|
||||||
|
Translation Factor: PNPT1 (NCBI Gene ID:87178) |
|
Gene Summary |
| Gene Information | Gene Name: PNPT1 | Gene ID: 87178 | Gene Symbol | PNPT1 | Gene ID | 87178 |
| Gene Name | polyribonucleotide nucleotidyltransferase 1 | |
| Synonyms | COXPD13|DFNB70|OLD35|PNPASE|old-35 | |
| Cytomap | 2p16.1 | |
| Type of Gene | protein-coding | |
| Description | polyribonucleotide nucleotidyltransferase 1, mitochondrial3'-5' RNA exonuclease OLD35PNPase 1PNPase old-35polynucleotide phosphorylase 1polynucleotide phosphorylase-like protein | |
| Modification date | 20200313 | |
| UniProtAcc | Q8TCS8 | |
Child GO biological process term(s) under GO:0006412 |
| GO ID | GO term |
| GO:0017148 | Negative regulation of translation |
| GO:0006417 | Regulation of translation |
| GO:0005840 | Ribosome |
| GO:0006412 | Translation |
Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | PNPT1 | GO:0000957 | mitochondrial RNA catabolic process | 18501193 |
| Hgene | PNPT1 | GO:0000958 | mitochondrial mRNA catabolic process | 20691904 |
| Hgene | PNPT1 | GO:0000962 | positive regulation of mitochondrial RNA catabolic process | 19509288|29967381 |
| Hgene | PNPT1 | GO:0006401 | RNA catabolic process | 18083836 |
| Hgene | PNPT1 | GO:0006402 | mRNA catabolic process | 12721301|16055741 |
| Hgene | PNPT1 | GO:0034599 | cellular response to oxidative stress | 18501193 |
| Hgene | PNPT1 | GO:0035458 | cellular response to interferon-beta | 16410805 |
| Hgene | PNPT1 | GO:0035927 | RNA import into mitochondrion | 20691904 |
| Hgene | PNPT1 | GO:0035928 | rRNA import into mitochondrion | 20691904 |
| Hgene | PNPT1 | GO:0043631 | RNA polyadenylation | 18083836 |
| Hgene | PNPT1 | GO:0045926 | negative regulation of growth | 12721301 |
| Hgene | PNPT1 | GO:0051260 | protein homooligomerization | 20691904 |
| Hgene | PNPT1 | GO:0070207 | protein homotrimerization | 19509288|20691904 |
| Hgene | PNPT1 | GO:0071042 | nuclear polyadenylation-dependent mRNA catabolic process | 16934922 |
| Hgene | PNPT1 | GO:0071850 | mitotic cell cycle arrest | 12721301 |
| Hgene | PNPT1 | GO:2000627 | positive regulation of miRNA catabolic process | 20547861 |
| Hgene | PNPT1 | GO:2000772 | regulation of cellular senescence | 16055741 |
Inferred gene age of translation factor. |
| Gene | Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25 |
| PNPT1 | >1119.25 |
Top |
|
We searched PubMed using 'PNPT1[title] AND translation [title] AND human.' |
| Gene | Title | PMID |
| PNPT1 | . | . |
Top |
|
Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. For more annotations, please visit our ExonSkipDB. |
![]() |
Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure. * Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser. |
| ENST | Exon skip start (DNA) | Exon Skip end (DNA) | ORF |
| ENST00000447944 | 55864686 | 55864734 | In-frame |
