Home

Download

Statistics

Examples

Help

Contact

	Gene Summary
	Translation studies in PubMed
	Exon Skipping Events
	Expression
	Expression Regulation
	Associated Genes
	Protein 3D Structure
	Protein-Protein Interaction
	Mutations
	Prognostic Analysis
	Gender Association
	Age Association
	Related Drugs
	Related Diseases

Translation Factor: RBM4 (NCBI Gene ID:5936)

Gene Summary

Gene Summary

Gene Information	Gene Name: RBM4
	Gene ID: 5936
	Gene Symbol	RBM4
	Gene ID	5936
	Gene Name	RNA binding motif protein 4
	Synonyms	LARK\|RBM4A\|ZCCHC21\|ZCRB3A
	Cytomap	11q13.2
	Type of Gene	protein-coding
	Description	RNA-binding protein 4RNA-binding motif protein 4alark homologtranscriptional coactivator CoAZzinc finger CCHC-type and RNA binding motif 3A
	Modification date	20200322
	UniProtAcc	Q9BWF3

Child GO biological process term(s) under GO:0006412

GO ID	GO term
GO:0017148	Negative regulation of translation
GO:0006417	Regulation of translation
GO:0002181	Cytoplasmic translation
GO:0006413	Translational initiation
GO:0006412	Translation

Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	RBM4	GO:0000381	regulation of alternative mRNA splicing, via spliceosome	12628928\|16260624\|16777844\|16934801\|21518792
Hgene	RBM4	GO:0002190	cap-independent translational initiation	17284590
Hgene	RBM4	GO:0002192	IRES-dependent translational initiation of linear mRNA	17284590
Hgene	RBM4	GO:0017148	negative regulation of translation	17284590
Hgene	RBM4	GO:0032055	negative regulation of translation in response to stress	17284590
Hgene	RBM4	GO:0035278	miRNA mediated inhibition of translation	19801630
Hgene	RBM4	GO:0045947	negative regulation of translational initiation	19801630
Hgene	RBM4	GO:0046685	response to arsenic-containing substance	17284590
Hgene	RBM4	GO:0046822	regulation of nucleocytoplasmic transport	12628928\|17284590
Hgene	RBM4	GO:0051149	positive regulation of muscle cell differentiation	21518792

Inferred gene age of translation factor.

Gene	Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25
RBM4	(355.7 - 733]

Top

Translation Studies in PubMed

We searched PubMed using 'RBM4[title] AND translation [title] AND human.'

Gene	Title	PMID
RBM4	G-Quadruplex Regulation of VEGFA mRNA Translation by RBM4	35054929

Top

Exon Skipping Events

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.
For more annotations, please visit our ExonSkipDB.

Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.

ENST

Exon skip start (DNA)

Exon Skip end (DNA)

ORF

Exon skipping position in the amino acid sequence.

ENST

Exon skip start (DNA)

Exon Skip end (DNA)

Len(transcript seq)

Exon skip start (mRNA)

Exon Skip end (mRNA)

Len(amino acid seq)

Exon skip start (AA)

Exon Skip end (AA)

Potentially (partially) lost protein functional features of UniProt.

UniProtAcc

Exon skip start (AA)

Exon Skip end (AA)

Function feature start (AA)

Function feature end (AA)

Functional feature type

Functional feature desc.

Top

Expression

Gene expression level across TCGA pancancer

Gene expression level across GTEx pantissue

Expression level of gene isoforms across TCGA pancancer

Expression level of gene isoforms across GTEx pantissue

Cancer(tissue) type-specific expression level of Translation factor using z-score distriution

Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples)

Cancer type	Translation factor	FC	adj.pval
PRAD	RBM4	1.32937067591027	0.000716413334112081
LUAD	RBM4	-1.96328065408892	8.21156504477211e-06

Top

Expression Regulation

Translation factor expression regulation through miRNA binding

Cancer type

Gene

miRNA

TargetScan binding score (Context++ score percentile)

Coefficient

Pvalue

Translation factor expression regulation through methylation in the promoter of Translation factor

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation)

Cancer type	Gene	methyl group b	methyl group a	DEG pval	avg methyl in b	avg methyl in a	avg exp in b	avg exp in a
ACC	RBM4	2	3	0.0127381609139164	0.521080431177446	0.611036752136752	-0.502077114506421	0.192810026710662

Translation factor expression regulation through copy number variation of Translation factor

