Home

Download

Statistics

Examples

Help

Contact

	Gene Summary
	Translation studies in PubMed
	Exon Skipping Events
	Expression
	Expression Regulation
	Associated Genes
	Protein 3D Structure
	Protein-Protein Interaction
	Mutations
	Prognostic Analysis
	Gender Association
	Age Association
	Related Drugs
	Related Diseases

Translation Factor: RPS29 (NCBI Gene ID:6235)

Gene Summary

Gene Summary

Gene Information	Gene Name: RPS29
	Gene ID: 6235
	Gene Symbol	RPS29
	Gene ID	6235
	Gene Name	ribosomal protein S29
	Synonyms	DBA13\|S29\|uS14
	Cytomap	14q21.3
	Type of Gene	protein-coding
	Description	40S ribosomal protein S29small ribosomal subunit protein uS14
	Modification date	20200313
	UniProtAcc	P62273

Child GO biological process term(s) under GO:0006412

GO ID	GO term
GO:0005840	Ribosome
GO:0002181	Cytoplasmic translation
GO:0006412	Translation

Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	RPS29	GO:0002181	cytoplasmic translation	25957688

Inferred gene age of translation factor.

Gene	Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25
RPS29	>1119.25

Top

Translation Studies in PubMed

We searched PubMed using 'RPS29[title] AND translation [title] AND human.'

Gene	Title	PMID
RPS29	.	.

Top

Exon Skipping Events

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.
For more annotations, please visit our ExonSkipDB.

Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.

ENST	Exon skip start (DNA)	Exon Skip end (DNA)	ORF
ENST00000245458	50052667	50052767	Frame-shift

Exon skipping position in the amino acid sequence.

ENST

Exon skip start (DNA)

Exon Skip end (DNA)

Len(transcript seq)

Exon skip start (mRNA)

Exon Skip end (mRNA)

Len(amino acid seq)

Exon skip start (AA)

Exon Skip end (AA)

Potentially (partially) lost protein functional features of UniProt.

UniProtAcc

Exon skip start (AA)

Exon Skip end (AA)

Function feature start (AA)

Function feature end (AA)

Functional feature type

Functional feature desc.

Top

Expression

Gene expression level across TCGA pancancer

Gene expression level across GTEx pantissue

Expression level of gene isoforms across TCGA pancancer

Expression level of gene isoforms across GTEx pantissue

Cancer(tissue) type-specific expression level of Translation factor using z-score distriution

Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples)

Cancer type

Translation factor

adj.pval

Top

Expression Regulation

Translation factor expression regulation through miRNA binding

Cancer type	Gene	miRNA	TargetScan binding score (Context++ score percentile)	Coefficient	Pvalue
GBM	RPS29	hsa-miR-500a-5p	96	1	0.0166666666666667
GBM	RPS29	hsa-miR-500b-5p	96	1	0.0166666666666667

Translation factor expression regulation through methylation in the promoter of Translation factor

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation)

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through copy number variation of Translation factor

Cancer type

Gene

Coefficient

Pvalue

Top

Associated Genes

Strongly correlated genes belong to cellular important gene groups with RPS29 (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green)