| ENST00000447944 | 55867761 | 55867840 | Frame-shift |
| ENST00000447944 | 55871771 | 55871855 | In-frame |
| ENST00000447944 | 55873549 | 55873621 | In-frame |
| ENST00000447944 | 55874481 | 55874588 | Frame-shift |
| ENST00000447944 | 55882034 | 55882088 | In-frame |
| ENST00000447944 | 55883439 | 55883506 | Frame-shift |
| ENST00000447944 | 55887291 | 55887328 | Frame-shift |
| ENST00000447944 | 55889090 | 55889161 | Frame-shift |
| ENST00000447944 | 55894996 | 55895093 | Frame-shift |
| ENST00000447944 | 55900027 | 55900214 | Frame-shift |
| ENST00000447944 | 55907846 | 55907894 | In-frame |
Exon skipping position in the amino acid sequence. |
| ENST | Exon skip start (DNA) | Exon Skip end (DNA) | Len(transcript seq) | Exon skip start (mRNA) | Exon Skip end (mRNA) | Len(amino acid seq) | Exon skip start (AA) | Exon Skip end (AA) |
| ENST00000447944 | 55864686 | 55864734 | 4428 | 2236 | 2283 | 783 | 716 | 732 |
| ENST00000447944 | 55871771 | 55871855 | 4428 | 1910 | 1993 | 783 | 607 | 635 |
| ENST00000447944 | 55873549 | 55873621 | 4428 | 1690 | 1761 | 783 | 534 | 558 |
| ENST00000447944 | 55882034 | 55882088 | 4428 | 1529 | 1582 | 783 | 480 | 498 |
| ENST00000447944 | 55907846 | 55907894 | 4428 | 605 | 652 | 783 | 172 | 188 |
Potentially (partially) lost protein functional features of UniProt. |
| UniProtAcc | Exon skip start (AA) | Exon Skip end (AA) | Function feature start (AA) | Function feature end (AA) | Functional feature type | Functional feature desc. |
| Q8TCS8 | 716 | 732 | 46 | 783 | Chain | ID=PRO_0000024751;Note=Polyribonucleotide nucleotidyltransferase 1%2C mitochondrial |
| Q8TCS8 | 172 | 188 | 46 | 783 | Chain | ID=PRO_0000024751;Note=Polyribonucleotide nucleotidyltransferase 1%2C mitochondrial |
| Q8TCS8 | 480 | 498 | 46 | 783 | Chain | ID=PRO_0000024751;Note=Polyribonucleotide nucleotidyltransferase 1%2C mitochondrial |
| Q8TCS8 | 534 | 558 | 46 | 783 | Chain | ID=PRO_0000024751;Note=Polyribonucleotide nucleotidyltransferase 1%2C mitochondrial |
| Q8TCS8 | 607 | 635 | 46 | 783 | Chain | ID=PRO_0000024751;Note=Polyribonucleotide nucleotidyltransferase 1%2C mitochondrial |
| Q8TCS8 | 607 | 635 | 605 | 664 | Domain | Note=KH;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00117 |
| Q8TCS8 | 716 | 732 | 679 | 750 | Domain | Note=S1 motif;Ontology_term=ECO:0000255;evidence=ECO:0000255|PROSITE-ProRule:PRU00180 |
| Q8TCS8 | 534 | 558 | 552 | 552 | Modified residue | Note=N6-succinyllysine;Ontology_term=ECO:0000250;evidence=ECO:0000250|UniProtKB:Q8K1R3 |
| Q8TCS8 | 480 | 498 | 484 | 484 | Mutagenesis | Note=Inhibits poly(A) polymerase and RNA degradation activities. Does not inhibit the import or stabilization of RNase P RNA into the mitochondrial matrix. Does not inhibit homotrimerization activity. S->A;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:20691904;Dbxref=PMID:20691904 |