Cancer type	Gene	Coefficient	Pvalue
BLCA	RBM4	0.133281173	0.004220818
MESO	RBM4	0.086928715	0.027826846

Top

Associated Genes

Strongly correlated genes belong to cellular important gene groups with RBM4 (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green)

Cancer type	Gene group	Translation factor	Correlated gene	Coefficient	Pvalue
DLBC	Cell metabolism gene	RBM4	PSMD4	0.802991114	6.60E-12
DLBC	CGC	RBM4	SDHAF2	0.801337854	7.85E-12
DLBC	Epifactor	RBM4	BRMS1	0.823157705	6.95E-13
DLBC	TF	RBM4	ZNF408	0.851953282	1.62E-14
DLBC	TSG	RBM4	BRMS1	0.823157705	6.95E-13
DLBC	TSG	RBM4	TSSC4	0.8436355	5.18E-14
THYM	Cell metabolism gene	RBM4	OAZ1	0.800597829	1.84E-28
THYM	Cell metabolism gene	RBM4	SSR2	0.802276095	1.17E-28
THYM	Cell metabolism gene	RBM4	LSM2	0.803490994	8.40E-29
THYM	Cell metabolism gene	RBM4	EXOSC4	0.808914056	1.86E-29
THYM	Cell metabolism gene	RBM4	PSMB3	0.809547702	1.56E-29
THYM	Cell metabolism gene	RBM4	PSMB7	0.809672822	1.50E-29
THYM	Cell metabolism gene	RBM4	TIMM8B	0.810819299	1.09E-29
THYM	Cell metabolism gene	RBM4	MVD	0.811422641	9.14E-30
THYM	Cell metabolism gene	RBM4	FAU	0.815710012	2.64E-30
THYM	Cell metabolism gene	RBM4	GFER	0.815950419	2.46E-30
THYM	Cell metabolism gene	RBM4	SLC27A5	0.819907113	7.56E-31
THYM	Cell metabolism gene	RBM4	DPM2	0.822319113	3.64E-31
THYM	Cell metabolism gene	RBM4	PSMD13	0.830652801	2.65E-32
THYM	Cell metabolism gene	RBM4	POLD2	0.833066031	1.21E-32
THYM	Cell metabolism gene	RBM4	ACOT8	0.83312922	1.18E-32
THYM	Cell metabolism gene	RBM4	FPGS	0.833328995	1.11E-32
THYM	Cell metabolism gene	RBM4	MED19	0.838695907	1.84E-33
THYM	Cell metabolism gene	RBM4	SNRPD2	0.840337958	1.05E-33
THYM	Cell metabolism gene	RBM4	MED18	0.845183101	1.93E-34
THYM	Cell metabolism gene	RBM4	PSMC3	0.859097417	1.05E-36
THYM	Cell metabolism gene	RBM4	TIMM13	0.868460147	2.26E-38
THYM	Cell metabolism gene	RBM4	TALDO1	0.884264083	1.70E-41
THYM	CGC	RBM4	RBM10	0.833957481	9.02E-33
THYM	CGC	RBM4	TFPT	0.83591434	4.71E-33
THYM	CGC	RBM4	SDHAF2	0.848390367	6.06E-35
THYM	Epifactor	RBM4	TAF10	0.807641278	2.67E-29
THYM	Epifactor	RBM4	MCRS1	0.808894559	1.87E-29
THYM	Epifactor	RBM4	EXOSC4	0.808914056	1.86E-29
THYM	Epifactor	RBM4	C17orf49	0.813483555	5.05E-30
THYM	Epifactor	RBM4	CXXC1	0.829853017	3.43E-32
THYM	Epifactor	RBM4	PRPF31	0.83188398	1.78E-32
THYM	Epifactor	RBM4	TFPT	0.83591434	4.71E-33
THYM	Epifactor	RBM4	DMAP1	0.837088413	3.18E-33
THYM	Epifactor	RBM4	PPP4C	0.843130393	3.98E-34
THYM	Epifactor	RBM4	BRMS1	0.849280945	4.38E-35
THYM	Epifactor	RBM4	NOC2L	0.851071786	2.26E-35
THYM	Epifactor	RBM4	FBL	0.851172245	2.18E-35
THYM	Epifactor	RBM4	MBD3	0.867423607	3.50E-38
THYM	IUPHAR	RBM4	MFSD2B	0.803262938	8.94E-29
THYM	IUPHAR	RBM4	MVD	0.811422641	9.14E-30
THYM	IUPHAR	RBM4	SLC27A5	0.819907113	7.56E-31
THYM	IUPHAR	RBM4	EGLN2	0.837068907	3.20E-33