Cancer type	Gene group	Translation factor	Correlated gene	Coefficient	Pvalue
DLBC	Cell metabolism gene	RPS29	PSMB6	0.80216665	7.20E-12
DLBC	Cell metabolism gene	RPS29	PTDSS2	0.805784527	4.91E-12
DLBC	Cell metabolism gene	RPS29	LSM2	0.807461781	4.10E-12
DLBC	Cell metabolism gene	RPS29	UROD	0.814177919	1.96E-12
DLBC	Cell metabolism gene	RPS29	DPM2	0.816149512	1.57E-12
DLBC	Cell metabolism gene	RPS29	PHKG2	0.816288023	1.54E-12
DLBC	Cell metabolism gene	RPS29	PSMD13	0.81844818	1.21E-12
DLBC	Cell metabolism gene	RPS29	TOMM22	0.823336757	6.80E-13
DLBC	Cell metabolism gene	RPS29	POLR2J	0.82508544	5.52E-13
DLBC	Cell metabolism gene	RPS29	POLR2F	0.826280139	4.78E-13
DLBC	Cell metabolism gene	RPS29	DGUOK	0.827925042	3.91E-13
DLBC	Cell metabolism gene	RPS29	POLR2I	0.829770604	3.12E-13
DLBC	Cell metabolism gene	RPS29	TIMM13	0.835507711	1.51E-13
DLBC	Cell metabolism gene	RPS29	PSMC5	0.837897839	1.11E-13
DLBC	Cell metabolism gene	RPS29	PGLS	0.842843134	5.76E-14
DLBC	Cell metabolism gene	RPS29	ECHS1	0.845278879	4.14E-14
DLBC	Cell metabolism gene	RPS29	GEMIN7	0.852753187	1.44E-14
DLBC	Cell metabolism gene	RPS29	PSMB3	0.857700478	6.95E-15
DLBC	Cell metabolism gene	RPS29	TOMM7	0.861668936	3.79E-15
DLBC	Cell metabolism gene	RPS29	TIMM9	0.863107755	3.03E-15
DLBC	Cell metabolism gene	RPS29	NME2	0.870707558	8.87E-16
DLBC	Cell metabolism gene	RPS29	GFER	0.881610185	1.32E-16
DLBC	Cell metabolism gene	RPS29	SNRPD2	0.904363045	1.25E-18
DLBC	Cell metabolism gene	RPS29	FAU	0.911565938	2.24E-19
DLBC	Cell metabolism gene	RPS29	PFDN5	0.922483195	1.22E-20
DLBC	CGC	RPS29	NACA	0.822812587	7.24E-13
DLBC	Epifactor	RPS29	BRMS1	0.805047829	5.31E-12
DLBC	Epifactor	RPS29	PAF1	0.805552961	5.03E-12
DLBC	Epifactor	RPS29	RBX1	0.805992767	4.80E-12
DLBC	Epifactor	RPS29	SIRT6	0.807167976	4.23E-12
DLBC	Epifactor	RPS29	HMG20B	0.807231799	4.20E-12
DLBC	Epifactor	RPS29	MBD3	0.82098888	8.97E-13
DLBC	Epifactor	RPS29	TAF10	0.823751557	6.48E-13
DLBC	Epifactor	RPS29	DMAP1	0.853911186	1.22E-14
DLBC	Epifactor	RPS29	ZNHIT1	0.85896693	5.74E-15
DLBC	Epifactor	RPS29	FBL	0.86010905	4.82E-15
DLBC	IUPHAR	RPS29	SIRT3	0.801540025	7.69E-12
DLBC	IUPHAR	RPS29	PSMB6	0.80216665	7.20E-12
DLBC	IUPHAR	RPS29	ATG4B	0.806638648	4.48E-12
DLBC	IUPHAR	RPS29	SIRT6	0.807167976	4.23E-12
DLBC	IUPHAR	RPS29	PHKG2	0.816288023	1.54E-12
DLBC	IUPHAR	RPS29	MMP24	0.834614463	1.70E-13
DLBC	IUPHAR	RPS29	SLC25A26	0.86708568	1.61E-15
DLBC	Kinase	RPS29	PHKG2	0.816288023	1.54E-12
DLBC	TF	RPS29	ZNF581	0.802492399	6.96E-12
DLBC	TF	RPS29	HMG20B	0.807231799	4.20E-12
DLBC	TF	RPS29	THAP4	0.808855337	3.53E-12
DLBC	TF	RPS29	ZNF444	0.808876993	3.52E-12
DLBC	TF	RPS29	ZNF428	0.817357772	1.37E-12
DLBC	TF	RPS29	MBD3	0.82098888	8.97E-13
DLBC	TF	RPS29	IRF3	0.829400345	3.27E-13
DLBC	TF	RPS29	THAP3	0.841676235	6.74E-14
DLBC	TF	RPS29	NME2	0.870707558	8.87E-16
DLBC	TF	RPS29	THAP7	0.874077939	5.02E-16
DLBC	TSG	RPS29	SIRT3	0.801540025	7.69E-12
DLBC	TSG	RPS29	PARK7	0.803408896	6.32E-12
DLBC	TSG	RPS29	STUB1	0.805004687	5.34E-12
DLBC	TSG	RPS29	BRMS1	0.805047829	5.31E-12
DLBC	TSG	RPS29	SIRT6	0.807167976	4.23E-12
DLBC	TSG	RPS29	IRF3	0.829400345	3.27E-13
DLBC	TSG	RPS29	TSSC4	0.840418895	7.97E-14
DLBC	TSG	RPS29	GLTSCR2	0.860250745	4.72E-15
DLBC	TSG	RPS29	GNB2L1	0.886511201	5.27E-17
DLBC	TSG	RPS29	GADD45GIP1	0.886638107	5.15E-17