| Q8TCS8 | 534 | 558 | 544 | 544 | Mutagenesis | Note=Stimulates in vitro poly(A) polymerase activity. Inhibits RNA degradation activity. Inhibits the import or stabilization of RNase P RNA into the mitochondrial matrix. Does not inhibit homotrimerization activity. D->A;Ontology_term=ECO:0000269;evidence=ECO:0000269|PubMed:20691904;Dbxref=PMID:20691904 |
| Q8TCS8 | 172 | 188 | 165 | 179 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:3U1K |
| Q8TCS8 | 172 | 188 | 180 | 182 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:3U1K |
| Q8TCS8 | 480 | 498 | 483 | 497 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:3U1K |
| Q8TCS8 | 534 | 558 | 535 | 539 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:3U1K |
| Q8TCS8 | 534 | 558 | 541 | 549 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:3U1K |
| Q8TCS8 | 534 | 558 | 554 | 561 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:3U1K |
| Q8TCS8 | 607 | 635 | 606 | 611 | Beta strand | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:3U1K |
| Q8TCS8 | 607 | 635 | 614 | 621 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:3U1K |
| Q8TCS8 | 607 | 635 | 623 | 625 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:3U1K |
| Q8TCS8 | 607 | 635 | 626 | 635 | Helix | Ontology_term=ECO:0000244;evidence=ECO:0000244|PDB:3U1K |
Top |
|
Gene expression level across TCGA pancancer |
![]() |
Gene expression level across GTEx pantissue |
![]() |
Expression level of gene isoforms across TCGA pancancer |
![]() |
Expression level of gene isoforms across GTEx pantissue |
![]() |
Cancer(tissue) type-specific expression level of Translation factor using z-score distriution |
![]() |
Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples) |
![]() |
| Cancer type | Translation factor | FC | adj.pval |
| KICH | PNPT1 | 1.84455116577408 | 0.000187873840332031 |
| LIHC | PNPT1 | -1.04502631808729 | 0.00967934859969721 |
| STAD | PNPT1 | -2.72869865637622 | 1.11940316855908e-05 |
| KIRC | PNPT1 | 1.16005507166092 | 2.90348670181982e-08 |
Top |
|
Translation factor expression regulation through miRNA binding |
| Cancer type | Gene | miRNA | TargetScan binding score (Context++ score percentile) | Coefficient | Pvalue |
| UCEC | PNPT1 | hsa-miR-145-5p | 70 | 0.364400305576776 | 0.0347909025005121 |
Translation factor expression regulation through methylation in the promoter of Translation factor |
![]() |
| Cancer type | Gene | methyl group b | methyl group a | DEG pval | avg methyl in b | avg methyl in a | avg exp in b | avg exp in a |
Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation) |
![]() |
| Cancer type | Gene | methyl group b | methyl group a | DEG pval | avg methyl in b | avg methyl in a | avg exp in b | avg exp in a |
Translation factor expression regulation through copy number variation of Translation factor |
![]() |
| Cancer type | Gene | Coefficient | Pvalue |