THYM	TF	RBM4	ZNF775	0.802098326	1.23E-28
THYM	TF	RBM4	CXXC1	0.829853017	3.43E-32
THYM	TF	RBM4	REXO4	0.854040683	7.41E-36
THYM	TF	RBM4	MBD3	0.867423607	3.50E-38
THYM	TF	RBM4	ZNF408	0.891357796	4.75E-43
THYM	TSG	RBM4	GNB2L1	0.814740692	3.50E-30
THYM	TSG	RBM4	BRMS1	0.849280945	4.38E-35
THYM	TSG	RBM4	TSSC4	0.908040875	3.58E-47
UCS	Cell metabolism gene	RBM4	OAZ1	0.800597829	1.84E-28
UCS	Cell metabolism gene	RBM4	SSR2	0.802276095	1.17E-28
UCS	Cell metabolism gene	RBM4	LSM2	0.803490994	8.40E-29
UCS	Cell metabolism gene	RBM4	EXOSC4	0.808914056	1.86E-29
UCS	Cell metabolism gene	RBM4	PSMB3	0.809547702	1.56E-29
UCS	Cell metabolism gene	RBM4	PSMB7	0.809672822	1.50E-29
UCS	Cell metabolism gene	RBM4	TIMM8B	0.810819299	1.09E-29
UCS	Cell metabolism gene	RBM4	MVD	0.811422641	9.14E-30
UCS	Cell metabolism gene	RBM4	FAU	0.815710012	2.64E-30
UCS	Cell metabolism gene	RBM4	GFER	0.815950419	2.46E-30
UCS	Cell metabolism gene	RBM4	SLC27A5	0.819907113	7.56E-31
UCS	Cell metabolism gene	RBM4	DPM2	0.822319113	3.64E-31
UCS	Cell metabolism gene	RBM4	PSMD13	0.830652801	2.65E-32
UCS	Cell metabolism gene	RBM4	POLD2	0.833066031	1.21E-32
UCS	Cell metabolism gene	RBM4	ACOT8	0.83312922	1.18E-32
UCS	Cell metabolism gene	RBM4	FPGS	0.833328995	1.11E-32
UCS	Cell metabolism gene	RBM4	MED19	0.838695907	1.84E-33
UCS	Cell metabolism gene	RBM4	SNRPD2	0.840337958	1.05E-33
UCS	Cell metabolism gene	RBM4	MED18	0.845183101	1.93E-34
UCS	Cell metabolism gene	RBM4	PSMC3	0.859097417	1.05E-36
UCS	Cell metabolism gene	RBM4	TIMM13	0.868460147	2.26E-38
UCS	Cell metabolism gene	RBM4	TALDO1	0.884264083	1.70E-41
UCS	CGC	RBM4	RBM10	0.833957481	9.02E-33
UCS	CGC	RBM4	TFPT	0.83591434	4.71E-33
UCS	CGC	RBM4	SDHAF2	0.848390367	6.06E-35
UCS	Epifactor	RBM4	TAF10	0.807641278	2.67E-29
UCS	Epifactor	RBM4	MCRS1	0.808894559	1.87E-29
UCS	Epifactor	RBM4	EXOSC4	0.808914056	1.86E-29
UCS	Epifactor	RBM4	C17orf49	0.813483555	5.05E-30
UCS	Epifactor	RBM4	CXXC1	0.829853017	3.43E-32
UCS	Epifactor	RBM4	PRPF31	0.83188398	1.78E-32
UCS	Epifactor	RBM4	TFPT	0.83591434	4.71E-33
UCS	Epifactor	RBM4	DMAP1	0.837088413	3.18E-33
UCS	Epifactor	RBM4	PPP4C	0.843130393	3.98E-34
UCS	Epifactor	RBM4	BRMS1	0.849280945	4.38E-35
UCS	Epifactor	RBM4	NOC2L	0.851071786	2.26E-35
UCS	Epifactor	RBM4	FBL	0.851172245	2.18E-35
UCS	Epifactor	RBM4	MBD3	0.867423607	3.50E-38
UCS	IUPHAR	RBM4	MFSD2B	0.803262938	8.94E-29
UCS	IUPHAR	RBM4	MVD	0.811422641	9.14E-30
UCS	IUPHAR	RBM4	SLC27A5	0.819907113	7.56E-31
UCS	IUPHAR	RBM4	EGLN2	0.837068907	3.20E-33
UCS	TF	RBM4	ZNF775	0.802098326	1.23E-28
UCS	TF	RBM4	CXXC1	0.829853017	3.43E-32
UCS	TF	RBM4	REXO4	0.854040683	7.41E-36
UCS	TF	RBM4	MBD3	0.867423607	3.50E-38
UCS	TF	RBM4	ZNF408	0.891357796	4.75E-43
UCS	TSG	RBM4	GNB2L1	0.814740692	3.50E-30
UCS	TSG	RBM4	BRMS1	0.849280945	4.38E-35
UCS	TSG	RBM4	TSSC4	0.908040875	3.58E-47

