|
||||||
|
Translation Factor: NSUN3 (NCBI Gene ID:63899) |
|
Gene Summary |
| Gene Information | Gene Name: NSUN3 | Gene ID: 63899 | Gene Symbol | NSUN3 | Gene ID | 63899 |
| Gene Name | NOP2/Sun RNA methyltransferase 3 | |
| Synonyms | MST077|MSTP077 | |
| Cytomap | 3q11.2 | |
| Type of Gene | protein-coding | |
| Description | tRNA (cytosine(34)-C(5))-methyltransferase, mitochondrialNOL1/NOP2/Sun domain family member 3NOP2/Sun RNA methyltransferase family member 3putative methyltransferase NSUN3 | |
| Modification date | 20200313 | |
| UniProtAcc | Q9H649 | |
Child GO biological process term(s) under GO:0006412 |
| GO ID | GO term |
| GO:0006417 | Regulation of translation |
| GO:0032543 | Mitochondrial translation |
| GO:0005840 | Ribosome |
| GO:0006412 | Translation |
Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | NSUN3 | GO:0002127 | tRNA wobble base cytosine methylation | 27214402|27356879|27497299 |
Inferred gene age of translation factor. |
| Gene | Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25 |
| NSUN3 | (355.7 - 733] |
Top |
|
We searched PubMed using 'NSUN3[title] AND translation [title] AND human.' |
| Gene | Title | PMID |
| NSUN3 | NSUN3 and ABH1 modify the wobble position of mt-tRNAMet to expand codon recognition in mitochondrial translation | 27497299 |
Top |
|
Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. For more annotations, please visit our ExonSkipDB. |
![]() |
Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure. * Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser. |
| ENST | Exon skip start (DNA) | Exon Skip end (DNA) | ORF |
| ENST00000314622 | 93812983 | 93813138 | Frame-shift |
Exon skipping position in the amino acid sequence. |
| ENST | Exon skip start (DNA) | Exon Skip end (DNA) | Len(transcript seq) | Exon skip start (mRNA) | Exon Skip end (mRNA) | Len(amino acid seq) | Exon skip start (AA) | Exon Skip end (AA) |
Potentially (partially) lost protein functional features of UniProt. |
| UniProtAcc | Exon skip start (AA) | Exon Skip end (AA) | Function feature start (AA) | Function feature end (AA) | Functional feature type | Functional feature desc. |
Top |
|
Gene expression level across TCGA pancancer |
![]() |
Gene expression level across GTEx pantissue |
![]() |
Expression level of gene isoforms across TCGA pancancer |
![]() |
Expression level of gene isoforms across GTEx pantissue |
![]() |
Cancer(tissue) type-specific expression level of Translation factor using z-score distriution |
![]() |
Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples) |
![]() |
| Cancer type | Translation factor | FC | adj.pval |
| HNSC | NSUN3 | -1.20648775901954 | 0.0232541393677366 |
Top |
|
Translation factor expression regulation through miRNA binding |
| Cancer type | Gene | miRNA | TargetScan binding score (Context++ score percentile) | Coefficient | Pvalue |
| CESC | NSUN3 | hsa-miR-330-3p | 83 | 0.319996459236965 | 0.00445411540868611 |