GBM	Cell metabolism gene	RPS29	DAD1	0.803005842	4.66E-40
GBM	Cell metabolism gene	RPS29	SSR2	0.803290005	4.17E-40
GBM	Cell metabolism gene	RPS29	PFDN5	0.829979453	5.84E-45
GBM	Cell metabolism gene	RPS29	FAU	0.836893166	2.34E-46
GBM	Cell metabolism gene	RPS29	PSMA6	0.85644198	1.09E-50
GBM	Cell metabolism gene	RPS29	TIMM9	0.880968516	3.93E-57
GBM	TF	RPS29	ZNF410	0.812044183	1.30E-41
LGG	Cell metabolism gene	RPS29	FAU	0.83371639	2.77E-138
PRAD	Cell metabolism gene	RPS29	NME2	0.801114765	2.91E-124
PRAD	Cell metabolism gene	RPS29	SNRPE	0.824254651	1.78E-137
PRAD	Cell metabolism gene	RPS29	TIMM9	0.841599808	1.01E-148
PRAD	Cell metabolism gene	RPS29	TOMM7	0.84513883	3.48E-151
PRAD	Cell metabolism gene	RPS29	SNRPD2	0.850414716	5.67E-155
PRAD	Epifactor	RPS29	FBL	0.84375374	3.25E-150
PRAD	TF	RPS29	NME2	0.801114765	2.91E-124
THYM	Cell metabolism gene	RPS29	POLR3K	0.800333429	1.98E-28
THYM	Cell metabolism gene	RPS29	POLR2F	0.802978461	9.66E-29
THYM	Cell metabolism gene	RPS29	GEMIN7	0.807031275	3.16E-29
THYM	Cell metabolism gene	RPS29	GMPPA	0.807055122	3.14E-29
THYM	Cell metabolism gene	RPS29	DPM2	0.811323145	9.40E-30
THYM	Cell metabolism gene	RPS29	SNRPE	0.812123679	7.47E-30
THYM	Cell metabolism gene	RPS29	IMPDH2	0.812858074	6.05E-30
THYM	Cell metabolism gene	RPS29	EXOSC4	0.814621758	3.63E-30
THYM	Cell metabolism gene	RPS29	PGP	0.815205331	3.06E-30
THYM	Cell metabolism gene	RPS29	TIMM50	0.815674133	2.66E-30
THYM	Cell metabolism gene	RPS29	SNRPD3	0.816344341	2.19E-30
THYM	Cell metabolism gene	RPS29	POLA2	0.817631106	1.49E-30
THYM	Cell metabolism gene	RPS29	PSMB1	0.820123853	7.08E-31
THYM	Cell metabolism gene	RPS29	DTYMK	0.821784824	4.28E-31
THYM	Cell metabolism gene	RPS29	EBP	0.823084663	2.88E-31
THYM	Cell metabolism gene	RPS29	PSMA5	0.825015915	1.58E-31
THYM	Cell metabolism gene	RPS29	SMPD2	0.82769474	6.82E-32
THYM	Cell metabolism gene	RPS29	MVD	0.829297547	4.10E-32
THYM	Cell metabolism gene	RPS29	TOMM22	0.829313541	4.08E-32
THYM	Cell metabolism gene	RPS29	POLR2H	0.831360816	2.11E-32
THYM	Cell metabolism gene	RPS29	GUK1	0.831524982	2.00E-32
THYM	Cell metabolism gene	RPS29	OAZ1	0.83264093	1.39E-32
THYM	Cell metabolism gene	RPS29	APRT	0.833967641	8.99E-33
THYM	Cell metabolism gene	RPS29	FPGS	0.835011031	6.37E-33
THYM	Cell metabolism gene	RPS29	PGLS	0.836926535	3.36E-33
THYM	Cell metabolism gene	RPS29	LSM3	0.841812747	6.31E-34
THYM	Cell metabolism gene	RPS29	PFDN5	0.842661287	4.69E-34
THYM	Cell metabolism gene	RPS29	PSME1	0.846439699	1.23E-34
THYM	Cell metabolism gene	RPS29	POLD2	0.848906178	5.02E-35
THYM	Cell metabolism gene	RPS29	POLD4	0.849370226	4.24E-35
THYM	Cell metabolism gene	RPS29	PSMB3	0.851687713	1.80E-35
THYM	Cell metabolism gene	RPS29	ACOT8	0.85440204	6.46E-36
THYM	Cell metabolism gene	RPS29	PSMC3	0.857864328	1.70E-36
THYM	Cell metabolism gene	RPS29	SEC61G	0.858147447	1.52E-36
THYM	Cell metabolism gene	RPS29	TIMM8B	0.860792744	5.33E-37
THYM	Cell metabolism gene	RPS29	PSMD13	0.862492266	2.69E-37
THYM	Cell metabolism gene	RPS29	TALDO1	0.862793058	2.38E-37
THYM	Cell metabolism gene	RPS29	PSMB7	0.868863352	1.90E-38
THYM	Cell metabolism gene	RPS29	LSM2	0.87073478	8.51E-39
THYM	Cell metabolism gene	RPS29	SLC27A5	0.871385325	6.42E-39
THYM	Cell metabolism gene	RPS29	FAU	0.871779032	5.40E-39
