E-27
UVM	IUPHAR	EIF2AK4	DPP8	0.902377059	3.04E-30
UVM	Kinase	EIF2AK4	CHUK	0.800092036	5.46E-19
UVM	Kinase	EIF2AK4	RIOK1	0.803877538	2.80E-19
UVM	Kinase	EIF2AK4	SMG1	0.805708637	2.02E-19
UVM	Kinase	EIF2AK4	BMPR1A	0.805890868	1.95E-19
UVM	Kinase	EIF2AK4	MAPK6	0.807605485	1.43E-19
UVM	Kinase	EIF2AK4	CDK8	0.809627483	9.86E-20
UVM	Kinase	EIF2AK4	COL4A3BP	0.811828474	6.55E-20
UVM	Kinase	EIF2AK4	RIOK3	0.812611442	5.66E-20
UVM	Kinase	EIF2AK4	TTBK2	0.817728675	2.13E-20
UVM	Kinase	EIF2AK4	MAP3K2	0.817915367	2.06E-20
UVM	Kinase	EIF2AK4	SCYL2	0.824410699	5.69E-21
UVM	Kinase	EIF2AK4	HIPK3	0.847641563	3.58E-23
UVM	Kinase	EIF2AK4	MAPK8	0.855796526	4.93E-24
UVM	Kinase	EIF2AK4	TRPM7	0.86155235	1.13E-24
UVM	TF	EIF2AK4	ZNF146	0.800636937	4.96E-19
UVM	TF	EIF2AK4	REST	0.802587936	3.52E-19
UVM	TF	EIF2AK4	CREB1	0.805615218	2.05E-19
UVM	TF	EIF2AK4	ZNF430	0.807093695	1.57E-19
UVM	TF	EIF2AK4	ZNF81	0.807418726	1.48E-19
UVM	TF	EIF2AK4	ATF2	0.807531578	1.45E-19
UVM	TF	EIF2AK4	ZNF484	0.808167066	1.29E-19
UVM	TF	EIF2AK4	ZNF347	0.809200647	1.07E-19
UVM	TF	EIF2AK4	ZNF281	0.811657202	6.77E-20
UVM	TF	EIF2AK4	PPARA	0.811981256	6.37E-20
UVM	TF	EIF2AK4	ZNF236	0.813052012	5.21E-20
UVM	TF	EIF2AK4	ZNF234	0.813083587	5.18E-20
UVM	TF	EIF2AK4	ZNF17	0.814267051	4.14E-20
UVM	TF	EIF2AK4	ZNF420	0.815459139	3.30E-20
UVM	TF	EIF2AK4	ZNF143	0.815844125	3.07E-20
UVM	TF	EIF2AK4	ZNF41	0.816287547	2.82E-20
UVM	TF	EIF2AK4	ZBTB6	0.816563745	2.67E-20
UVM	TF	EIF2AK4	ZNF558	0.818414489	1.87E-20
UVM	TF	EIF2AK4	RFX7	0.823322414	7.08E-21
UVM	TF	EIF2AK4	YY1	0.824978589	5.07E-21
UVM	TF	EIF2AK4	ZNF131	0.825223817	4.83E-21
UVM	TF	EIF2AK4	CLOCK	0.82731845	3.15E-21
UVM	TF	EIF2AK4	ARID2	0.830450853	1.64E-21
UVM	TF	EIF2AK4	SMAD4	0.831438318	1.33E-21
UVM	TF	EIF2AK4	PRDM10	0.832178119	1.14E-21
UVM	TF	EIF2AK4	ZNF791	0.832458665	1.07E-21
UVM	TF	EIF2AK4	TOPORS	0.835603127	5.46E-22
UVM	TF	EIF2AK4	ZNF45	0.836443002	4.55E-22
UVM	TF	EIF2AK4	NR2C1	0.840629175	1.80E-22
UVM	TF	EIF2AK4	ZSCAN29	0.84163736	1.43E-22
UVM	TF	EIF2AK4	ATF1	0.842627376	1.15E-22
UVM	TF	EIF2AK4	HMG20A	0.844293721	7.82E-23
UVM	TF	EIF2AK4	ELK3	0.847507301	3.70E-23
UVM	TF	EIF2AK4	SP3	0.861772238	1.07E-24
UVM	TF	EIF2AK4	MEF2A	0.867639525	2.20E-25
UVM	TF	EIF2AK4	MGA	0.87149568	7.51E-26
UVM	TF	EIF2AK4	HIF1A	0.88838214	4.30E-28
UVM	TSG	EIF2AK4	CHUK	0.800092036	5.46E-19
UVM	TSG	EIF2AK4	MLH3	0.801817005	4.03E-19
UVM	TSG	EIF2AK4	COPS2	0.803075943	3.23E-19
UVM	TSG	EIF2AK4	USP12	0.803782711	2.85E-19
UVM	TSG	EIF2AK4	DCLRE1A	0.805439877	2.12E-19
UVM	TSG	EIF2AK4	BMPR1A	0.805890868	1.95E-19
UVM	TSG	EIF2AK4	NF1	0.806909763	1.62E-19
UVM	TSG	EIF2AK4	UHRF2	0.80710634	1.56E-19
UVM	TSG	EIF2AK4	PDS5B	0.809709203	9.71E-20
UVM	TSG	EIF2AK4	YAP1	0.809865263	9.44E-20
UVM	TSG	EIF2AK4	PPARA	0.811981256	6.37E-20
UVM	TSG	EIF2AK4	ZMYND11	0.816187891	2.87E-20
UVM	TSG	EIF2AK4	INTS6	0.816615341	2.64E-20
UVM	TSG	EIF2AK4	CDC73	0.817595348	2.19E-20
UVM	TSG	EIF2AK4	PIAS1	0.817701556	2.14E-20
UVM	TSG	EIF2AK4	GTPBP4	0.818801588	1.73E-20
UVM	TSG	EIF2AK4	PALB2	0.818847247	1.72E-20
UVM	TSG	EIF2AK4	CUL2	0.821087433	1.11E-20
UVM	TSG	EIF2AK4	SMCHD1	0.822355545	8.59E-21
UVM	TSG	EIF2AK4	ARID2	0.830450853	1.64E-21
UVM	TSG	EIF2AK4	SMAD4	0.831438318	1.33E-21
UVM	TSG	EIF2AK4	KRIT1	0.834673259	6.68E-22
UVM	TSG	EIF2AK4	TOPORS	0.835603127	5.46E-22
UVM	TSG	EIF2AK4	WDR11	0.838390936	2.97E-22
UVM	TSG	EIF2AK4	RNF111	0.8705383	9.84E-26
UVM	TSG	EIF2AK4	KDM5A	0.878499168	9.69E-27
UVM	TSG	EIF2AK4	HIF1A	0.88838214	4.30E-28

Top

Protein structure

Protein 3D structure
Visit iCn3D.

Top

Protein-Protein Interaction

Protein-protein interaction networks
* Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

* Edge colors based on TCGA cancer types.

* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P))

Cancer type	Translation factor	Interacting protein coding gene	FC	adj.pval
LIHC	EIF2AK4	EIF2B5	-2.17335102876885	0.000112780019881286
PRAD	EIF2AK4	GCN1L1	-7.54173196078564	0.000376184722398862
STAD	EIF2AK4	EPRS	-1.48171581324647	0.000789262883452143
KIRC	EIF2AK4	GCN1L1	1.52944128066025	0.00150654978717842
LIHC	EIF2AK4	EIF2S3	-4.62530933210412	0.00154404530385922
KICH	EIF2AK4	EIF2S2	-1.06278646532411	0.00308787822723389
COAD	EIF2AK4	EIF2B5	-3.82949281161428	0.011966735124588
ESCA	EIF2AK4	EEF1A1	1.94762611248595	0.0185546875
LIHC	EIF2AK4	EEF1A1	1.48788676140446	0.0227162265784831
CHOL	EIF2AK4	EIF2B2	-1.61211785827489	0.02734375
LUAD	EIF2AK4	EEF1A1	-3.86176112530422	0.02958519941608
STAD	EIF2AK4	EIF2B1	1.06970835543362	0.0324882394634187
ESCA	EIF2AK4	EIF2S3	-1.31322237574718	0.0419921875
BRCA	EIF2AK4	EIF2S2	-2.57303037687825	1.70212120584918e-09
LIHC	EIF2AK4	GCN1L1	-1.50546993282376	2.24402029682138e-06
LIHC	EIF2AK4	EPRS	-7.10731017811505	2.28054594243154e-08
BRCA	EIF2AK4	EEF1A1	-2.99170190120593	2.4485651456383e-20
STAD	EIF2AK4	EIF2S2	-2.13186277769467	3.17529775202275e-05
LIHC	EIF2AK4	EIF2B2	-1.75683032348821	4.08414278982391e-05
LUAD	EIF2AK4	EIF2B2	-3.96081365689084	4.19177862905507e-09
KIRP	EIF2AK4	EIF2B1	-2.14953108463177	5.24520874023438e-06
LUAD	EIF2AK4	EIF2B1	-2.39668434561352	5.70558004016916e-06
LUAD	EIF2AK4	GCN1L1	-3.11494072871482	5.86248556550202e-05
KIRC	EIF2AK4	EIF2B1	-1.83635928054145	7.43306349049898e-12
PRAD	EIF2AK4	MTOR	2.45767376269894	8.16442831201447e-07
PRAD	EIF2AK4	EPRS	-1.76339127457265	9.52775218277559e-05

Protein-protein interactors with this translation factor (BIOGRID-3.4.160)

PPI interactors with EIF2AK4

USP46, GGNBP1, ARRB2, TRAP1, FAM153B, PPP1CC, PPP1CA, CROT, TARS, MATR3, LRPPRC, Edc4, Sept11, DEF8, TKT, PALM2, PSMC3, MDM4, C6orf141, CRYL1, HNRNPL, TMPO, TNIP2, TNRC6A, KIAA1429, PLEKHA4, ITGB1, nsp8, LRRC31, KIF14, LDLR, SREBF2, SMAD4, TGM2, DUSP16, CDC16, PGM2L1, MAGEA9, NUP210P1, PRPS2, PIPSL, S100P, AK9, EN1, PPP4R1L, FTL, CAPN2, KLHL34, KLHL14, DNAJA2, ALDH3B1, METTL21B, DHDH, HDHD1, CIB2, UBXN6, FBXW7,

Top

Mutations

Clinically associated variants from ClinVar.