Top

Protein structure

Protein 3D structure
Visit iCn3D.

Top

Protein-Protein Interaction

Protein-protein interaction networks
* Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

* Edge colors based on TCGA cancer types.

* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P))

Cancer type	Translation factor	Interacting protein coding gene	FC	adj.pval
COAD	RBM4	EIF4E2	-1.6767866186069	0.000144809484481812
PRAD	RBM4	U2AF2	-1.72395716782151	0.000148819683073472
BRCA	RBM4	EIF4E2	-1.81299600715269	0.000370278590179521
THCA	RBM4	EPAS1	-1.1685380871093	0.000383300149310361
LUAD	RBM4	EIF4E2	-1.75169025615215	0.000823732994424591
ESCA	RBM4	U2AF2	-1.96955066294306	0.0009765625
THCA	RBM4	U2AF2	-1.27117273946612	0.00109657614318825
STAD	RBM4	RBM10	-2.79790708804074	0.00114433001726866
KICH	RBM4	RBM10	-2.94062668822626	0.00129634141921997
LIHC	RBM4	RBM10	-2.00040383499879	0.00182077236082954
KICH	RBM4	HNRNPF	1.50744544294582	0.00225526094436645
LIHC	RBM4	HNRNPF	-1.57993713616518	0.00511896143343789
COAD	RBM4	PTBP2	2.65804852116182	0.006689190864563
THCA	RBM4	HNRNPK	-8.73422542563389	0.00797530353045887
COAD	RBM4	SF1	-4.15611836563102	0.0176135301589966
ESCA	RBM4	RBM10	-1.37883217160431	0.0244140625
BLCA	RBM4	EPAS1	-4.2743612980481	0.0289306640625
UCEC	RBM4	HNRNPK	1.64532744504864	0.03125
READ	RBM4	HNRNPF	1.32191790666862	0.03125
READ	RBM4	SF1	-4.06236226767122	0.03125
BLCA	RBM4	SF1	-2.17267387315221	0.0493659973144531
KICH	RBM4	EPAS1	-1.49091405612871	1.0073184967041e-05
KIRC	RBM4	EIF4E2	-4.19473040895577	1.04336657477644e-05
BRCA	RBM4	U2AF2	-1.80145836888837	1.46582416507411e-17
LUAD	RBM4	U2AF2	-1.44668799993657	2.59537001508388e-08
LUSC	RBM4	RBM10	-1.99732081137045	2.71315137313761e-06
THCA	RBM4	SF1	-9.3346192550436	2.943362132749e-05
LIHC	RBM4	EPAS1	-1.41073496075186	3.12340071872958e-06
LUAD	RBM4	EPAS1	-2.09956511155159	3.59910232594763e-11
LUSC	RBM4	EPAS1	-4.36310118977922	5.62667765456517e-10
THCA	RBM4	PTBP2	-1.17269337106653	6.0270502999501e-05

Protein-protein interactors with this translation factor (BIOGRID-3.4.160)