THYM	Cell metabolism gene	RPS29	TIMM13	0.875853544	8.83E-40
THYM	Cell metabolism gene	RPS29	SSR2	0.899338425	6.23E-45
THYM	Cell metabolism gene	RPS29	SNRPD2	0.909717205	1.25E-47
THYM	CGC	RPS29	SDHAF2	0.863727969	1.63E-37
THYM	CGC	RPS29	TFPT	0.870904316	7.91E-39
THYM	Epifactor	RPS29	RUVBL2	0.800631067	1.82E-28
THYM	Epifactor	RPS29	EXOSC4	0.814621758	3.63E-30
THYM	Epifactor	RPS29	CXXC1	0.815900045	2.49E-30
THYM	Epifactor	RPS29	ZNHIT1	0.818808364	1.05E-30
THYM	Epifactor	RPS29	SIRT6	0.819643344	8.19E-31
THYM	Epifactor	RPS29	NOC2L	0.820208542	6.91E-31
THYM	Epifactor	RPS29	PPP4C	0.835990298	4.59E-33
THYM	Epifactor	RPS29	PRPF31	0.838024307	2.32E-33
THYM	Epifactor	RPS29	C17orf49	0.849115824	4.65E-35
THYM	Epifactor	RPS29	RRP8	0.866425354	5.33E-38
THYM	Epifactor	RPS29	TAF10	0.870396046	9.86E-39
THYM	Epifactor	RPS29	TFPT	0.870904316	7.91E-39
THYM	Epifactor	RPS29	BRMS1	0.897475472	1.77E-44
THYM	Epifactor	RPS29	FBL	0.903844362	4.58E-46
THYM	IUPHAR	RPS29	IMPDH2	0.812858074	6.05E-30
THYM	IUPHAR	RPS29	SIRT6	0.819643344	8.19E-31
THYM	IUPHAR	RPS29	PSMB1	0.820123853	7.08E-31
THYM	IUPHAR	RPS29	MFSD2B	0.823051184	2.90E-31
THYM	IUPHAR	RPS29	EGLN2	0.826693676	9.36E-32
THYM	IUPHAR	RPS29	SMPD2	0.82769474	6.82E-32
THYM	IUPHAR	RPS29	MVD	0.829297547	4.10E-32
THYM	IUPHAR	RPS29	SLC27A5	0.871385325	6.42E-39
THYM	TF	RPS29	ZNF444	0.806756296	3.41E-29
THYM	TF	RPS29	RBCK1	0.812945314	5.90E-30
THYM	TF	RPS29	USF1	0.813333392	5.27E-30
THYM	TF	RPS29	CXXC1	0.815900045	2.49E-30
THYM	TF	RPS29	PIN1	0.816510656	2.08E-30
THYM	TF	RPS29	THYN1	0.823621409	2.44E-31
THYM	TF	RPS29	REXO4	0.827846292	6.50E-32
THYM	TF	RPS29	ZNF581	0.832750792	1.34E-32
THYM	TF	RPS29	IRF3	0.833710049	9.79E-33
THYM	TSG	RPS29	PFN1	0.806676292	3.49E-29
THYM	TSG	RPS29	AIP	0.807761182	2.58E-29
THYM	TSG	RPS29	PIN1	0.816510656	2.08E-30
THYM	TSG	RPS29	NPRL2	0.819019826	9.87E-31
THYM	TSG	RPS29	SIRT6	0.819643344	8.19E-31
THYM	TSG	RPS29	IRF3	0.833710049	9.79E-33
THYM	TSG	RPS29	GLTSCR2	0.863126427	2.08E-37
THYM	TSG	RPS29	TSSC4	0.865823339	6.85E-38
THYM	TSG	RPS29	GNB2L1	0.878011572	3.30E-40
THYM	TSG	RPS29	BRMS1	0.897475472	1.77E-44
UCS	Cell metabolism gene	RPS29	POLR3K	0.800333429	1.98E-28
UCS	Cell metabolism gene	RPS29	POLR2F	0.802978461	9.66E-29
UCS	Cell metabolism gene	RPS29	GEMIN7	0.807031275	3.16E-29
UCS	Cell metabolism gene	RPS29	GMPPA	0.807055122	3.14E-29
UCS	Cell metabolism gene	RPS29	DPM2	0.811323145	9.40E-30
UCS	Cell metabolism gene	RPS29	SNRPE	0.812123679	7.47E-30
UCS	Cell metabolism gene	RPS29	IMPDH2	0.812858074	6.05E-30
UCS	Cell metabolism gene	RPS29	EXOSC4	0.814621758	3.63E-30
UCS	Cell metabolism gene	RPS29	PGP	0.815205331	3.06E-30
UCS	Cell metabolism gene	RPS29	TIMM50	0.815674133	2.66E-30
UCS	Cell metabolism gene	RPS29	SNRPD3	0.816344341	2.19E-30
UCS	Cell metabolism gene	RPS29	POLA2	0.817631106	1.49E-30
UCS	Cell metabolism gene	RPS29	PSMB1	0.820123853	7.08E-31
UCS	Cell metabolism gene	RPS29	DTYMK	0.821784824	4.28E-31
UCS	Cell metabolism gene	RPS29	EBP	0.823084663	2.88E-31
UCS	Cell metabolism gene	RPS29	PSMA5	0.825015915	1.58E-31
UCS	Cell metabolism gene	RPS29	SMPD2	0.82769474	6.82E-32
UCS	Cell metabolism gene	RPS29	MVD	0.829297547	4.10E-32
UCS	Cell metabolism gene	RPS29	TOMM22	0.829313541	4.08E-32
UCS	Cell metabolism gene	RPS29	POLR2H	0.831360816	2.11E-32