Gene	Chr	Position	RefSeq	VarSeq	RefSeeq	VarType	Pathogenic	Disease	VarInfo
EIF2AK4	chr15	40226020	G	A	single_nucleotide_variant	Benign	not_provided
EIF2AK4	chr15	40226022	G	A	single_nucleotide_variant	Likely_benign	not_provided
EIF2AK4	chr15	40226040	G	A	single_nucleotide_variant	Likely_benign	not_provided
EIF2AK4	chr15	40226291	G	A	single_nucleotide_variant	Benign	not_provided
EIF2AK4	chr15	40226294	A	G	single_nucleotide_variant	Benign	not_provided
EIF2AK4	chr15	40226385	C	A	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis	SO:0001623\|5_prime_UTR_variant	SO:0001623\|5_prime_UTR_variant
EIF2AK4	chr15	40226456	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40226471	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40226478	C	T	single_nucleotide_variant	Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001587\|nonsense	SO:0001587\|nonsense
EIF2AK4	chr15	40226495	T	C	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_specified	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40231500	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40231625	A	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40231704	A	G	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001574\|splice_acceptor_variant	SO:0001574\|splice_acceptor_variant
EIF2AK4	chr15	40231822	A	C	single_nucleotide_variant	Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40232001	C	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40232115	G	GA	Duplication	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40235234	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40235552	CT	C	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40235552	CTT	C	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40235552	CTTT	C	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40235573	G	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40235574	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40235580	C	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40235601	T	TA	Duplication	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40235677	CTG	C	Microsatellite	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40235986	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40235994	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40241137	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40241376	C	T	single_nucleotide_variant	Likely_benign	Familial_pulmonary_capillary_hemangiomatosis	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40245836	A	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40245849	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40245926	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40246136	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40246148	TAAAAG	T	Deletion	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis\|not_provided	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40246157	A	AG	Duplication	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40246389	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40247689	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40247894	C	G	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40247935	G	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40248097	ATCTT	A	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40248122	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40248205	CT	C	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40248205	CTT	C	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40253674	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40253723	C	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40253743	G	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40253819	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40253886	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40253974	T	G	single_nucleotide_variant	Likely_benign	Familial_pulmonary_capillary_hemangiomatosis	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40253986	C	T	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001587\|nonsense	SO:0001587\|nonsense
EIF2AK4	chr15	40254107	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40254155	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40254332	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40257603	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40257615	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40257886	G	A	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001574\|splice_acceptor_variant	SO:0001574\|splice_acceptor_variant
EIF2AK4	chr15	40258329	A	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40259504	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40259519	C	CT	Duplication	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40259519	C	CTT	Duplication	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40259605	C	T	single_nucleotide_variant	Uncertain_significance	Familial_pulmonary_capillary_hemangiomatosis	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40259676	T	TG	Duplication	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40259680	GTC	G	Microsatellite	Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40259783	A	G	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40259848	A	C	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_specified	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40259914	C	T	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001587\|nonsense	SO:0001587\|nonsense
EIF2AK4	chr15	40259915	G	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40259917	GT	G	Deletion	Pathogenic/Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40259974	C	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40260002	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40260208	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40260216	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40260323	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40265105	C	A	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40265127	CAAGGA	C	Deletion	Likely_pathogenic	not_provided	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40265227	A	T	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40265310	T	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40265404	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40265503	C	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40265588	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40265799	A	G	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_specified	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40265826	T	C	single_nucleotide_variant	Uncertain_significance	Familial_pulmonary_capillary_hemangiomatosis	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40265870	C	CA	Duplication	Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40265886	G	A	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40265927	G	C	single_nucleotide_variant	Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40268426	G	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40268544	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40268616	T	G	single_nucleotide_variant	Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40268724	T	G	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40268764	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40268816	C	T	single_nucleotide_variant	Benign/Likely_benign	Familial_pulmonary_capillary_hemangiomatosis\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40268821	G	A	single_nucleotide_variant	Likely_benign	Familial_pulmonary_capillary_hemangiomatosis	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40268854	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40268931	G	GCACT	Duplication	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40268987	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40268998	G	GGACGAC	Microsatellite	Benign	not_specified\|not_provided	SO:0001821\|inframe_insertion	SO:0001821\|inframe_insertion
EIF2AK4	chr15	40268999	G	GGACGAC	Insertion	Benign	Familial_pulmonary_capillary_hemangiomatosis	SO:0001820\|inframe_indel	SO:0001820\|inframe_indel
EIF2AK4	chr15	40269004	C	CCGACGA	Insertion	Benign	Familial_pulmonary_capillary_hemangiomatosis	SO:0001821\|inframe_insertion	SO:0001821\|inframe_insertion
EIF2AK4	chr15	40269052	G	A	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40269060	C	A	single_nucleotide_variant	Likely_benign	Familial_pulmonary_capillary_hemangiomatosis	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40269079	G	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40269102	A	AT	Duplication	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40269126	T	TTTCC	Microsatellite	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40269332	T	TCAAAAA	Insertion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40269333	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40269333	T	TAAAAAC	Microsatellite	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40270046	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40270047	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40270214	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40270349	G	A	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001575\|splice_donor_variant	SO:0001575\|splice_donor_variant
EIF2AK4	chr15	40270638	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40277904	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40278002	T	G	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40278101	G	A	single_nucleotide_variant	Benign/Likely_benign	Familial_pulmonary_capillary_hemangiomatosis\|not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40278192	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40280238	C	T	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001587\|nonsense	SO:0001587\|nonsense
EIF2AK4	chr15	40280539	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40282625	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40282701	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40284208	T	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40284406	G	C	single_nucleotide_variant	Benign/Likely_benign	Familial_pulmonary_capillary_hemangiomatosis\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40284523	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40284802	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40284849	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40285010	C	G	single_nucleotide_variant	Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40285120	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40285231	G	GTCCA	Microsatellite	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40285249	CCATCCATCCATCCATCCATCCATCCATT	C	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40285253	CCATCCATCCATCCATCCATCCATT	C	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40285257	CCATCCATCCATCCATCCATT	C	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40285304	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40285339	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40289237	AG	A	Deletion	Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40289255	C	T	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001587\|nonsense	SO:0001587\|nonsense
EIF2AK4	chr15	40289608	C	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40290663	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40290706	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40290989	A	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40291130	C	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40291140	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40291279	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40293022	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40293317	CACGCTGACCA	C	Deletion	Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40293320	G	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40293363	C	T	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001587\|nonsense	SO:0001587\|nonsense
EIF2AK4	chr15	40293389	T	G	single_nucleotide_variant	Likely_benign	Familial_pulmonary_capillary_hemangiomatosis	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40293395	C	T	single_nucleotide_variant	Likely_benign	Familial_pulmonary_capillary_hemangiomatosis	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40293413	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40293425	G	A	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40293530	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40293724	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40294906	T	C	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40294929	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40294963	C	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40295402	C	T	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001587\|nonsense	SO:0001587\|nonsense
EIF2AK4	chr15	40295465	C	T	single_nucleotide_variant	Likely_benign	Familial_pulmonary_capillary_hemangiomatosis	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40295483	G	A	single_nucleotide_variant	Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40295502	C	T	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40295752	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40299016	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40299200	TTTTG	T	Deletion	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_specified\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40299265	C	T	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001587\|nonsense	SO:0001587\|nonsense
EIF2AK4	chr15	40299914	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40300055	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40300092	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40300121	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40300214	G	C	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40300268	C	T	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001587\|nonsense	SO:0001587\|nonsense
EIF2AK4	chr15	40300397	G	T	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001575\|splice_donor_variant	SO:0001575\|splice_donor_variant
EIF2AK4	chr15	40300443	T	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40300547	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40300691	G	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40301502	C	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40301843	A	T	single_nucleotide_variant	Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40302243	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40303293	ATAAGT	A	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40303477	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40303493	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40303842	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40308648	A	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40308709	C	T	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001587\|nonsense	SO:0001587\|nonsense
EIF2AK4	chr15	40308745	C	T	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001587\|nonsense	SO:0001587\|nonsense
EIF2AK4	chr15	40308827	T	G	single_nucleotide_variant	Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40308859	G	T	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_specified	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40309385	A	G	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40309444	G	C	single_nucleotide_variant	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001575\|splice_donor_variant	SO:0001575\|splice_donor_variant
EIF2AK4	chr15	40309703	TA	T	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40309704	A	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40309705	TATATATATATATATATA	T	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40309705	TATATATATATATATATATA	T	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40309705	TATATATATATATATATATATA	T	Deletion	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40309705	TATATATATATATATATATATATA	T	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40309705	TATATATATATATATATATATATATATATA	T	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40309744	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40309748	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40309749	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40311212	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40312838	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40312922	CT	C	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40313083	G	T	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40313130	G	GT	Duplication	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40313141	C	T	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_specified	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40313144	G	T	single_nucleotide_variant	Benign/Likely_benign	not_specified\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40313386	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40314419	GT	G	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40314474	TCTTA	T	Deletion	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40314526	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40314669	CT	C	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40314711	T	G	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40314967	C	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40318178	G	GT	Duplication	Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001587\|nonsense	SO:0001587\|nonsense
EIF2AK4	chr15	40318185	C	CT	Duplication	Likely_pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40318201	GCAGA	G	Microsatellite	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40318312	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40318388	G	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40318501	T	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40318536	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40321351	C	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40321436	C	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40322296	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40322460	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40322548	T	G	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40322552	G	T	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40322589	GT	G	Deletion	Likely_pathogenic	Pulmonary_venoocclusive_disease_1,_autosomal_dominant	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40322614	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
EIF2AK4	chr15	40324075	G	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40324322	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40324381	A	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40324439	GTAAGTGGCTTTC	TTCT	Indel	Pathogenic	Familial_pulmonary_capillary_hemangiomatosis	SO:0001575\|splice_donor_variant	SO:0001575\|splice_donor_variant
EIF2AK4	chr15	40324481	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40324729	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40324837	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40324996	AT	A	Deletion	Likely_pathogenic	Pulmonary_arterial_hypertension	SO:0001587\|nonsense	SO:0001587\|nonsense
EIF2AK4	chr15	40326229	CA	C	Deletion	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
EIF2AK4	chr15	40326604	A	G	single_nucleotide_variant	Uncertain_significance	Familial_pulmonary_capillary_hemangiomatosis	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
EIF2AK4	chr15	40327233	CTG	C	Microsatellite	Uncertain_significance	Familial_pulmonary_capillary_hemangiomatosis	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
EIF2AK4	chr15	40327290	A	G	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_specified	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
EIF2AK4	chr15	40327301	G	A	single_nucleotide_variant	Benign	Familial_pulmonary_capillary_hemangiomatosis\|not_specified	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
EIF2AK4	chr15	40327380	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant

nsSNVs with sample frequency (size of circle) from TCGA 33 cancers.