Translation factor expression regulation through methylation in the promoter of Translation factor |
| Cancer type | Gene | methyl group b | methyl group a | DEG pval | avg methyl in b | avg methyl in a | avg exp in b | avg exp in a |
Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation) |
| Cancer type | Gene | methyl group b | methyl group a | DEG pval | avg methyl in b | avg methyl in a | avg exp in b | avg exp in a |
Translation factor expression regulation through copy number variation of Translation factor |
| Cancer type | Gene | Coefficient | Pvalue |
| DLBC | NSUN3 | 0.109864956 | 0.000246462 |
| LAML | NSUN3 | 0.038878445 | 0.030574589 |
Top |
|
Strongly correlated genes belong to cellular important gene groups with NSUN3 (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green) |
![]() |
| Cancer type | Gene group | Translation factor | Correlated gene | Coefficient | Pvalue |
| KICH | IUPHAR | NSUN3 | SLC35A5 | 0.814234096 | 9.86E-23 |
| THYM | Cell metabolism gene | NSUN3 | ARFGEF2 | 0.806427389 | 3.74E-29 |
| THYM | Cell metabolism gene | NSUN3 | PRKAA1 | 0.814764422 | 3.48E-30 |
| THYM | Cell metabolism gene | NSUN3 | PIKFYVE | 0.834805919 | 6.81E-33 |
| THYM | CGC | NSUN3 | ERCC4 | 0.800877252 | 1.71E-28 |
| THYM | CGC | NSUN3 | ATR | 0.819697536 | 8.06E-31 |
| THYM | Epifactor | NSUN3 | SMARCAD1 | 0.802107384 | 1.22E-28 |
| THYM | Epifactor | NSUN3 | SMEK2 | 0.810416146 | 1.22E-29 |
| THYM | Epifactor | NSUN3 | PRKAA1 | 0.814764422 | 3.48E-30 |
| THYM | Epifactor | NSUN3 | ATR | 0.819697536 | 8.06E-31 |
| THYM | Epifactor | NSUN3 | ARID4B | 0.843801152 | 3.14E-34 |
| THYM | IUPHAR | NSUN3 | PRKAA1 | 0.814764422 | 3.48E-30 |
| THYM | IUPHAR | NSUN3 | ATR | 0.819697536 | 8.06E-31 |
| THYM | IUPHAR | NSUN3 | PIKFYVE | 0.834805919 | 6.81E-33 |
| THYM | Kinase | NSUN3 | PRKAA1 | 0.814764422 | 3.48E-30 |
| THYM | Kinase | NSUN3 | ATR | 0.819697536 | 8.06E-31 |
| THYM | TF | NSUN3 | ZBTB11 | 0.850478228 | 2.82E-35 |
| THYM | TSG | NSUN3 | PRKAA1 | 0.814764422 | 3.48E-30 |
| THYM | TSG | NSUN3 | ATR | 0.819697536 | 8.06E-31 |
| UCS | Cell metabolism gene | NSUN3 | ARFGEF2 | 0.806427389 | 3.74E-29 |
| UCS | Cell metabolism gene | NSUN3 | PRKAA1 | 0.814764422 | 3.48E-30 |
| UCS | Cell metabolism gene | NSUN3 | PIKFYVE | 0.834805919 | 6.81E-33 |
| UCS | CGC | NSUN3 | ERCC4 | 0.800877252 | 1.71E-28 |
| UCS | CGC | NSUN3 | ATR | 0.819697536 | 8.06E-31 |
| UCS | Epifactor | NSUN3 | SMARCAD1 | 0.802107384 | 1.22E-28 |
| UCS | Epifactor | NSUN3 | SMEK2 | 0.810416146 | 1.22E-29 |
| UCS | Epifactor | NSUN3 | PRKAA1 | 0.814764422 | 3.48E-30 |
| UCS | Epifactor | NSUN3 | ATR | 0.819697536 | 8.06E-31 |
| UCS | Epifactor | NSUN3 | ARID4B | 0.843801152 | 3.14E-34 |
| UCS | IUPHAR | NSUN3 | PRKAA1 | 0.814764422 | 3.48E-30 |
| UCS | IUPHAR | NSUN3 | ATR | 0.819697536 | 8.06E-31 |
| UCS | IUPHAR | NSUN3 | PIKFYVE | 0.834805919 | 6.81E-33 |