UCS	Cell metabolism gene	RPS29	GUK1	0.831524982	2.00E-32
UCS	Cell metabolism gene	RPS29	OAZ1	0.83264093	1.39E-32
UCS	Cell metabolism gene	RPS29	APRT	0.833967641	8.99E-33
UCS	Cell metabolism gene	RPS29	FPGS	0.835011031	6.37E-33
UCS	Cell metabolism gene	RPS29	PGLS	0.836926535	3.36E-33
UCS	Cell metabolism gene	RPS29	LSM3	0.841812747	6.31E-34
UCS	Cell metabolism gene	RPS29	PFDN5	0.842661287	4.69E-34
UCS	Cell metabolism gene	RPS29	PSME1	0.846439699	1.23E-34
UCS	Cell metabolism gene	RPS29	POLD2	0.848906178	5.02E-35
UCS	Cell metabolism gene	RPS29	POLD4	0.849370226	4.24E-35
UCS	Cell metabolism gene	RPS29	PSMB3	0.851687713	1.80E-35
UCS	Cell metabolism gene	RPS29	ACOT8	0.85440204	6.46E-36
UCS	Cell metabolism gene	RPS29	PSMC3	0.857864328	1.70E-36
UCS	Cell metabolism gene	RPS29	SEC61G	0.858147447	1.52E-36
UCS	Cell metabolism gene	RPS29	TIMM8B	0.860792744	5.33E-37
UCS	Cell metabolism gene	RPS29	PSMD13	0.862492266	2.69E-37
UCS	Cell metabolism gene	RPS29	TALDO1	0.862793058	2.38E-37
UCS	Cell metabolism gene	RPS29	PSMB7	0.868863352	1.90E-38
UCS	Cell metabolism gene	RPS29	LSM2	0.87073478	8.51E-39
UCS	Cell metabolism gene	RPS29	SLC27A5	0.871385325	6.42E-39
UCS	Cell metabolism gene	RPS29	FAU	0.871779032	5.40E-39
UCS	Cell metabolism gene	RPS29	TIMM13	0.875853544	8.83E-40
UCS	Cell metabolism gene	RPS29	SSR2	0.899338425	6.23E-45
UCS	Cell metabolism gene	RPS29	SNRPD2	0.909717205	1.25E-47
UCS	CGC	RPS29	SDHAF2	0.863727969	1.63E-37
UCS	CGC	RPS29	TFPT	0.870904316	7.91E-39
UCS	Epifactor	RPS29	RUVBL2	0.800631067	1.82E-28
UCS	Epifactor	RPS29	EXOSC4	0.814621758	3.63E-30
UCS	Epifactor	RPS29	CXXC1	0.815900045	2.49E-30
UCS	Epifactor	RPS29	ZNHIT1	0.818808364	1.05E-30
UCS	Epifactor	RPS29	SIRT6	0.819643344	8.19E-31
UCS	Epifactor	RPS29	NOC2L	0.820208542	6.91E-31
UCS	Epifactor	RPS29	PPP4C	0.835990298	4.59E-33
UCS	Epifactor	RPS29	PRPF31	0.838024307	2.32E-33
UCS	Epifactor	RPS29	C17orf49	0.849115824	4.65E-35
UCS	Epifactor	RPS29	RRP8	0.866425354	5.33E-38
UCS	Epifactor	RPS29	TAF10	0.870396046	9.86E-39
UCS	Epifactor	RPS29	TFPT	0.870904316	7.91E-39
UCS	Epifactor	RPS29	BRMS1	0.897475472	1.77E-44
UCS	Epifactor	RPS29	FBL	0.903844362	4.58E-46
UCS	IUPHAR	RPS29	IMPDH2	0.812858074	6.05E-30
UCS	IUPHAR	RPS29	SIRT6	0.819643344	8.19E-31
UCS	IUPHAR	RPS29	PSMB1	0.820123853	7.08E-31
UCS	IUPHAR	RPS29	MFSD2B	0.823051184	2.90E-31
UCS	IUPHAR	RPS29	EGLN2	0.826693676	9.36E-32
UCS	IUPHAR	RPS29	SMPD2	0.82769474	6.82E-32
UCS	IUPHAR	RPS29	MVD	0.829297547	4.10E-32
UCS	IUPHAR	RPS29	SLC27A5	0.871385325	6.42E-39
UCS	TF	RPS29	ZNF444	0.806756296	3.41E-29
UCS	TF	RPS29	RBCK1	0.812945314	5.90E-30
UCS	TF	RPS29	USF1	0.813333392	5.27E-30
UCS	TF	RPS29	CXXC1	0.815900045	2.49E-30
UCS	TF	RPS29	PIN1	0.816510656	2.08E-30
UCS	TF	RPS29	THYN1	0.823621409	2.44E-31
UCS	TF	RPS29	REXO4	0.827846292	6.50E-32
UCS	TF	RPS29	ZNF581	0.832750792	1.34E-32
UCS	TF	RPS29	IRF3	0.833710049	9.79E-33
UCS	TSG	RPS29	PFN1	0.806676292	3.49E-29
UCS	TSG	RPS29	AIP	0.807761182	2.58E-29
UCS	TSG	RPS29	PIN1	0.816510656	2.08E-30
UCS	TSG	RPS29	NPRL2	0.819019826	9.87E-31
UCS	TSG	RPS29	SIRT6	0.819643344	8.19E-31
UCS	TSG	RPS29	IRF3	0.833710049	9.79E-33
UCS	TSG	RPS29	GLTSCR2	0.863126427	2.08E-37
UCS	TSG	RPS29	TSSC4	0.865823339	6.85E-38
UCS	TSG	RPS29	GNB2L1	0.878011572	3.30E-40
UCS	TSG	RPS29	BRMS1	0.897475472	1.77E-44