SNVs and Indels

Gene	Cancer type	Chromosome	Start	End	RefSeeq	MutSeq	Mutation type	AAchange	# samples
EIF2AK4	ESCA	chr15	40318214	40318214	C	T	Missense_Mutation	p.R1476C	7
EIF2AK4	COAD	chr15	40226495	40226495	T	C	Silent	p.I33I	6
EIF2AK4	READ	chr15	40259920	40259920	C	T	Missense_Mutation	p.R465C	5
EIF2AK4	LGG	chr15	40258023	40258023	G	A	Silent	p.K332K	4
EIF2AK4	SKCM	chr15	40282489	40282489	G	A	Missense_Mutation	p.D848N	4
EIF2AK4	BLCA	chr15	40282508	40282508	T	-	Frame_Shift_Del	p.I854fs	4
EIF2AK4	ESCA	chr15	40326639	40326639	A	-	Frame_Shift_Del	p.E1629fs	4
EIF2AK4	KIRP	chr15	40324962	40324962	A	G	Missense_Mutation	p.D1578G	4
EIF2AK4	COAD	chr15	40303495	40303495	C	T	Missense_Mutation	p.T1236M	4
EIF2AK4	SKCM	chr15	40313113	40313113	C	T	Missense_Mutation	p.S1396F	3
EIF2AK4	LIHC	chr15	40268641	40268641	C	T	Silent		3
EIF2AK4	LUAD	chr15	40269028	40269028	C	G	Silent	p.V744V	3
EIF2AK4	BLCA	chr15	40241433	40241433	G	A	Silent	p.Q159Q	3
EIF2AK4	KIRC	chr15	40299227	40299227	C	G	Missense_Mutation	p.A1123G	3
EIF2AK4	BLCA	chr15	40259848	40259848	A	C	Missense_Mutation		3
EIF2AK4	HNSC	chr15	40268785	40268785	G	A	Silent	p.A663A	3
EIF2AK4	PAAD	chr15	40269004	40269004	C	T	Silent	p.D736D	3
EIF2AK4	COAD	chr15	40268998	40268999	-	GACGAC	In_Frame_Ins	p.E734delinsEDD	3
EIF2AK4	ESCA	chr15	40280227	40280227	A	G	Missense_Mutation	p.Q816R	3
EIF2AK4	PRAD	chr15	40313180	40313180	A	G	Silent	p.K1418K	3
EIF2AK4	LIHC	chr15	40268641	40268641	C	T	Silent	p.C615C	3
EIF2AK4	SKCM	chr15	40254023	40254023	C	T	Missense_Mutation	p.S261F	3
EIF2AK4	SKCM	chr15	40300277	40300277	C	T	Missense_Mutation	p.P1153S	3
EIF2AK4	SKCM	chr15	40301883	40301883	C	T	Silent	p.I1215I	3
EIF2AK4	ACC	chr15	40326638	40326639	-	A	Frame_Shift_Ins	p.E1629fs	2
EIF2AK4	BLCA	chr15	40301819	40301819	G	C	Missense_Mutation	p.R1194T	2
EIF2AK4	UCEC	chr15	40326622	40326622	T	G	Missense_Mutation	p.I1623M	2
EIF2AK4	SKCM	chr15	40259841	40259841	C	T	Silent	p.T438T	2
EIF2AK4	STAD	chr15	40300240	40300240	A	G	Silent	p.E1140E	2
EIF2AK4	BRCA	chr15	40308734	40308734	A	C	Missense_Mutation	p.K1264T	2
EIF2AK4	LIHC	chr15	40259769	40259769	T	-	Frame_Shift_Del	p.D414fs	2
EIF2AK4	ESCA	chr15	40278066	40278066	G	T	Missense_Mutation	p.A794S	2
EIF2AK4	UCEC	chr15	40259646	40259646	C	T	Silent	p.I373	2
EIF2AK4	LUAD	chr15	40284993	40284993	A	T	Missense_Mutation	p.T904S	2
EIF2AK4	SKCM	chr15	40247835	40247835	T	C	Silent	p.I203I	2
EIF2AK4	STAD	chr15	40322596	40322596	T	C	Missense_Mutation	p.I1533T	2
EIF2AK4	CESC	chr15	40241419	40241419	C	G	Missense_Mutation		2
EIF2AK4	LIHC	chr15	40321621	40321621	A	G	Missense_Mutation		2
EIF2AK4	UCEC	chr15	40269025	40269025	C	T	Silent	p.G743	2
EIF2AK4	LIHC	chr15	40265176	40265176	C	-	Frame_Shift_Del	p.P541fs	2
EIF2AK4	SKCM	chr15	40293202	40293202	C	T	Missense_Mutation	p.S979F	2
EIF2AK4	SKCM	chr15	40300312	40300312	C	G	Silent	p.V1164V	2
EIF2AK4	HNSC	chr15	40257961	40257961	G	C	Missense_Mutation	p.E312Q	2
EIF2AK4	ESCA	chr15	40280227	40280227	A	G	Missense_Mutation		2
EIF2AK4	UCEC	chr15	40284381	40284381	C	T	Silent	p.D879	2
EIF2AK4	KIRC	chr15	40268968	40268968	C	A	Silent	p.P724P	2
EIF2AK4	LIHC	chr15	40265883	40265883	C	-	Frame_Shift_Del	p.S584fs	2
EIF2AK4	SKCM	chr15	40295428	40295428	C	T	Silent	p.P1090P	2
EIF2AK4	SARC	chr15	40289171	40289171	G	T	Missense_Mutation	p.D925Y	2
EIF2AK4	LIHC	chr15	40321621	40321621	A	G	Missense_Mutation	p.N1506S	2
EIF2AK4	SKCM	chr15	40300332	40300332	T	C	Missense_Mutation	p.F1171S	2
EIF2AK4	STAD	chr15	40308866	40308866	A	G	Missense_Mutation	p.K1308R	2
EIF2AK4	HNSC	chr15	40241351	40241351	C	G	Nonsense_Mutation	p.S132*	2
EIF2AK4	UCEC	chr15	40300268	40300268	C	A	Silent	p.R1150	2
EIF2AK4	KIRC	chr15	40299258	40299258	T	-	Frame_Shift_Del	p.N1133fs	2
EIF2AK4	LIHC	chr15	40259657	40259657	T	-	Frame_Shift_Del	p.I377fs	2
EIF2AK4	SKCM	chr15	40265894	40265894	A	C	Missense_Mutation	p.I588L	2
EIF2AK4	STAD	chr15	40265871	40265871	A	G	Missense_Mutation		2
EIF2AK4	STAD	chr15	40284379	40284379	G	C	Missense_Mutation	p.D879H	2
EIF2AK4	HNSC	chr15	40295429	40295429	C	T	Nonsense_Mutation	p.R1091*	2
EIF2AK4	ESCA	chr15	40318214	40318214	C	T	Missense_Mutation		2
EIF2AK4	UCEC	chr15	40303518	40303518	T	G	Missense_Mutation	p.F1244V	2
EIF2AK4	PAAD	chr15	40303495	40303495	C	T	Missense_Mutation		2
EIF2AK4	STAD	chr15	40318190	40318190	G	A	Missense_Mutation		2