| UCS | Kinase | NSUN3 | PRKAA1 | 0.814764422 | 3.48E-30 |
| UCS | Kinase | NSUN3 | ATR | 0.819697536 | 8.06E-31 |
| UCS | TF | NSUN3 | ZBTB11 | 0.850478228 | 2.82E-35 |
| UCS | TSG | NSUN3 | PRKAA1 | 0.814764422 | 3.48E-30 |
| UCS | TSG | NSUN3 | ATR | 0.819697536 | 8.06E-31 |
| UVM | CGC | NSUN3 | ATR | 0.817814786 | 2.10E-20 |
| UVM | Epifactor | NSUN3 | HLTF | 0.803252347 | 3.13E-19 |
| UVM | Epifactor | NSUN3 | ATR | 0.817814786 | 2.10E-20 |
| UVM | IUPHAR | NSUN3 | ATP11B | 0.804703843 | 2.41E-19 |
| UVM | IUPHAR | NSUN3 | ATR | 0.817814786 | 2.10E-20 |
| UVM | Kinase | NSUN3 | ATR | 0.817814786 | 2.10E-20 |
| UVM | TF | NSUN3 | ZBTB11 | 0.803305879 | 3.10E-19 |
| UVM | TF | NSUN3 | ZNF148 | 0.806021119 | 1.90E-19 |
| UVM | TF | NSUN3 | ZNF654 | 0.812387844 | 5.90E-20 |
| UVM | TF | NSUN3 | CGGBP1 | 0.830348915 | 1.68E-21 |
| UVM | TSG | NSUN3 | HLTF | 0.803252347 | 3.13E-19 |
| UVM | TSG | NSUN3 | ATR | 0.817814786 | 2.10E-20 |
Top |
|
Protein 3D structureVisit iCn3D. |
Top |
|
Protein-protein interaction networks * Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P)) |
![]() |
Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P)) |
![]() |
![]() * Edge colors based on TCGA cancer types. |
* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P)) |
![]() |
| Cancer type | Translation factor | Interacting protein coding gene | FC | adj.pval |
| PRAD | NSUN3 | METTL1 | -1.63380159139027 | 0.0001086303301899 |
| BRCA | NSUN3 | FTSJ3 | -3.46913955088154 | 0.000242834408791295 |
| PRAD | NSUN3 | NSUN5 | -1.07206800773388 | 0.000350945007587088 |
| THCA | NSUN3 | NSUN5 | -1.78607330603427 | 0.000361893082651998 |
| KICH | NSUN3 | WDR12 | 1.27437010311891 | 0.000631332397460937 |
| ESCA | NSUN3 | METTL1 | -1.44609135299267 | 0.0009765625 |
| ESCA | NSUN3 | WDR12 | -4.50085604434153 | 0.001953125 |
| ESCA | NSUN3 | NSUN5 | -6.13489313057259 | 0.0029296875 |
| ESCA | NSUN3 | DDX55 | -5.35907926138822 | 0.009765625 |
| LIHC | NSUN3 | METTL1 | -1.50812991098563 | 0.0171088642188067 |
| KIRC | NSUN3 | METTL1 | -3.13288625863516 | 0.0180140696589296 |
| CHOL | NSUN3 | TRMT11 | -1.83882690193514 | 0.01953125 |
| BRCA | NSUN3 | MTO1 | -1.09257288004134 | 0.0200878768110553 |
| BLCA | NSUN3 | GTPBP4 | 1.58690285996278 | 0.0289306640625 |
| PRAD | NSUN3 | TRMT11 | 1.06087533610535 | 0.0291755363147523 |
| READ | NSUN3 | FTSJ3 | -3.56153245977502 | 0.03125 |
| ESCA | NSUN3 | FTSJ3 | -2.37306570439978 | 0.0419921875 |
| BRCA | NSUN3 | METTL1 | -4.52332520302616 | 1.31899889155303e-16 |
| STAD | NSUN3 | METTL1 | -2.17210826407194 | 1.42958015203476e-07 |
| LUAD | NSUN3 | PUS1 | -2.33149816249926 | 1.55042044095848e-09 |
| KICH | NSUN3 | PUS1 | -1.07830972491459 | 1.82986259460449e-05 |
| STAD | NSUN3 | DDX55 | -1.85990041226941 | 2.00420618057251e-06 |
| STAD | NSUN3 | FTSJ3 | -1.61954756070611 | 2.00420618057251e-06 |
| PRAD | NSUN3 | DDX55 | -1.06119608116825 | 2.24248086489894e-05 |