PPI interactors with RBM4

CCNA1, CDK2, TRIB3, AGO2, CUL3, CUL4B, CUL2, CUL1, COPS5, COPS6, CAND1, EEF1A1, HNRNPH1, XRCC1, TMEM189, SUCLA2, EEF2, DDX1, STRIP1, TPR, FN1, VCAM1, SNRPC, SF3B4, U2AF2, RBM10, SF1, RBM23, PRPF31, RBM22, AQR, DGCR14, RBM7, DDX17, DDX5, HNRNPK, HNRNPUL1, DHX9, HNRNPM, HNRNPF, HNRNPH2, HNRNPH3, RBM42, CXorf56, PABPC1, PTBP2, SMAD5, ITGA4, SOX2, RPA1, RPA2, RPA3, CUL7, OBSL1, SUZ12, EED, RBM4B, NTRK1, FAP, MAPK8IP2, XPO1, PPL, PPM1G, CDK8, CTBP2, MKNK2, HNRNPD, PAX6, CDK18, PPIA, MAPK3, MYH13, VPS26A, SEC16A, POLK, KIF21A, CCDC88A, DNAJC11, CDCA5, ARX, TK2, TLN1, MRPL24, IPO4, ZNF668, MICALL1, Kif7, Klc2, Smad3, Pip4k2c, Rtfdc1, SNW1, CDC5L, NANOG, POU5F1, WDR3, ZNF420, WDR36, XRN1, RPP40, WDR43, RPP25, POP4, CENPC, RPL26L1, ZFP62, RPL36AL, PDCD11, RPF2, REXO4, SCAF1, WDR75, CENPU, RRP8, NOP2, EBNA1BP2, POP1, DNTTIP2, BUD13, PAK1IP1, KIAA0020, NLE1, DDX54, RRS1, DDX24, ZNF121, RBM28, RPP38, HIST2H2AB, ZCCHC17, RPS8, RPL14, PWP2, ZNF317, NOP56, DDX51, RPL32, NSA2, CARM1, UTP15, NVL, GNL2, TEX10, DKC1, PPAN-P2RY11, URB1, POP7, RPP25L, TBL3, DDX31, GTPBP4, RSL1D1, RPL5, URB2, GLYR1, RPL18A, BRIX1, EXOG, RBM34, ZBTB24, CENPN, RBBP6, DDX21, UTP23, DLST, PDHA1, FOXA1, HNRNPL, EGLN3, EFTUD2, RIOK1, HEXIM1, VCP, TNIP2, NR2C2, HIST1H4A, KLHL41, SNRNP70, BIRC3, STAU1, MATR3, ESR1, PTEN, MIRLET7A1, MIRLET7A2, MIRLET7A3, MIRLET7B, MIRLET7C, MIRLET7D, MIRLET7E, MIRLET7F1, MIRLET7F2, MIRLET7G, MIRLET7I, MIR1-1, MIR1-2, MIR7-1, MIR7-2, MIR7-3, MIR9-1, MIR9-2, MIR9-3, MIR10B, MIR15B, MIR16-2, MIR17, MIR19A, MIR19B1, MIR19B2, MIR20A, MIR20B, MIR21, MIR25, MIR29A, MIR29B1, MIR29B2, MIR29C, MIR31, MIR34A, MIR34B, MIR34C, MIR92A1, MIR92A2, MIR93, MIR106A, MIR106B, MIR128-1, MIR128-2, MIR138-1, MIR138-2, MIR141, MIR143, MIR145, MIR155, MIR199A1, MIR200A, MIR200B, MIR200C, MIR205, MIR206, MIR214, MIR221, MIR222, MIR363, MIR429, MIR451A, ZC3H18, HSCB, NEK4, KIF14, KIF20A, GRSF1, NUPR1, E7, BRD4, RBM39, LGALS9, NR3C1, C14orf169, nsp2, TULP3, UBQLN2, PAPD5, RPL26, HP1BP3, PRKRA, RPL7A, RPL15, NOL8, TTC19, RPLP0, EP300, SURF6, Htatsf1, ORF8, NRP1, FURIN, BSG, ACE2, E, nsp3, ORF10, ORF7b, S, SP7,

Top

Mutations

Clinically associated variants from ClinVar.

Gene

Chr

Position

RefSeq

VarSeq

RefSeeq

VarType

Pathogenic

Disease

VarInfo

nsSNVs with sample frequency (size of circle) from TCGA 33 cancers.