EIF2AK4	LGG	chr15	40241413	40241413	C	T	Missense_Mutation	p.R153W	2
EIF2AK4	COAD	chr15	40259877	40259877	C	T	Silent	p.L450L	2
EIF2AK4	UCEC	chr15	40309311	40309311	C	A	Silent	p.V1311	2
EIF2AK4	KIRC	chr15	40308848	40308848	T	C	Missense_Mutation	p.L1302S	2
EIF2AK4	STAD	chr15	40265871	40265871	A	G	Missense_Mutation	p.Q580R	2
EIF2AK4	SKCM	chr15	40259915	40259915	G	A	Missense_Mutation	p.R463Q	2
EIF2AK4	STAD	chr15	40309416	40309416	C	T	Silent	p.L1346L	2
EIF2AK4	HNSC	chr15	40313219	40313219	C	T	Silent	p.D1431D	2
EIF2AK4	ESCA	chr15	40295507	40295507	G	A	Missense_Mutation	p.D1117N	2
EIF2AK4	UCEC	chr15	40309413	40309413	C	A	Silent	p.I1345	2
EIF2AK4	SKCM	chr15	40241392	40241392	C	T	Missense_Mutation	p.H146Y	2
EIF2AK4	STAD	chr15	40318190	40318190	G	A	Missense_Mutation	p.E1468K	2
EIF2AK4	UCEC	chr15	40313113	40313113	C	A	Missense_Mutation	p.S1396Y	2
EIF2AK4	SARC	chr15	40289171	40289171	G	T	Missense_Mutation		2
EIF2AK4	SKCM	chr15	40259718	40259718	C	T	Silent	p.I397I	2
EIF2AK4	STAD	chr15	40259735	40259735	G	A	Missense_Mutation	p.R403H	2
EIF2AK4	BRCA	chr15	40246168	40246168	A	T	Nonsense_Mutation	p.K193*	2
EIF2AK4	BLCA	chr15	40235658	40235658	A	G	Missense_Mutation	p.E111G	2
EIF2AK4	UCEC	chr15	40321631	40321631	G	C	Silent	p.V1509	2
EIF2AK4	SKCM	chr15	40247829	40247829	G	T	Missense_Mutation	p.L201F	2
EIF2AK4	STAD	chr15	40254062	40254062	G	T	Missense_Mutation	p.S274I	2
EIF2AK4	BRCA	chr15	40265856	40265856	T	C	Missense_Mutation	p.F575S	2
EIF2AK4	LGG	chr15	40241413	40241413	C	T	Missense_Mutation		2
EIF2AK4	HNSC	chr15	40293317	40293317	C	A	Missense_Mutation	p.H1017Q	2
EIF2AK4	BLCA	chr15	40268620	40268620	G	A	Silent	p.Q608Q	2
EIF2AK4	UCEC	chr15	40324439	40324440	-	T	Splice_Site	e36+1	2
EIF2AK4	SKCM	chr15	40259840	40259840	C	T	Missense_Mutation	p.T438I	2
EIF2AK4	STAD	chr15	40260054	40260054	A	G	Silent	p.P509P	2
EIF2AK4	BRCA	chr15	40295488	40295488	G	T	Missense_Mutation	p.M1110I	2
EIF2AK4	LGG	chr15	40258023	40258023	G	A	Silent		2
EIF2AK4	LUAD	chr15	40268969	40268969	G	-	Frame_Shift_Del	p.A725fs	2
EIF2AK4	UCEC	chr15	40253992	40253992	C	T	Missense_Mutation	p.R251C	2
EIF2AK4	HNSC	chr15	40259747	40259747	C	T	Missense_Mutation	p.A407V	2
EIF2AK4	GBM	chr15	40282488	40282488	G	A	Silent	p.R847R	1
EIF2AK4	KIRP	chr15	40226511	40226511	C	A	Missense_Mutation		1
EIF2AK4	LUAD	chr15	40259689	40259689	G	T	Missense_Mutation	p.A388S	1
EIF2AK4	SARC	chr15	40265130	40265130	G	T	Missense_Mutation		1
EIF2AK4	SKCM	chr15	40235622	40235622	C	G	Nonsense_Mutation	p.S99*	1
EIF2AK4	BLCA	chr15	40268948	40268949	-	-	Frame_Shift_Ins		1
EIF2AK4	HNSC	chr15	40259747	40259747	C	T	Missense_Mutation		1
EIF2AK4	LGG	chr15	40265883	40265883	C	T	Missense_Mutation		1
EIF2AK4	LIHC	chr15	40289257	40289257	A	G	Silent		1
EIF2AK4	LUAD	chr15	40284374	40284374	A	G	Splice_Site	p.A878_splice	1
EIF2AK4	MESO	chr15	40300339	40300339	C	A	Silent		1
EIF2AK4	TGCT	chr15	40313141	40313141	C	T	Silent		1
EIF2AK4	BLCA	chr15	40322574	40322574	C	T	Missense_Mutation		1
EIF2AK4	COAD	chr15	40308809	40308809	A	C	Missense_Mutation	p.K1289T	1
EIF2AK4	KICH	chr15	40257897	40257897	A	G	Silent		1
EIF2AK4	BLCA	chr15	40268996	40268996	G	A	Missense_Mutation		1
EIF2AK4	BLCA	chr15	40254051	40254051	C	G	Missense_Mutation	p.F270L	1
EIF2AK4	GBM	chr15	40247830	40247830	G	T	Nonsense_Mutation	p.E202*	1
EIF2AK4	KIRP	chr15	40303485	40303485	G	T	Nonsense_Mutation		1
EIF2AK4	READ	chr15	40311297	40311297	C	T	Missense_Mutation	p.P1357S	1
EIF2AK4	SARC	chr15	40284991	40284991	G	T	Missense_Mutation		1
EIF2AK4	SKCM	chr15	40226525	40226525	G	A	Silent	p.P43P	1
EIF2AK4	LUAD	chr15	40284431	40284431	G	A	Splice_Site	p.G896_splice	1
EIF2AK4	BLCA	chr15	40268949	40268949	C	G	Missense_Mutation		1
EIF2AK4	HNSC	chr15	40268785	40268785	G	A	Silent		1
EIF2AK4	LGG	chr15	40257951	40257951	C	T	Silent		1
EIF2AK4	KICH	chr15	40257897	40257897	A	G	Silent	p.E290E	1
EIF2AK4	MESO	chr15	40309362	40309362	C	A	Silent		1
EIF2AK4	THCA	chr15	40308702	40308702	G	A	Splice_Site		1
EIF2AK4	BLCA	chr15	40326640	40326640	A	C	Missense_Mutation		1
EIF2AK4	COAD	chr15	40308829	40308829	G	C	Missense_Mutation	p.E1296Q	1
EIF2AK4	ESCA	chr15	40326639	40326639	A	-	Frame_Shift_Del		1
EIF2AK4	SARC	chr15	40314774	40314774	C	T	Missense_Mutation	p.L1453F	1
EIF2AK4	SKCM	chr15	40309365	40309365	C	T	Silent	p.F1329F	1