| LIHC | NSUN3 | GTPBP4 | -1.61937717479796 | 2.46746298874691e-06 |
| KIRC | NSUN3 | MTO1 | -1.03081816734249 | 2.47012955490964e-07 |
| KIRP | NSUN3 | MTO1 | -3.77202252731403 | 2.49594449996948e-07 |
| LIHC | NSUN3 | WDR12 | -3.16467679630325 | 2.54824448841554e-08 |
| HNSC | NSUN3 | DDX55 | -1.92269002566393 | 2.61776540355641e-06 |
| LUAD | NSUN3 | DDX55 | -2.69446926676317 | 2.61881883428183e-09 |
| KIRP | NSUN3 | DDX55 | -1.24324098541014 | 2.66358256340027e-06 |
| KICH | NSUN3 | FTSJ3 | 1.78589325244141 | 2.98023223876953e-07 |
| KIRC | NSUN3 | NSUN7 | -2.83700247829284 | 3.11293121252179e-12 |
| LUSC | NSUN3 | NSUN5 | -4.54569982003047 | 3.6518313538953e-08 |
| BRCA | NSUN3 | NSUN5 | -1.29239909533653 | 3.65366474535211e-14 |
| KIRC | NSUN3 | DDX55 | -1.14218277964996 | 4.4523606197609e-12 |
| PRAD | NSUN3 | MTO1 | -2.87181302059323 | 4.59461327401057e-05 |
| LUSC | NSUN3 | NSUN7 | -3.00542519641248 | 5.24011361196257e-05 |
| HNSC | NSUN3 | GTPBP4 | 2.02268965512305 | 6.75183794101032e-05 |
| STAD | NSUN3 | WDR12 | -2.46721337744962 | 6.79492950439454e-06 |
| KICH | NSUN3 | DDX55 | -1.36704804776623 | 7.49826431274414e-05 |
| KIRP | NSUN3 | PUS1 | -4.4419119304275 | 8.84756445884705e-09 |
Protein-protein interactors with this translation factor (BIOGRID-3.4.160) |
| PPI interactors with NSUN3 |
| LRRTM1, LRFN4, THUMPD3, CD79A, TOR1AIP2, SLC2A12, HEXIM1, PHB2, HSPD1, PIPSL, KLRC2, VSIG4, CBWD2, UQCRFS1, FTL, KLK1, SLC31A1, TACSTD2, RNF181, CTLA4, KLRD1, RAMP2, BSCL2, CD3D, MAGEA8, GRPR, TMEM106A, MPL, OSTM1, P2RY10, GPR182, ADAMTS4, |
Top |
|
Clinically associated variants from ClinVar. |
| Gene | Chr | Position | RefSeq | VarSeq | RefSeeq | VarType | Pathogenic | Disease | VarInfo |
| NSUN3 | chr3 | 93802334 | GGGGAAAGCAACCAAACGGAGGCTGAAGTGAAGTTACAAAGGTTACACTCTTGTGCAAATATCTGATTGGTTATGGACAGCAACCAGAGACTAAAGTGAAGTTACAAAGTTCCACTTCTATGCAAGCGTGTGATTGGTTGCAAAAAGCAACAAATTAGAGGTACTTTCAATTTCCCATTTGCCATGCAGAAAATGTGGGGGTTTGCAAAGGGAGTAGCGCCTGGTTCTTTTGTTACTTAGGCATGATGGAAAGTT | G | Deletion | Pathogenic | Combined_oxidative_phosphorylation_deficiency_48 | SO:0001574|splice_acceptor_variant,SO:0001575|splice_donor_variant | SO:0001574|splice_acceptor_variant,SO:0001575|splice_donor_variant |
| NSUN3 | chr3 | 93803123 | C | T | single_nucleotide_variant | Pathogenic | Combined_oxidative_phosphorylation_deficiency_48 | SO:0001587|nonsense | SO:0001587|nonsense |
| NSUN3 | chr3 | 93803249 | G | C | single_nucleotide_variant | Pathogenic | Combined_oxidative_phosphorylation_deficiency_48 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| NSUN3 | chr3 | 93803282 | T | A | single_nucleotide_variant | Pathogenic | Combined_oxidative_phosphorylation_deficiency_48 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| NSUN3 | chr3 | 93803292 | C | CA | Duplication | Likely_pathogenic | not_provided | SO:0001589|frameshift_variant | SO:0001589|frameshift_variant |