SNVs and Indels

Gene	Cancer type	Chromosome	Start	End	RefSeeq	MutSeq	Mutation type	AAchange	# samples
RBM4	LUAD	chr11	66411054	66411054	C	T	Silent	p.R182R	6
RBM4	CHOL	chr11	66407408	66407408	A	C	Missense_Mutation	p.T76P	3
RBM4	CHOL	chr11	66410945	66410945	C	T	Missense_Mutation	p.S146F	3
RBM4	KIRP	chr11	66411450	66411450	T	A	Silent	p.A314A	3
RBM4	BLCA	chr11	66407491	66407491	G	A	Silent	p.P103P	3
RBM4	ESCA	chr11	66407231	66407231	G	C	Missense_Mutation	p.E17Q	3
RBM4	ESCA	chr11	66411101	66411101	G	A	Missense_Mutation	p.R198H	3
RBM4	HNSC	chr11	66411238	66411238	T	C	Missense_Mutation	p.Y244H	3
RBM4	HNSC	chr11	66407477	66407477	G	C	Missense_Mutation	p.E99Q	2
RBM4	ESCA	chr11	66411053	66411053	G	T	Missense_Mutation	p.R182L	2
RBM4	BLCA	chr11	66411364	66411384	GCTGCTGCTGCAGCAGCAGCC	-	In_Frame_Del		2
RBM4	HNSC	chr11	66411036	66411036	G	A	Silent	p.P176P	2
RBM4	LIHC	chr11	66407588	66407588	T	-	Frame_Shift_Del	p.F136fs	2
RBM4	STAD	chr11	66411100	66411100	C	T	Missense_Mutation	p.R198C	2
RBM4	UCEC	chr11	66407237	66407237	C	T	Missense_Mutation	p.R19C	2
RBM4	HNSC	chr11	66407347	66407347	G	A	Silent	p.L55L	2
RBM4	STAD	chr11	66411167	66411167	C	T	Missense_Mutation	p.A220V	2
RBM4	ESCA	chr11	66407231	66407231	G	C	Missense_Mutation		2
RBM4	UCEC	chr11	66407320	66407320	G	A	Silent	p.T46	2
RBM4	HNSC	chr11	66407340	66407340	G	A	Missense_Mutation	p.R53H	2
RBM4	STAD	chr11	66407528	66407528	G	A	Missense_Mutation	p.V116I	2
RBM4	UCEC	chr11	66407465	66407465	C	T	Nonsense_Mutation	p.R95*	2
RBM4	BLCA	chr11	66410998	66410998	C	A	Silent	p.R164R	2
RBM4	LUAD	chr11	66407528	66407528	G	C	Missense_Mutation	p.V116L	2
RBM4	STAD	chr11	66411193	66411193	C	T	Missense_Mutation	p.R229W	2
RBM4	UCEC	chr11	66410998	66410998	C	T	Missense_Mutation	p.R164W	2
RBM4	STAD	chr11	66410970	66410970	C	T	Silent	p.P154P	2
RBM4	UCEC	chr11	66411237	66411237	T	C	Silent	p.N243	2
RBM4	UCEC	chr11	66411420	66411420	C	T	Silent	p.Y304	2
RBM4	UCEC	chr11	66411459	66411459	A	G	Silent	p.P317	2
RBM4	STAD	chr11	66411375	66411375	A	T	Silent	p.A289A	2
RBM4	TGCT	chr11	66411186	66411186	T	A	Silent	p.R226R	2
RBM4	UCEC	chr11	66411589	66411589	T	C	Missense_Mutation	p.Y361H	2
RBM4	STAD	chr11	66407488	66407488	T	C	Silent	p.G102G	2
RBM4	CESC	chr11	66411229	66411229	G	A	Missense_Mutation	p.V241M	2
RBM4	BLCA	chr11	66407491	66407491	G	A	Silent		2
RBM4	STAD	chr11	66411194	66411194	G	A	Missense_Mutation	p.R229Q	2
RBM4	BLCA	chr11	66411376	66411393	GCAGCAGCCGCTGCTGCT	-	In_Frame_Del		1
RBM4	STAD	chr11	66411175	66411175	A	G	Missense_Mutation	p.K223E	1
RBM4	CHOL	chr11	66410945	66410945	C	T	Missense_Mutation		1
RBM4	LIHC	chr11	66411228	66411228	C	T	Silent	p.S240S	1
RBM4	READ	chr11	66407272	66407272	A	C	Missense_Mutation	p.E30D	1
RBM4	THYM	chr11	66411485	66411485	G	T	Missense_Mutation		1