EIF2AK4	BLCA	chr15	40241433	40241433	G	A	Silent		1
EIF2AK4	BLCA	chr15	40295447	40295447	G	A	Missense_Mutation	p.E1097K	1
EIF2AK4	GBM	chr15	40280263	40280263	T	C	Missense_Mutation	p.L828P	1
EIF2AK4	KIRP	chr15	40325002	40325002	G	T	Missense_Mutation		1
EIF2AK4	LUAD	chr15	40226472	40226472	G	T	Nonsense_Mutation	p.E26*	1
EIF2AK4	SARC	chr15	40313150	40313150	T	C	Silent		1
EIF2AK4	LIHC	chr15	40301931	40301931	G	A	Silent	p.V1231V	1
EIF2AK4	LUSC	chr15	40293219	40293219	G	A	Missense_Mutation	p.D985N	1
EIF2AK4	STAD	chr15	40280268	40280268	C	T	Nonsense_Mutation	p.R830X	1
EIF2AK4	BLCA	chr15	40301819	40301819	G	C	Missense_Mutation		1
EIF2AK4	MESO	chr15	40259561	40259561	C	A	Missense_Mutation	p.T345K	1
EIF2AK4	THYM	chr15	40321627	40321627	C	T	Missense_Mutation		1
EIF2AK4	BLCA	chr15	40268996	40268996	G	A	Missense_Mutation	p.E734K	1
EIF2AK4	COAD	chr15	40308859	40308859	G	T	Missense_Mutation	p.G1306C	1
EIF2AK4	SKCM	chr15	40295502	40295502	C	T	Missense_Mutation	p.P1115L	1
EIF2AK4	BLCA	chr15	40265857	40265857	C	T	Silent		1
EIF2AK4	BLCA	chr15	40300367	40300367	G	A	Missense_Mutation	p.E1183K	1
EIF2AK4	GBM	chr15	40259731	40259731	C	T	Missense_Mutation		1
EIF2AK4	KIRP	chr15	40324962	40324962	A	G	Missense_Mutation		1
EIF2AK4	SARC	chr15	40311357	40311357	G	T	Missense_Mutation		1
EIF2AK4	LUSC	chr15	40308761	40308761	C	A	Missense_Mutation	p.T1273K	1
EIF2AK4	BLCA	chr15	40293197	40293197	C	A	Silent		1
EIF2AK4	COAD	chr15	40235602	40235602	A	-	Nonsense_Mutation	p.L92X	1
EIF2AK4	LIHC	chr15	40268695	40268695	C	A	Silent		1
EIF2AK4	ESCA	chr15	40241361	40241361	C	T	Silent		1
EIF2AK4	PAAD	chr15	40269004	40269004	C	T	Silent		1
EIF2AK4	THYM	chr15	40254002	40254002	C	T	Missense_Mutation	p.S254F	1
EIF2AK4	COAD	chr15	40313141	40313141	C	T	Silent	p.G1405G	1
EIF2AK4	SARC	chr15	40313150	40313150	T	C	Silent	p.S1408S	1
EIF2AK4	BLCA	chr15	40268702	40268702	G	A	Missense_Mutation		1
EIF2AK4	BLCA	chr15	40265864	40265864	G	A	Missense_Mutation	p.E578K	1
EIF2AK4	GBM	chr15	40247830	40247830	G	T	Nonsense_Mutation		1
EIF2AK4	LUAD	chr15	40268812	40268812	C	T	Silent	p.S672S	1
EIF2AK4	SARC	chr15	40290969	40290969	G	T	Missense_Mutation		1
EIF2AK4	LIHC	chr15	40268649	40268649	T	C	Missense_Mutation	p.V618A	1
EIF2AK4	LUSC	chr15	40241344	40241344	G	A	Missense_Mutation	p.V130M	1
EIF2AK4	SKCM	chr15	40235622	40235622	C	G	Nonsense_Mutation	p.S99X	1
EIF2AK4	BLCA	chr15	40300269	40300269	G	T	Missense_Mutation		1
EIF2AK4	COAD	chr15	40241471	40241471	T	C	Splice_Site	.	1
EIF2AK4	LIHC	chr15	40300255	40300255	G	T	Silent		1
EIF2AK4	LIHC	chr15	40290979	40290979	A	-	Frame_Shift_Del	p.A972fs	1
EIF2AK4	SKCM	chr15	40293386	40293386	C	T	Silent	p.S1040S	1
EIF2AK4	BLCA	chr15	40265857	40265857	C	T	Silent	p.F575F	1
EIF2AK4	COAD	chr15	40318189	40318189	C	T	Silent	p.F1467F	1
EIF2AK4	SARC	chr15	40314774	40314774	C	T	Missense_Mutation		1
EIF2AK4	BLCA	chr15	40326640	40326640	A	C	Missense_Mutation	p.E1629D	1
EIF2AK4	GBM	chr15	40268672	40268672	G	C	Missense_Mutation		1
EIF2AK4	LUAD	chr15	40265983	40265983	G	A	Silent	p.617	1
EIF2AK4	SARC	chr15	40294943	40294943	G	T	Missense_Mutation		1
EIF2AK4	LIHC	chr15	40259627	40259627	A	G	Missense_Mutation	p.K367R	1
EIF2AK4	LUSC	chr15	40265206	40265206	A	T	Missense_Mutation	p.S551C	1
EIF2AK4	STAD	chr15	40295419	40295419	A	G	Silent	p.L1087L	1
EIF2AK4	BLCA	chr15	40254051	40254051	C	G	Missense_Mutation		1
EIF2AK4	THYM	chr15	40226421	40226421	G	-	Frame_Shift_Del	p.G9fs	1
EIF2AK4	LIHC	chr15	40318226	40318226	A	G	Missense_Mutation		1
EIF2AK4	ESCA	chr15	40295507	40295507	G	A	Missense_Mutation		1
EIF2AK4	LIHC	chr15	40241374	40241374	C	-	Frame_Shift_Del	p.P142fs	1
EIF2AK4	SKCM	chr15	40290939	40290939	C	T	Missense_Mutation	p.S959L	1
EIF2AK4	BLCA	chr15	40268702	40268702	G	A	Missense_Mutation	p.E636K	1
EIF2AK4	ESCA	chr15	40241361	40241361	C	T	Silent	p.S135	1
EIF2AK4	SARC	chr15	40284991	40284991	G	T	Missense_Mutation	p.G903V	1
EIF2AK4	BLCA	chr15	40265139	40265139	G	C	Missense_Mutation		1
EIF2AK4	BLCA	chr15	40268948	40268949	-	TG	Frame_Shift_Ins	p.S718fs	1
EIF2AK4	GBM	chr15	40282488	40282488	G	A	Silent		1
EIF2AK4	LGG	chr15	40282507	40282508	-	T	Frame_Shift_Ins	p.I854fs	1
EIF2AK4	LUAD	chr15	40265942	40265942	G	A	Missense_Mutation	p.V604I	1
EIF2AK4	LIHC	chr15	40265138	40265138	G	T	Missense_Mutation	p.W528L	1
EIF2AK4	LUSC	chr15	40322614	40322614	C	T	Missense_Mutation	p.P1539L	1