nsSNVs with sample frequency (size of circle) from TCGA 33 cancers. |
SNVs and Indels |
| Gene | Cancer type | Chromosome | Start | End | RefSeeq | MutSeq | Mutation type | AAchange | # samples |
| NSUN3 | BRCA | chr3 | 93803063 | 93803063 | C | T | Nonsense_Mutation | p.Q79* | 4 |
| NSUN3 | KIRP | chr3 | 93845254 | 93845254 | G | T | Missense_Mutation | p.V315L | 3 |
| NSUN3 | UCS | chr3 | 93813928 | 93813928 | G | A | Missense_Mutation | p.D225N | 3 |
| NSUN3 | LUAD | chr3 | 93813893 | 93813893 | C | T | Missense_Mutation | p.P213L | 3 |
| NSUN3 | BRCA | chr3 | 93783283 | 93783283 | G | C | Silent | p.L5 | 3 |
| NSUN3 | BRCA | chr3 | 93845211 | 93845211 | C | G | Missense_Mutation | p.H300Q | 3 |
| NSUN3 | ESCA | chr3 | 93813066 | 93813066 | G | C | Missense_Mutation | p.L183F | 3 |
| NSUN3 | CESC | chr3 | 93813015 | 93813015 | G | C | Silent | 2 | |
| NSUN3 | LIHC | chr3 | 93845147 | 93845147 | T | - | Frame_Shift_Del | p.I279fs | 2 |
| NSUN3 | STAD | chr3 | 93803031 | 93803031 | A | G | Missense_Mutation | p.D68G | 2 |
| NSUN3 | UCEC | chr3 | 93845073 | 93845073 | A | G | Silent | p.L254 | 2 |
| NSUN3 | CESC | chr3 | 93813021 | 93813021 | G | C | Missense_Mutation | 2 | |
| NSUN3 | LIHC | chr3 | 93845245 | 93845245 | G | - | Frame_Shift_Del | p.G312fs | 2 |
| NSUN3 | HNSC | chr3 | 93803120 | 93803120 | G | A | Missense_Mutation | p.G98S | 2 |
| NSUN3 | UCEC | chr3 | 93845075 | 93845075 | G | T | Missense_Mutation | p.R255L | 2 |
| NSUN3 | LIHC | chr3 | 93845279 | 93845279 | G | - | Frame_Shift_Del | p.W323fs | 2 |
| NSUN3 | STAD | chr3 | 93803180 | 93803180 | G | C | Missense_Mutation | p.A118P | 2 |
| NSUN3 | BLCA | chr3 | 93802971 | 93802971 | C | G | Nonsense_Mutation | p.S48* | 2 |
| NSUN3 | PAAD | chr3 | 93783283 | 93783283 | G | A | Silent | p.L5L | 2 |
| NSUN3 | LIHC | chr3 | 93802963 | 93802963 | A | G | Silent | 2 | |
| NSUN3 | LIHC | chr3 | 93802963 | 93802963 | A | G | Silent | p.T45T | 2 |
| NSUN3 | HNSC | chr3 | 93781974 | 93781974 | C | T | Silent | p.L2L | 2 |
| NSUN3 | HNSC | chr3 | 93783306 | 93783306 | T | A | Missense_Mutation | p.L13H | 2 |
| NSUN3 | SKCM | chr3 | 93813945 | 93813945 | C | T | Silent | p.S230S | 2 |
| NSUN3 | UCEC | chr3 | 93803123 | 93803123 | C | T | Nonsense_Mutation | p.R99* | 2 |
| NSUN3 | HNSC | chr3 | 93783304 | 93783304 | G | T | Missense_Mutation | p.K12N | 2 |
| NSUN3 | SKCM | chr3 | 93781971 | 93781971 | A | G | Missense_Mutation | p.M1V | 2 |
| NSUN3 | UCEC | chr3 | 93803192 | 93803192 | C | A | Missense_Mutation | p.L122I | 2 |
| NSUN3 | ESCA | chr3 | 93813066 | 93813066 | G | C | Missense_Mutation | 1 | |
| NSUN3 | LUAD | chr3 | 93802949 | 93802949 | A | T | Splice_Site | p.R41_splice | 1 |
| NSUN3 | HNSC | chr3 | 93803224 | 93803224 | G | T | Silent | p.G132G | 1 |
| NSUN3 | ESCA | chr3 | 93803065 | 93803065 | G | T | Missense_Mutation | p.Q79H | 1 |
| NSUN3 | LUAD | chr3 | 93812983 | 93812983 | G | T | Splice_Site | p.G156_splice | 1 |