Top

Protein structure

Protein 3D structure
Visit iCn3D.

Top

Protein-Protein Interaction

Protein-protein interaction networks
* Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

* Edge colors based on TCGA cancer types.

* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P))

Cancer type	Translation factor	Interacting protein coding gene	FC	adj.pval
KIRP	RPS29	RPL18A	-1.51651392808885	0.00016188295558095
KICH	RPS29	RPS27A	1.75396693785956	0.000187873840332031
KIRP	RPS29	RPS16	-1.35957043617517	0.00019507110118866
COAD	RPS29	RPS3	1.48730375143014	0.000411599874496461
KIRP	RPS29	RPS11	-1.01861570565103	0.00105937570333481
LIHC	RPS29	RPL8	-4.84588284974558	0.00110314154326131
PRAD	RPS29	RPL18A	1.40600175748499	0.00205137828390396
KICH	RPS29	RPL19	1.36901182894089	0.00250792503356934
KICH	RPS29	RPS12	1.26997381758431	0.00308787822723389
LUAD	RPS29	RPL19	-1.31398026615725	0.00993159558412698
THCA	RPS29	RPS16	-6.16322798156577	0.0115764821363307
BLCA	RPS29	RPS12	-1.47804673440421	0.0204124450683594
BLCA	RPS29	RPS27A	-1.04747470069188	0.0258216857910156
HNSC	RPS29	RPS3	-4.73505819095135	0.0273726439852453
COAD	RPS29	RPS11	1.35307548998204	0.0312207043170929
LUSC	RPS29	RPL19	-2.14669889516666	0.044366810398747
KIRC	RPS29	RPL19	-2.73485271276676	1.33980982873695e-10
BRCA	RPS29	RPS12	-4.91239327478244	1.85340619742495e-09
KIRP	RPS29	RPL37	-1.17421621947139	2.26888805627823e-05
KIRC	RPS29	RPL35	-1.06475238059392	2.72286325678163e-08
KIRC	RPS29	RPL8	-1.18252459971773	5.64962994208288e-07
KIRP	RPS29	RPL8	-1.53003692350119	6.0301274061203e-05
KIRC	RPS29	RPS16	-1.66149869889384	7.8509870430991e-09
BRCA	RPS29	RPS27A	-4.28512148200424	7.8788217967112e-14
KIRC	RPS29	RPL37	-2.87198822058464	8.03913394748564e-12
KIRP	RPS29	RPL35	-1.52981101975496	9.0546440333128e-05
KIRC	RPS29	RPS3	-1.29560847926387	9.05905681935088e-10
KIRC	RPS29	RPL18A	-4.43079304960843	9.2516163152192e-11

Protein-protein interactors with this translation factor (BIOGRID-3.4.160)

PPI interactors with RPS29

EIF1B, STYXL1, DDX56, EIF4A2, EXT2, RPL7, RPL27, RPS15, RPS14, RPSA, RPS9, RPL30, RPS21, RPS10, RPS8, RPS16, RPS3, RPS23, RPS17, CTBP2, UMPS, ADH6, SMARCD1, FAU, HNRNPU, LARP1, RPS12, RPS13, RPS15A, RPS18, RPS19, RPS20, RPS24, RPS25, RPS26, RPS28, DYNLT3, EIF2A, RPL28, RPS4X, RPS5, RPS2, RPS3A, RPS6, RPS7, SERBP1, TSR1, WIBG, ZBTB1, Fbxl16, ABCE1, RPL19, RPL9, RPL26, RPL26L1, RPL8, KRAS, NPM1, RPL10, EXOSC4, Eif3a, Eif3e, Srp72, Rrbp1, MCM2, GLIPR1, CYLD, TRIM25, HEY1, PYHIN1, RNF31, TNF, ESR2, HEXIM1, MEPCE, LARP7, AGR2, RECQL4, REST, EEA1, DCAF13, RC3H1, PPP1CC, VRK1, SAMD4A, SNRNP70, ITFG1, HMGB1, NFX1, WWP2, SYVN1, PLEKHA4, HCVgp1, ZC3H18, ESR1, ERCC6, CIT, ANLN, AURKB, CHMP4B, ECT2, KIF14, KIF20A, KIF23, PRC1, PLEKHG3, ARHGAP22, ARHGAP27, ARHGAP36, ARHGAP4, Arhgap6, ARHGEF1, ARHGEF4, MCF2L2, Pik3r2, PLEKHG4, SH3BP1, MKI67, Apc2, DNAJC19, DNAJC25, HSPBAP1, L3MBTL1, CIAO1, SDE2, SMYD2, HIST1H2BD, CBWD2, HOXA5, SPOP, UFL1, DDRGK1, FZR1, Nelfe, TMPRSS11B, KLF4, KLF8,

Top

Mutations

Clinically associated variants from ClinVar.