| LIHC | PNPT1 | 0.03310716 | 0.037579673 |
Top |
|
Strongly correlated genes belong to cellular important gene groups with PNPT1 (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green) |
![]() |
| Cancer type | Gene group | Translation factor | Correlated gene | Coefficient | Pvalue |
| COAD | Cell metabolism gene | PNPT1 | HSPD1 | 0.841301512 | 2.29E-89 |
| COAD | TSG | PNPT1 | HSPD1 | 0.841301512 | 2.29E-89 |
| KICH | Cell metabolism gene | PNPT1 | PSMD14 | 0.81075139 | 2.08E-22 |
| KICH | Cell metabolism gene | PNPT1 | PIGF | 0.81332359 | 1.20E-22 |
| KICH | CGC | PNPT1 | MSH2 | 0.804596148 | 7.47E-22 |
| KICH | Epifactor | PNPT1 | ATF2 | 0.80540742 | 6.33E-22 |
| KICH | Epifactor | PNPT1 | SMEK2 | 0.813111047 | 1.26E-22 |
| KICH | Epifactor | PNPT1 | HAT1 | 0.825373326 | 8.15E-24 |
| KICH | IUPHAR | PNPT1 | PSMD14 | 0.81075139 | 2.08E-22 |
| KICH | IUPHAR | PNPT1 | HAT1 | 0.825373326 | 8.15E-24 |
| KICH | TF | PNPT1 | ATF2 | 0.80540742 | 6.33E-22 |
| KICH | TF | PNPT1 | CEBPZ | 0.832966004 | 1.34E-24 |
| KICH | TSG | PNPT1 | MSH2 | 0.804596148 | 7.47E-22 |
| SKCM | Cell metabolism gene | PNPT1 | XPO1 | 0.834197234 | 4.37E-124 |
| SKCM | CGC | PNPT1 | XPO1 | 0.834197234 | 4.37E-124 |
| SKCM | IUPHAR | PNPT1 | XPO1 | 0.834197234 | 4.37E-124 |
| SKCM | TF | PNPT1 | CEBPZ | 0.817357669 | 4.15E-115 |
| THYM | CGC | PNPT1 | PALB2 | 0.81578239 | 2.58E-30 |
| THYM | TSG | PNPT1 | PALB2 | 0.81578239 | 2.58E-30 |
| UCS | CGC | PNPT1 | PALB2 | 0.81578239 | 2.58E-30 |
| UCS | TSG | PNPT1 | PALB2 | 0.81578239 | 2.58E-30 |
| UVM | Cell metabolism gene | PNPT1 | FUT8 | 0.800300489 | 5.27E-19 |
| UVM | Cell metabolism gene | PNPT1 | NUP35 | 0.800346314 | 5.22E-19 |
| UVM | Cell metabolism gene | PNPT1 | TGS1 | 0.801520439 | 4.25E-19 |
| UVM | Cell metabolism gene | PNPT1 | TRDMT1 | 0.802355697 | 3.67E-19 |
| UVM | Cell metabolism gene | PNPT1 | GLS | 0.803451 | 3.02E-19 |
| UVM | Cell metabolism gene | PNPT1 | NANP | 0.803795034 | 2.84E-19 |
| UVM | Cell metabolism gene | PNPT1 | ME2 | 0.803891829 | 2.79E-19 |
| UVM | Cell metabolism gene | PNPT1 | SMG1 | 0.805106898 | 2.25E-19 |
| UVM | Cell metabolism gene | PNPT1 | PIK3C2A | 0.806182851 | 1.85E-19 |
| UVM | Cell metabolism gene | PNPT1 | PHAX | 0.806862918 | 1.64E-19 |
| UVM | Cell metabolism gene | PNPT1 | SEC23A | 0.807923709 | 1.35E-19 |
| UVM | Cell metabolism gene | PNPT1 | DLAT | 0.807925395 | 1.35E-19 |
| UVM | Cell metabolism gene | PNPT1 | PPP1CB | 0.809600039 | 9.91E-20 |
| UVM | Cell metabolism gene | PNPT1 | CNOT2 | 0.8096739 | 9.78E-20 |
| UVM | Cell metabolism gene | PNPT1 | SDHD | 0.810542344 | 8.33E-20 |
| UVM | Cell metabolism gene | PNPT1 | GPAM | 0.811252116 | 7.30E-20 |
| UVM | Cell metabolism gene | PNPT1 | PSME4 | 0.811883177 | 6.49E-20 |
| UVM | Cell metabolism gene | PNPT1 | POLR2B | 0.813794533 | 4.53E-20 |