| NSUN3 | STAD | chr3 | 93783344 | 93783345 | - | A | Frame_Shift_Ins | p.E26fs | 1 |
| NSUN3 | CESC | chr3 | 93813015 | 93813015 | G | C | Silent | p.L166 | 1 |
| NSUN3 | GBM | chr3 | 93813043 | 93813043 | G | C | Missense_Mutation | p.E176Q | 1 |
| NSUN3 | LUSC | chr3 | 93845224 | 93845224 | G | T | Missense_Mutation | p.A305S | 1 |
| NSUN3 | UCS | chr3 | 93813928 | 93813928 | G | A | Missense_Mutation | 1 | |
| NSUN3 | CESC | chr3 | 93813021 | 93813021 | G | C | Missense_Mutation | p.L168F | 1 |
| NSUN3 | LIHC | chr3 | 93803159 | 93803159 | A | - | Frame_Shift_Del | p.K112fs | 1 |
| NSUN3 | HNSC | chr3 | 93783304 | 93783304 | G | T | Missense_Mutation | 1 | |
| NSUN3 | LUSC | chr3 | 93803157 | 93803157 | T | A | Missense_Mutation | p.L110Q | 1 |
| NSUN3 | KIRP | chr3 | 93845254 | 93845254 | G | T | Missense_Mutation | 1 | |
| NSUN3 | COAD | chr3 | 93803155 | 93803155 | C | T | Silent | p.N109N | 1 |
| NSUN3 | LIHC | chr3 | 93845299 | 93845299 | A | - | Frame_Shift_Del | p.K330fs | 1 |
| NSUN3 | STAD | chr3 | 93783345 | 93783346 | - | A | Frame_Shift_Ins | p.E26fs | 1 |
| NSUN3 | HNSC | chr3 | 93783306 | 93783306 | T | A | Missense_Mutation | 1 | |
| NSUN3 | LUSC | chr3 | 93803158 | 93803158 | G | A | Silent | p.L110L | 1 |
| NSUN3 | BLCA | chr3 | 93783294 | 93783294 | C | T | Missense_Mutation | 1 | |
| NSUN3 | LIHC | chr3 | 93845062 | 93845062 | A | G | Missense_Mutation | 1 | |
| NSUN3 | COAD | chr3 | 93813134 | 93813134 | A | G | Missense_Mutation | p.D206G | 1 |
| NSUN3 | LUAD | chr3 | 93802949 | 93802949 | A | T | Splice_Site | 1 | |
| NSUN3 | HNSC | chr3 | 93781974 | 93781974 | C | T | Silent | 1 | |
| NSUN3 | PAAD | chr3 | 93783283 | 93783283 | G | A | Silent | 1 | |
| NSUN3 | THCA | chr3 | 93802955 | 93802956 | AT | - | Frame_Shift_Del | p.I43fs | 1 |
| NSUN3 | LIHC | chr3 | 93803011 | 93803011 | T | C | Silent | 1 | |
| NSUN3 | COAD | chr3 | 93803286 | 93803286 | C | T | Missense_Mutation | p.A153V | 1 |
| NSUN3 | LUAD | chr3 | 93845234 | 93845234 | G | T | Missense_Mutation | p.G308V | 1 |
| NSUN3 | HNSC | chr3 | 93803120 | 93803120 | G | A | Missense_Mutation | 1 | |
| NSUN3 | THYM | chr3 | 93845122 | 93845122 | G | T | Nonsense_Mutation | p.E271X | 1 |
| NSUN3 | BLCA | chr3 | 93783294 | 93783294 | C | T | Missense_Mutation | p.S9L | 1 |
| NSUN3 | DLBC | chr3 | 93845062 | 93845062 | A | G | Missense_Mutation | p.I251V | 1 |
| NSUN3 | HNSC | chr3 | 93803224 | 93803224 | G | T | Silent | 1 | |
| NSUN3 | PRAD | chr3 | 93803223 | 93803223 | G | T | Missense_Mutation | p.G132V | 1 |
| NSUN3 | UCEC | chr3 | 93845073 | 93845073 | A | G | Silent | p.L254L | 1 |
| NSUN3 | ESCA | chr3 | 93795383 | 93795383 | C | A | RNA | NULL | 1 |
| NSUN3 | LUAD | chr3 | 93812983 | 93812983 | G | T | Splice_Site | 1 | |
| NSUN3 | READ | chr3 | 93803060 | 93803060 | T | A | Missense_Mutation | p.S78T | 1 |
| NSUN3 | UCEC | chr3 | 93803065 | 93803065 | G | A | Silent | p.Q79Q | 1 |