Gene	Chr	Position	RefSeq	VarSeq	RefSeeq	VarType	Pathogenic	Disease	VarInfo
RPS29	chr14	50044392	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
RPS29	chr14	50050396	G	GA	Duplication	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
RPS29	chr14	50050396	GA	G	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
RPS29	chr14	50050450	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
RPS29	chr14	50052664	C	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
RPS29	chr14	50052681	A	G	single_nucleotide_variant	Likely_pathogenic	Diamond-Blackfan_anemia_13	SO:0001583\|missense_variant	SO:0001583\|missense_variant
RPS29	chr14	50052739	T	A	single_nucleotide_variant	Pathogenic	Diamond-Blackfan_anemia_13	SO:0001583\|missense_variant	SO:0001583\|missense_variant
RPS29	chr14	50052757	A	G	single_nucleotide_variant	Likely_pathogenic	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
RPS29	chr14	50052770	G	T	single_nucleotide_variant	Likely_pathogenic	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
RPS29	chr14	50052773	A	C	single_nucleotide_variant	Uncertain_significance	Diamond-Blackfan_anemia_13	SO:0001627\|intron_variant	SO:0001627\|intron_variant
RPS29	chr14	50053047	C	T	single_nucleotide_variant	Benign/Likely_benign	not_specified\|not_provided	SO:0001819\|synonymous_variant,SO:0001627\|intron_variant	SO:0001819\|synonymous_variant,SO:0001627\|intron_variant
RPS29	chr14	50053263	C	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant

nsSNVs with sample frequency (size of circle) from TCGA 33 cancers.

SNVs and Indels

Gene	Cancer type	Chromosome	Start	End	RefSeeq	MutSeq	Mutation type	AAchange	# samples
RPS29	KIRC	chr14	50053045	50053045	T	C	Missense_Mutation	p.Y7C	4
RPS29	UCEC	chr14	50053006	50053006	G	C	Missense_Mutation	p.S20C	3
RPS29	LUAD	chr14	50053060	50053060	C	T	Missense_Mutation	p.G2D	2
RPS29	UCEC	chr14	50044564	50044564	A	G	Missense_Mutation	p.L57P	2
RPS29	KIRC	chr14	50053045	50053045	T	C	Missense_Mutation	p.L7R	1
RPS29	LIHC	chr14	50053056	50053079	GTGACCCATCTTGCTCTCAGCAGT	-	Translation_Start_Site		1
RPS29	SKCM	chr14	50052766	50052766	G	A	Splice_Site	p.R22_splice	1
RPS29	BLCA	chr14	50052766	50052766	G	C	Splice_Site	p.R22G	1
RPS29	CESC	chr14	50050372	50050372	G	C	RNA	NULL	1
RPS29	HNSC	chr14	50053078	50053078	G	A	Missense_Mutation		1

Copy number variation (CNV) of RPS29
* Click on the image to open the original image in a new window.

Fusion gene breakpoints (product of the structural variants (SVs)) across RPS29
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion genes with this translation factor from FusionGDB2.0.