EIF2AK4	BLCA	chr15	40269014	40269014	G	A	Missense_Mutation		1
EIF2AK4	UCEC	chr15	40284381	40284381	C	T	Silent	p.D879D	1
EIF2AK4	LIHC	chr15	40314780	40314780	T	C	Missense_Mutation		1
EIF2AK4	BLCA	chr15	40265139	40265139	G	C	Missense_Mutation	p.W528C	1
EIF2AK4	KIRP	chr15	40268924	40268924	G	A	Missense_Mutation	p.E710K	1
EIF2AK4	LIHC	chr15	40254048	40254048	T	-	Frame_Shift_Del	p.Y269fs	1
EIF2AK4	SARC	chr15	40322628	40322628	G	T	Missense_Mutation		1
EIF2AK4	SKCM	chr15	40285047	40285047	C	T	Nonsense_Mutation	p.Q922*	1
EIF2AK4	BLCA	chr15	40241358	40241358	C	T	Silent		1
EIF2AK4	HNSC	chr15	40257961	40257961	G	C	Missense_Mutation		1
EIF2AK4	LGG	chr15	40257951	40257951	C	T	Silent	p.V308V	1
EIF2AK4	LUAD	chr15	40295449	40295449	G	A	Silent	p.E1097E	1
EIF2AK4	LUSC	chr15	40280230	40280230	G	A	Missense_Mutation	p.G817E	1
EIF2AK4	SKCM	chr15	40268873	40268873	C	G	Missense_Mutation	p.L693V	1
EIF2AK4	STAD	chr15	40280268	40280268	C	T	Nonsense_Mutation	p.R830*	1
EIF2AK4	BLCA	chr15	40295447	40295447	G	A	Missense_Mutation		1
EIF2AK4	COAD	chr15	40293270	40293270	C	-	Frame_Shift_Del	p.L1001fs	1
EIF2AK4	UCEC	chr15	40324439	40324440	-	T	Splice_Site	p.A1576_splice	1
EIF2AK4	HNSC	chr15	40268942	40268942	G	A	Missense_Mutation	p.E716K	1
EIF2AK4	BLCA	chr15	40241358	40241358	C	T	Silent	p.L134L	1
EIF2AK4	ESCA	chr15	40309342	40309342	C	T	Nonsense_Mutation	p.Q1322*	1
EIF2AK4	LIHC	chr15	40265809	40265809	T	-	Frame_Shift_Del	p.D559fs	1
EIF2AK4	PRAD	chr15	40290965	40290965	G	A	Missense_Mutation	p.D968N	1
EIF2AK4	SKCM	chr15	40259715	40259715	C	T	Silent	p.P396P	1
EIF2AK4	BLCA	chr15	40268695	40268696	-	-	Frame_Shift_Ins		1
EIF2AK4	HNSC	chr15	40268942	40268942	G	A	Missense_Mutation		1
EIF2AK4	LGG	chr15	40265883	40265883	C	T	Missense_Mutation	p.S584F	1
EIF2AK4	LIHC	chr15	40289267	40289267	G	A	Splice_Site		1
EIF2AK4	LUAD	chr15	40284431	40284431	G	A	Splice_Site		1
EIF2AK4	LIHC	chr15	40241361	40241361	C	A	Missense_Mutation	p.S135R	1
EIF2AK4	LUSC	chr15	40246108	40246108	C	A	Missense_Mutation	p.R173S	1
EIF2AK4	STAD	chr15	40301865	40301865	A	G	Missense_Mutation	p.I1209M	1
EIF2AK4	BLCA	chr15	40300367	40300367	G	A	Missense_Mutation		1
EIF2AK4	COAD	chr15	40295502	40295502	C	A	Missense_Mutation	p.P1115H	1
EIF2AK4	UCEC	chr15	40270349	40270350	-	TA	Splice_Site	p.Q773_splice	1
EIF2AK4	HNSC	chr15	40231714	40231714	G	T	Missense_Mutation	p.E51D	1
EIF2AK4	ESCA	chr15	40309342	40309342	C	T	Nonsense_Mutation	p.Q1322X	1
EIF2AK4	KIRP	chr15	40226434	40226434	A	G	Missense_Mutation	p.D13G	1
EIF2AK4	LIHC	chr15	40314763	40314763	C	-	Frame_Shift_Del	p.T1449fs	1
EIF2AK4	PRAD	chr15	40259951	40259951	C	T	Missense_Mutation	p.T475M	1
EIF2AK4	SARC	chr15	40247825	40247825	G	A	Missense_Mutation		1
EIF2AK4	SKCM	chr15	40321615	40321615	C	T	Missense_Mutation	p.S1504F	1
EIF2AK4	BLCA	chr15	40235658	40235658	A	G	Missense_Mutation		1
EIF2AK4	HNSC	chr15	40231714	40231714	G	T	Missense_Mutation		1
EIF2AK4	LIHC	chr15	40246116	40246116	C	A	Silent		1
EIF2AK4	LUAD	chr15	40293422	40293422	G	A	Silent	p.L1052L	1
EIF2AK4	LIHC	chr15	40313196	40313196	A	G	Missense_Mutation	p.I1424V	1
EIF2AK4	LUSC	chr15	40247944	40247944	C	A	Silent	p.R240R	1
EIF2AK4	STAD	chr15	40268999	40269000	-	GACGAC	In_Frame_Ins	p.737_738insD	1
EIF2AK4	BLCA	chr15	40265864	40265864	G	A	Missense_Mutation		1
EIF2AK4	UCEC	chr15	40246159	40246159	A	-	Frame_Shift_Del	p.K190fs	1
EIF2AK4	ESCA	chr15	40241361	40241361	C	T	Silent	p.S135S	1
EIF2AK4	KIRP	chr15	40284411	40284411	G	A	Silent		1
EIF2AK4	LIHC	chr15	40265184	40265184	A	-	Frame_Shift_Del	p.P543fs	1
EIF2AK4	PRAD	chr15	40294929	40294929	C	T	Missense_Mutation	p.R1059C	1
EIF2AK4	SARC	chr15	40259952	40259952	G	T	Silent		1
EIF2AK4	SKCM	chr15	40314722	40314722	C	T	Silent	p.S1435S	1
EIF2AK4	BLCA	chr15	40268620	40268620	G	A	Silent		1
EIF2AK4	HNSC	chr15	40313219	40313219	C	T	Silent		1
EIF2AK4	LIHC	chr15	40289235	40289235	A	G	Missense_Mutation		1
EIF2AK4	LIHC	chr15	40299226	40299226	G	T	Missense_Mutation	p.A1123S	1
EIF2AK4	MESO	chr15	40259781	40259781	C	A	Missense_Mutation		1
EIF2AK4	TGCT	chr15	40308859	40308859	G	T	Missense_Mutation		1
EIF2AK4	BLCA	chr15	40322573	40322573	C	T	Silent		1
EIF2AK4	COAD	chr15	40303504	40303504	A	G	Missense_Mutation	p.E1239G	1
EIF2AK4	ESCA	chr15	40326639	40326639	A	-	Frame_Shift_Del	p.K1631fs	1