| UVM | Cell metabolism gene | PNPT1 | ENOPH1 | 0.814853245 | 3.70E-20 |
| UVM | Cell metabolism gene | PNPT1 | GLUD2 | 0.815349029 | 3.37E-20 |
| UVM | Cell metabolism gene | PNPT1 | CNOT8 | 0.815583752 | 3.22E-20 |
| UVM | Cell metabolism gene | PNPT1 | GXYLT1 | 0.815917552 | 3.02E-20 |
| UVM | Cell metabolism gene | PNPT1 | CPOX | 0.816552455 | 2.68E-20 |
| UVM | Cell metabolism gene | PNPT1 | ALG13 | 0.817097211 | 2.41E-20 |
| UVM | Cell metabolism gene | PNPT1 | MED4 | 0.817245316 | 2.34E-20 |
| UVM | Cell metabolism gene | PNPT1 | MCEE | 0.817603836 | 2.18E-20 |
| UVM | Cell metabolism gene | PNPT1 | MED7 | 0.818579161 | 1.81E-20 |
| UVM | Cell metabolism gene | PNPT1 | GLUD1 | 0.818817892 | 1.73E-20 |
| UVM | Cell metabolism gene | PNPT1 | COL4A3BP | 0.819071902 | 1.64E-20 |
| UVM | Cell metabolism gene | PNPT1 | SEH1L | 0.821280686 | 1.06E-20 |
| UVM | Cell metabolism gene | PNPT1 | GCLC | 0.821342399 | 1.05E-20 |
| UVM | Cell metabolism gene | PNPT1 | IDI1 | 0.8217478 | 9.70E-21 |
| UVM | Cell metabolism gene | PNPT1 | PIK3C3 | 0.823790059 | 6.45E-21 |
| UVM | Cell metabolism gene | PNPT1 | ACADSB | 0.824836061 | 5.22E-21 |
| UVM | Cell metabolism gene | PNPT1 | BPNT1 | 0.828826659 | 2.30E-21 |
| UVM | Cell metabolism gene | PNPT1 | PIP5K1A | 0.829034454 | 2.21E-21 |
| UVM | Cell metabolism gene | PNPT1 | PDHX | 0.829833712 | 1.87E-21 |
| UVM | Cell metabolism gene | PNPT1 | DPM1 | 0.830527182 | 1.61E-21 |
| UVM | Cell metabolism gene | PNPT1 | MANEA | 0.831622423 | 1.28E-21 |
| UVM | Cell metabolism gene | PNPT1 | NUPL2 | 0.831980809 | 1.19E-21 |
| UVM | Cell metabolism gene | PNPT1 | CCT2 | 0.833106566 | 9.35E-22 |
| UVM | Cell metabolism gene | PNPT1 | PLA2G12A | 0.833249988 | 9.07E-22 |
| UVM | Cell metabolism gene | PNPT1 | CLOCK | 0.833614328 | 8.39E-22 |
| UVM | Cell metabolism gene | PNPT1 | NUDT12 | 0.834299034 | 7.24E-22 |
| UVM | Cell metabolism gene | PNPT1 | L2HGDH | 0.835654309 | 5.40E-22 |
| UVM | Cell metabolism gene | PNPT1 | CSGALNACT2 | 0.837421047 | 3.67E-22 |
| UVM | Cell metabolism gene | PNPT1 | MGAT2 | 0.838815618 | 2.70E-22 |
| UVM | Cell metabolism gene | PNPT1 | LYPLA1 | 0.838937235 | 2.63E-22 |
| UVM | Cell metabolism gene | PNPT1 | CDK8 | 0.840153643 | 2.00E-22 |
| UVM | Cell metabolism gene | PNPT1 | DCK | 0.843606856 | 9.16E-23 |
| UVM | Cell metabolism gene | PNPT1 | PIKFYVE | 0.845942365 | 5.34E-23 |
| UVM | Cell metabolism gene | PNPT1 | ACSL4 | 0.846877033 | 4.29E-23 |
| UVM | Cell metabolism gene | PNPT1 | SACM1L | 0.847398331 | 3.79E-23 |
| UVM | Cell metabolism gene | PNPT1 | AASDHPPT | 0.848010408 | 3.28E-23 |
| UVM | Cell metabolism gene | PNPT1 | ARFGEF2 | 0.850787979 | 1.69E-23 |
| UVM | Cell metabolism gene | PNPT1 | MTR | 0.851009686 | 1.60E-23 |
| UVM | Cell metabolism gene | PNPT1 | GRPEL2 | 0.852264034 | 1.18E-23 |
| UVM | Cell metabolism gene | PNPT1 | PI4K2B | 0.8524458 | 1.13E-23 |