FusionGDB2 ID	Disease	Sample	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand
96487	N/A	AA577987	DNAJA3	chr16	4503162	+	RPS29	chr14	50053567	-
96487	ACC	TCGA-OR-A5KT	FNDC3A	chr13	49720071	+	RPS29	chr14	50052767	-
96487	N/A	EC542684	HNRNPA2B1	chr7	26233280	+	RPS29	chr14	50050381	-
96487	STAD	TCGA-CD-A486-01A	JUND	chr19	18390816	-	RPS29	chr14	50050353	-
96487	COAD	TCGA-A6-2684-01A	KIAA1107	chr1	92633440	+	RPS29	chr14	50050387	-
96487	N/A	AA535571	LINGO2	chr9	28199996	-	RPS29	chr14	50050297	+
96487	N/A	EC576817	NCL	chr2	232319518	+	RPS29	chr14	50050341	-
96487	STAD	TCGA-VQ-A92D	NIN	chr14	51273454	-	RPS29	chr14	50052767	-
96487	N/A	AX184469	NUP155	chr5	37362656	-	RPS29	chr14	50063909	-
96487	OV	TCGA-24-1842-01A	POLE2	chr14	50154854	-	RPS29	chr14	50052767	-
96487	N/A	EC556734	RPL26	chr17	8280901	+	RPS29	chr14	50050346	-
77838	N/A	BU960781	RPS29	chr14	50058338	-	C6orf99	chr6	159334260	-
77838	N/A	BF218986	RPS29	chr14	50050296	-	C8orf44-SGK3	chr8	67599881	-
102383	N/A	CF124067	RPS29	chr14	50050297	-	CACNA1A	chr19	13329876	-
89285	N/A	BP228342	RPS29	chr14	50050295	-	CERK	chr22	47100721	+
77838	N/A	CF123708	RPS29	chr14	50050297	-	CNGB1	chr16	57956791	-
77838	N/A	AA548681	RPS29	chr14	50050290	-	CSDC2	chr22	41958405	+
99835	COAD	TCGA-AA-3525-01A	RPS29	chr14	50050360	-	ETV5	chr3	185826703	-
98346	N/A	BI856026	RPS29	chr14	50050300	-	GYS1	chr19	49475290	+
91467	N/A	EC582310	RPS29	chr14	50050290	-	HFM1	chr1	91826780	+
77838	N/A	BP430713	RPS29	chr14	50050290	-	IFT74	chr9	27011666	-
81676	N/A	CF124017	RPS29	chr14	50050296	-	LAMA1	chr18	7115807	+
97359	BRCA	TCGA-A8-A06Q-01A	RPS29	chr14	50052668	-	MAP3K3	chr17	61723394	+
99664	N/A	AV691615	RPS29	chr14	50050295	-	MLLT10	chr10	21920892	-
96263	N/A	CD240102	RPS29	chr14	50050290	-	NBEA	chr13	35718023	+
101172	N/A	BM016424	RPS29	chr14	50050296	-	NR6A1	chr9	127338578	-
91445	N/A	BF812767	RPS29	chr14	50047125	+	PARM1	chr4	75858546	+
77838	STAD	TCGA-HF-7131	RPS29	chr14	50052667	-	PIGF	chr2	46808730	-
77838	STAD	TCGA-HF-7131-01A	RPS29	chr14	50052668	-	PIGF	chr2	46808730	-
84611	BRCA	TCGA-C8-A12K-01A	RPS29	chr14	50053003	-	POLE2	chr14	50122561	-
82759	N/A	EC558127	RPS29	chr14	50052723	-	PSMC2	chr7	102989068	+
100374	N/A	BI496365	RPS29	chr14	50050296	-	PTPRD	chr9	10057514	+
87484	N/A	BG059206	RPS29	chr14	50050295	-	RNF150	chr4	141903701	-
77838	N/A	EC499282	RPS29	chr14	50050356	+	RPL26	chr17	8280903	-
97558	UCEC	TCGA-AP-A5FX-01A	RPS29	chr14	50052668	-	RPL36AL	chr14	50085858	-
96487	N/A	EC452086	RPS29	chr14	50050340	-	RPS29	chr14	50052671	+
92710	N/A	BP224547	RPS29	chr14	50050290	-	SGCD	chr5	155423786	+
90055	N/A	BQ373523	RPS29	chr14	50053298	-	SSH3	chr11	67073868	-
94252	STAD	TCGA-CD-8525-01A	RPS29	chr14	50052668	-	TRIP12	chr2	230650571	-
81223	N/A	BP225268	RPS29	chr14	50050295	-	ZCCHC7	chr9	37350138	-
96487	N/A	EC554133	SLC34A2	chr4	25680330	+	RPS29	chr14	50053093	-
96487	OV	TCGA-09-1667	SULF1	chr8	70512988	+	RPS29	chr14	50044571	-
96487	OV	TCGA-09-1667-01C	SULF1	chr8	70501376	+	RPS29	chr14	50052767	-
96487	OV	TCGA-09-1667-01C	SULF1	chr8	70512988	+	RPS29	chr14	50052767	-
96487	N/A	BU532331	TBRG4	chr7	45148641	-	RPS29	chr14	50050356	-
96491	N/A	AA531568	UBTD2	chr5	171659318	-	RPS29	chr14	50050296	+

Top

Prognostic Analysis

Kaplan-Meier plots with logrank tests of overall survival (OS)

Cancer type

Translation factor

Coefficent

Hazard ratio

Wald test pval

Likelihool ratio pval

Logrank test pval

# samples

Top

Translation factor and Gender

Differential gene expression between female and male. (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
LGG	RPS29	0.0182365116272011	0.51

Top

Translation factor and Age

Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
LUSC	RPS29	0.00841179342422611	0.28
LGG	RPS29	0.0390487407181976	1
BRCA	RPS29	0.00837762099522085	0.28
THYM	RPS29	0.0408437824396013	1

Top

Related Drugs

Drugs targeting genes involved in this translation factor.
(DrugBank Version 5.1.8 2021-05-08)

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

Related Diseases

Diseases associated with this translation factor.
(DisGeNet 4.0)

Disease ID	Disease Name	# PubMeds	Disease source
C1260899	Anemia, Diamond-Blackfan	2	GENOMICS_ENGLAND;ORPHANET
C2931850	Aase Smith syndrome 2	1	ORPHANET
C4014641	DIAMOND-BLACKFAN ANEMIA 13	1	CTD_human;GENOMICS_ENGLAND;UNIPROT