RBM4	ESCA	chr11	66411101	66411101	G	A	Missense_Mutation		1
RBM4	READ	chr11	66410927	66410927	G	A	Missense_Mutation	p.R140Q	1
RBM4	BLCA	chr11	66411553	66411553	C	G	Missense_Mutation		1
RBM4	LIHC	chr11	66407214	66407214	G	-	Frame_Shift_Del	p.R11fs	1
RBM4	READ	chr11	66407465	66407465	C	T	Nonsense_Mutation	p.R95X	1
RBM4	BLCA	chr11	66407395	66407395	G	A	Silent		1
RBM4	COAD	chr11	66411058	66411058	G	A	Missense_Mutation	p.A184T	1
RBM4	LUAD	chr11	66407690	66407690	G	T	Missense_Mutation	p.V170F	1
RBM4	ESCA	chr11	66384399	66384399	A	T	Translation_Start_Site		1
RBM4	SARC	chr11	66411598	66411598	T	C	Missense_Mutation	p.F364L	1
RBM4	COAD	chr11	66411264	66411264	G	A	Silent	p.L252L	1
RBM4	HNSC	chr11	66411036	66411036	G	A	Silent		1
RBM4	SARC	chr11	66411529	66411529	C	G	Missense_Mutation	p.R341G	1
RBM4	KIRP	chr11	66407706	66407706	T	C	Missense_Mutation		1
RBM4	COAD	chr11	66411372	66411372	T	A	Silent	p.A288A	1
RBM4	LUAD	chr11	66411409	66411409	A	T	Missense_Mutation	p.T301S	1
RBM4	HNSC	chr11	66407347	66407347	G	A	Silent		1
RBM4	SARC	chr11	66411364	66411384	GCTGCTGCTGCAGCAGCAGCC	-	In_Frame_Del	p.AAAAAAA286del	1
RBM4	SKCM	chr11	66407441	66407441	C	T	Missense_Mutation	p.P87S	1
RBM4	BLCA	chr11	66411553	66411553	C	G	Missense_Mutation	p.R349G	1
RBM4	KIRP	chr11	66411450	66411450	T	A	Silent		1
RBM4	COAD	chr11	66411421	66411421	G	A	Missense_Mutation	p.G305R	1
RBM4	STAD	chr11	66410965	66410965	G	A	Missense_Mutation	p.A153T	1
RBM4	HNSC	chr11	66407340	66407340	G	A	Missense_Mutation		1
RBM4	SKCM	chr11	66411273	66411273	C	T	Silent	p.V255V	1
RBM4	BLCA	chr11	66411376	66411393	GCAGCAGCCGCTGCTGCT	-	In_Frame_Del	p.AAAAAA290del	1
RBM4	LGG	chr11	66407646	66407646	A	G	Missense_Mutation	p.N155S	1
RBM4	COAD	chr11	66411554	66411554	G	A	Missense_Mutation	p.R349Q	1
RBM4	LUAD	chr11	66411316	66411316	G	A	Missense_Mutation	p.D270N	1
RBM4	TGCT	chr11	66411186	66411186	T	A	Silent		1
RBM4	HNSC	chr11	66411238	66411238	T	C	Missense_Mutation		1
RBM4	CESC	chr11	66411229	66411229	G	A	Missense_Mutation		1
RBM4	LGG	chr11	66411034	66411035	-	CGATAGAT	Frame_Shift_Ins	p.D176fs	1
RBM4	LUAD	chr11	66411601	66411601	T	A	Nonstop_Mutation	p.*365K	1
RBM4	BLCA	chr11	66410998	66410998	C	A	Silent		1
RBM4	HNSC	chr11	66407477	66407477	G	C	Missense_Mutation		1
RBM4	LGG	chr11	66411034	66411035	-	CGATAGAT	Frame_Shift_Ins		1
RBM4	OV	chr11	66411583	66411583	G	A	Missense_Mutation	p.A359T	1
RBM4	THCA	chr11	66407597	66407597	G	A	Missense_Mutation		1
RBM4	CHOL	chr11	66407408	66407408	A	C	Missense_Mutation		1
RBM4	LIHC	chr11	66411560	66411560	A	G	Missense_Mutation		1
RBM4	ESCA	chr11	66413571	66413571	C	T	RNA	NULL	1
RBM4	PRAD	chr11	66407351	66407351	C	A	Missense_Mutation	p.H57N	1
RBM4	THCA	chr11	66407597	66407597	G	A	Missense_Mutation	p.E139K	1