| NSUN3 | LIHC | chr3 | 93812983 | 93812983 | G | T | Splice_Site | . | 1 |
| NSUN3 | ESCA | chr3 | 93795412 | 93795412 | G | T | RNA | NULL | 1 |
| NSUN3 | LUAD | chr3 | 93845162 | 93845162 | G | C | Missense_Mutation | p.G284A | 1 |
| NSUN3 | LIHC | chr3 | 93813919 | 93813919 | T | - | Frame_Shift_Del | p.F222fs | 1 |
| NSUN3 | LUAD | chr3 | 93845109 | 93845109 | G | A | Silent | p.T266T | 1 |
Copy number variation (CNV) of NSUN3 * Click on the image to open the original image in a new window. |
![]() |
Fusion gene breakpoints (product of the structural variants (SVs)) across NSUN3 * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Fusion genes with this translation factor from FusionGDB2.0. |
| FusionGDB2 ID | Disease | Sample | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand |
| 36017 | STAD | TCGA-BR-8058-01A | APTX | chr9 | 32988081 | - | NSUN3 | chr3 | 93802951 | + |
| 36017 | LUSC | TCGA-NC-A5HD-01A | ARL13B | chr3 | 93722752 | + | NSUN3 | chr3 | 93845055 | + |
| 36023 | SARC | TCGA-DX-A8BR-01A | HECTD1 | chr14 | 31617927 | - | NSUN3 | chr3 | 93800453 | + |
| 89169 | ESCA | TCGA-LN-A49K | NSUN3 | chr3 | 93813998 | + | ALCAM | chr3 | 105238910 | + |
| 96258 | N/A | CD674690 | NSUN3 | chr3 | 93846833 | + | ASPH | chr8 | 62560042 | - |
| 98738 | N/A | AF169972 | NSUN3 | chr3 | 93845631 | + | CDK8 | chr13 | 26893896 | - |
| 93484 | N/A | AF351612 | NSUN3 | chr3 | 93804223 | + | EZR | chr6 | 159221568 | - |
| 83984 | STAD | TCGA-BR-A4PE | NSUN3 | chr3 | 93813998 | + | HGD | chr3 | 120371498 | - |
| 102084 | Non-Cancer | TCGA-HU-A4GP-11A | NSUN3 | chr3 | 93783390 | + | SEC31A | chr4 | 83750211 | - |
Top |
|
Kaplan-Meier plots with logrank tests of overall survival (OS) |
![]() |
| Cancer type | Translation factor | Coefficent | Hazard ratio | Wald test pval | Likelihool ratio pval | Logrank test pval | # samples |
Top |
|
Differential gene expression between female and male. (Wilcoxon test, pval<0.05) |
![]() |
| Cancer type | Translation factor | pval | adj.p |
| HNSC | NSUN3 | 0.000537540123267641 | 0.015 |
| ACC | NSUN3 | 0.00200719759878059 | 0.054 |
| LUAD | NSUN3 | 0.00316480072149138 | 0.082 |
| STAD | NSUN3 | 0.00449613103919873 | 0.11 |
| GBM | NSUN3 | 0.00509144745640982 | 0.12 |
| THYM | NSUN3 | 0.0245069444445632 | 0.56 |
| THCA | NSUN3 | 0.0286610534804987 | 0.63 |
Top |
|
Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05) |
![]() |
| Cancer type | Translation factor | pval | adj.p |
| STAD | NSUN3 | 0.0398205352477647 | 1 |
| THCA | NSUN3 | 7.43588503471176e-05 | 0.0025 |
| CHOL | NSUN3 | 0.0255086207691769 | 0.82 |
Top |
|
Drugs targeting genes involved in this translation factor. (DrugBank Version 5.1.8 2021-05-08) |
| UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
|
Diseases associated with this translation factor. (DisGeNet 4.0) |
| Disease ID | Disease Name | # PubMeds | Disease source |