Copy number variation (CNV) of EIF2AK4
* Click on the image to open the original image in a new window.

Fusion gene breakpoints (product of the structural variants (SVs)) across EIF2AK4
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion genes with this translation factor from FusionGDB2.0.

FusionGDB2 ID	Disease	Sample	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand
98512	BRCA	TCGA-AO-A128-01A	BUB1B	chr15	40468874	-	EIF2AK4	chr15	40301815	+
98512	BRCA	TCGA-D8-A1XT-01A	BUB1B	chr15	40453456	+	EIF2AK4	chr15	40314720	+
98512	BRCA	TCGA-OL-A66I-01A	BUB1B	chr15	40453456	-	EIF2AK4	chr15	40321607	+
98512	OV	TCGA-36-1575	BUB1B	chr15	40462882	+	EIF2AK4	chr15	40284375	+
98512	OV	TCGA-36-1575-01A	BUB1B	chr15	40462882	+	EIF2AK4	chr15	40284376	+
98512	UCS	TCGA-N8-A56S-01A	BUB1B	chr15	40510763	-	EIF2AK4	chr15	40278006	+
25687	HNSC	TCGA-CR-5243	EIF2AK4	chr15	40241469	+	ANKRD34C	chr15	79585583	+
78815	LUAD	TCGA-93-A4JQ-01A	EIF2AK4	chr15	40294989	+	AVEN	chr15	34160056	-
78816	PRAD	TCGA-CH-5771	EIF2AK4	chr15	40309443	+	BUB1B	chr15	40504699	+
78816	PRAD	TCGA-CH-5771-01A	EIF2AK4	chr15	40309442	+	BUB1B	chr15	40504699	+
78816	PRAD	TCGA-CH-5771-01A	EIF2AK4	chr15	40309443	+	BUB1B	chr15	40504700	+
98512	N/A	AA230218	EIF2AK4	chr15	40266278	+	EIF2AK4	chr15	40266241	-
98512	N/A	AB037759	EIF2AK4	chr15	40241401	-	EIF2AK4	chr15	40246119	+
83721	HNSC	TCGA-CQ-6225-01A	EIF2AK4	chr15	40231818	+	EPB42	chr15	43495473	-
79760	LUSC	TCGA-43-8116-01A	EIF2AK4	chr15	40314806	+	FEM1B	chr15	68581945	+
25687	THCA	TCGA-FE-A239-01A	EIF2AK4	chr15	40241469	+	HMGN2P46	chr15	45847671	+
25687	THCA	TCGA-FE-A239-01A	EIF2AK4	chr15	40241469	+	HMGN2P46	chr15	45847688	+
25687	THCA	TCGA-FE-A239-01A	EIF2AK4	chr15	40241469	+	HMGN2P46	chr15	45878376	+
68622	UCS	TCGA-N7-A4Y5	EIF2AK4	chr15	40284430	+	IVD	chr15	40708276	+
68622	UCS	TCGA-N7-A4Y5	EIF2AK4	chr15	40284430	+	IVD	chr15	40708277	+
68622	UCS	TCGA-N7-A4Y5-01A	EIF2AK4	chr15	40284430	+	IVD	chr15	40727616	+
95979	N/A	H43827	EIF2AK4	chr15	40279494	+	MYC	chr8	128750838	+
102786	LGG	TCGA-DU-A7TC-01A	EIF2AK4	chr15	40301931	+	PKM	chr15	72502819	-
91027	N/A	DD229307	EIF2AK4	chr15	40327467	+	PTPN9	chr15	75815045	-
98295	N/A	DN919475	EIF2AK4	chr15	40235579	+	SPAG1	chr8	101206882	-
94405	Non-Cancer	203N	EIF2AK4	chr15	40326645	+	SRP14	chr15	40329219	-
94405	N/A	BE738621	EIF2AK4	chr15	40328581	+	SRP14	chr15	40328583	+
100942	ESCA	TCGA-2H-A9GN	EIF2AK4	chr15	40247969	+	TMOD3	chr15	52221630	+
100942	ESCA	TCGA-2H-A9GN	EIF2AK4	chr15	40247969	+	TMOD3	chr15	52226447	+
100942	ESCA	TCGA-2H-A9GN	EIF2AK4	chr15	40247969	+	TMOD3	chr15	52239187	+
100942	ESCA	TCGA-2H-A9GN-01A	EIF2AK4	chr15	40247969	+	TMOD3	chr15	52223228	+
95300	N/A	EI784932	EIF2AK4	chr15	40274404	+	ZSCAN29	chr15	43660508	-
98512	N/A	AW389992	LRCH3	chr3	197605525	-	EIF2AK4	chr15	40325451	+
98512	N/A	BG031114	MDN1	chr6	90431535	+	EIF2AK4	chr15	40235965	-
98512	BRCA	TCGA-A7-A26I	PPP1R12B	chr1	202318270	+	EIF2AK4	chr15	40282473	+
98525	STAD	TCGA-CG-4449	VPS8	chr3	184588593	+	EIF2AK4	chr15	40318177	+
98525	STAD	TCGA-CG-4449-01A	VPS8	chr3	184588593	+	EIF2AK4	chr15	40318178	+

Top

Prognostic Analysis

Kaplan-Meier plots with logrank tests of overall survival (OS)

Cancer type

Translation factor

Coefficent

Hazard ratio

Wald test pval

Likelihool ratio pval

Logrank test pval

# samples

Top

Translation factor and Gender

Differential gene expression between female and male. (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
PAAD	EIF2AK4	0.000246116466036692	0.0066
KIRC	EIF2AK4	0.0388621284637644	1
LGG	EIF2AK4	0.0433934763913926	1
KIRP	EIF2AK4	4.7893504857e-08	1.3e-06

Top

Translation factor and Age

Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
GBM	EIF2AK4	0.0374803266665929	1
ESCA	EIF2AK4	0.0181997786540225	0.56
THYM	EIF2AK4	0.00605181462940031	0.2
COAD	EIF2AK4	0.014451411869997	0.46

Top

Related Drugs

Drugs targeting genes involved in this translation factor.
(DrugBank Version 5.1.8 2021-05-08)

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

Related Diseases

Diseases associated with this translation factor.
(DisGeNet 4.0)

Disease ID	Disease Name	# PubMeds	Disease source
C0340848	PULMONARY VENOOCCLUSIVE DISEASE 2, AUTOSOMAL RECESSIVE	3	GENOMICS_ENGLAND;UNIPROT
C0034091	Pulmonary Veno-Occlusive Disease (disorder)	2	CTD_human;GENOMICS_ENGLAND;ORPHANET
C0340543	Familial primary pulmonary hypertension	2	GENOMICS_ENGLAND;ORPHANET
C0340548	Pulmonary capillary hemangiomatosis	2	GENOMICS_ENGLAND;ORPHANET
C0152171	Idiopathic pulmonary hypertension	1	GENOMICS_ENGLAND
C0750905	Amino Acid Metabolism, Inherited Disorders	1	CTD_human
C1701939	Familial pulmonary arterial hypertension	1	ORPHANET
C2973725	Pulmonary arterial hypertension	1	GENOMICS_ENGLAND
C3203102	Idiopathic pulmonary arterial hypertension	1	GENOMICS_ENGLAND