Copy number variation (CNV) of RBM4
* Click on the image to open the original image in a new window.

Fusion gene breakpoints (product of the structural variants (SVs)) across RBM4
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion genes with this translation factor from FusionGDB2.0.

FusionGDB2 ID	Disease	Sample	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand
90084	STAD	TCGA-EQ-8122-01A	ENC1	chr5	73936132	-	RBM4	chr11	66407171	+
90084	N/A	AI658666	NTM	chr11	131998650	-	RBM4	chr11	66408653	-
90084	HNSC	TCGA-CV-A45X-01A	PPFIA1	chr11	70118542	+	RBM4	chr11	66407171	+
90084	N/A	NM_001198845	RBM14	chr11	66384528	+	RBM4	chr11	66410921	+
90084	N/A	NM_001198846	RBM14	chr11	66384528	+	RBM4	chr11	66413498	+
79881	BRCA	TCGA-A7-A6VV-01A	RBM4	chr11	66406223	+	ACTN3	chr11	66324604	+
79881	SKCM	TCGA-FS-A1ZT-06A	RBM4	chr11	66384528	+	ACTN3	chr11	66318710	+
82388	Non-Cancer	TCGA-BH-A1FE-11B	RBM4	chr11	66407594	+	C20orf196	chr20	5753507	+
102746	LGG	TCGA-E1-A7YE	RBM4	chr11	66407594	+	CLASP1	chr2	122145482	-
103202	LUAD	TCGA-49-AAQV	RBM4	chr11	66407594	+	DPP3	chr11	66276550	+
102436	N/A	AV705851	RBM4	chr11	66413720	+	FAM156A	chrX	52976829	-
72956	LUSC	TCGA-98-7454	RBM4	chr11	66406301	+	IGHG3	chr14	106330461	-
72956	BRCA	TCGA-E2-A14V-01A	RBM4	chr11	66384528	+	MIR4523	chr17	27697323	-
84562	BRCA	TCGA-A1-A0SN-01A	RBM4	chr11	66407594	+	MTMR4	chr17	56573691	-
90084	N/A	AA188793	RBM4	chr11	66413678	-	RBM4	chr11	66413534	+
90084	N/A	AA188829	RBM4	chr11	66413534	-	RBM4	chr11	66413678	+
90084	N/A	BE154847	RBM4	chr11	66412741	-	RBM4	chr11	66430382	+
90084	N/A	BE154890	RBM4	chr11	66430382	-	RBM4	chr11	66412741	+
98351	N/A	EI782517	RBM4	chr11	66423815	+	VPS26A	chr10	70923692	+
90084	N/A	BI860431	RBM4B	chr11	66444138	-	RBM4	chr11	66407170	+
90087	BRCA	TCGA-BH-A1EN-01A	TENM4	chr11	78775783	-	RBM4	chr11	66433327	+

Top

Prognostic Analysis

Kaplan-Meier plots with logrank tests of overall survival (OS)

Cancer type	Translation factor	Coefficent	Hazard ratio	Wald test pval	Likelihool ratio pval	Logrank test pval	# samples
PAAD	RBM4	0.465739453022666	-0.7641289149041	0.00127971675651087	0.00139917952886649	0.00154461344171607	182
PAAD	RBM4	0.465739453022666	-0.7641289149041	0.00127971675651087	0.00139917952886649	0.00154461344171607	182
KIRC	RBM4	1.5866384137877	0.461617572980356	0.00687136275328288	0.00628143933513642	0.0069680483036812	604
KIRC	RBM4	1.5866384137877	0.461617572980356	0.00687136275328288	0.00628143933513642	0.0069680483036812	604
LGG	RBM4	0.373711299596653	-0.984271705868212	4.63882299904821e-06	5.46024561514843e-06	4.85458386804667e-06	525

Top

Translation factor and Gender

Differential gene expression between female and male. (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
LIHC	RBM4	0.0057257737926085	0.16
KIRP	RBM4	0.0202589114567686	0.55

Top

Translation factor and Age

Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
LIHC	RBM4	0.00774507822901152	0.25
THCA	RBM4	0.0292086206723617	0.91
ACC	RBM4	0.00362704838268545	0.12
HNSC	RBM4	0.0312991497740982	0.94

Top

Related Drugs

Drugs targeting genes involved in this translation factor.
(DrugBank Version 5.1.8 2021-05-08)

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

Related Diseases

Diseases associated with this translation factor.
(DisGeNet 4.0)

Disease ID

Disease Name

# PubMeds

Disease source