| UVM | Cell metabolism gene | PNPT1 | GPD2 | 0.854869803 | 6.21E-24 |
| UVM | Cell metabolism gene | PNPT1 | RANBP2 | 0.856267397 | 4.38E-24 |
| UVM | Cell metabolism gene | PNPT1 | ALG10B | 0.856614027 | 4.01E-24 |
| UVM | Cell metabolism gene | PNPT1 | UGGT2 | 0.857685319 | 3.06E-24 |
| UVM | Cell metabolism gene | PNPT1 | TNPO1 | 0.860511656 | 1.48E-24 |
| UVM | Cell metabolism gene | PNPT1 | PSMD14 | 0.861963314 | 1.01E-24 |
| UVM | Cell metabolism gene | PNPT1 | NUP107 | 0.86266134 | 8.43E-25 |
| UVM | Cell metabolism gene | PNPT1 | HMGCS1 | 0.863239318 | 7.24E-25 |
| UVM | Cell metabolism gene | PNPT1 | FBXL3 | 0.863851108 | 6.15E-25 |
| UVM | Cell metabolism gene | PNPT1 | MINPP1 | 0.864645913 | 4.97E-25 |
| UVM | Cell metabolism gene | PNPT1 | PNPLA8 | 0.866228169 | 3.24E-25 |
| UVM | Cell metabolism gene | PNPT1 | RPE | 0.866816167 | 2.76E-25 |
| UVM | Cell metabolism gene | PNPT1 | NAMPT | 0.870736082 | 9.31E-26 |
| UVM | Cell metabolism gene | PNPT1 | PPAT | 0.872603622 | 5.48E-26 |
| UVM | Cell metabolism gene | PNPT1 | GNPDA2 | 0.874647901 | 3.03E-26 |
| UVM | Cell metabolism gene | PNPT1 | LCLAT1 | 0.875068525 | 2.68E-26 |
| UVM | Cell metabolism gene | PNPT1 | ETNK1 | 0.876062351 | 2.00E-26 |
| UVM | Cell metabolism gene | PNPT1 | MED17 | 0.8765687 | 1.73E-26 |
| UVM | Cell metabolism gene | PNPT1 | AGPS | 0.877704945 | 1.23E-26 |
| UVM | Cell metabolism gene | PNPT1 | PSMC6 | 0.877716519 | 1.23E-26 |
| UVM | Cell metabolism gene | PNPT1 | NUPL1 | 0.883701916 | 1.95E-27 |
| UVM | Cell metabolism gene | PNPT1 | FAR1 | 0.884585244 | 1.47E-27 |
| UVM | Cell metabolism gene | PNPT1 | DIS3 | 0.894172951 | 6.03E-29 |
| UVM | Cell metabolism gene | PNPT1 | PRKAA1 | 0.897890634 | 1.61E-29 |
| UVM | Cell metabolism gene | PNPT1 | EDEM3 | 0.900155137 | 7.00E-30 |
| UVM | Cell metabolism gene | PNPT1 | NUP50 | 0.903206272 | 2.22E-30 |
| UVM | Cell metabolism gene | PNPT1 | MTMR6 | 0.905041363 | 1.09E-30 |
| UVM | Cell metabolism gene | PNPT1 | XPO1 | 0.933367677 | 1.88E-36 |
| UVM | CGC | PNPT1 | HNRNPA2B1 | 0.802034168 | 3.88E-19 |
| UVM | CGC | PNPT1 | TRIM24 | 0.807473562 | 1.46E-19 |
| UVM | CGC | PNPT1 | BCLAF1 | 0.809788715 | 9.57E-20 |
| UVM | CGC | PNPT1 | SDHD | 0.810542344 | 8.33E-20 |
| UVM | CGC | PNPT1 | AFF4 | 0.810831473 | 7.89E-20 |
| UVM | CGC | PNPT1 | NBN | 0.811624692 | 6.81E-20 |
| UVM | CGC | PNPT1 | ABI1 | 0.811816082 | 6.57E-20 |
| UVM | CGC | PNPT1 | HSP90AA1 | 0.812290597 | 6.01E-20 |
| UVM | CGC | PNPT1 | SS18L1 | 0.812677987 | 5.59E-20 |
| UVM | CGC | PNPT1 | N4BP2 | 0.813662812 | 4.64E-20 |
| UVM | CGC | PNPT1 | ERCC4 | 0.815718976 | 3.14E-20 |
| UVM | CGC | PNPT1 | RB1 | 0.815930145 | 3.02E-20 |
| UVM | CGC | PNPT1 | RGPD3 | 0.816089293 | 2.92E-20 |
| UVM | CGC | PNPT1 | NFE2L2 | 0.816123467 | 2.91E-20 |
| UVM | CGC | PNPT1 | ARID2 | 0.816606434 | 2.65E-20 |
| UVM | CGC | PNPT1 | DDX10 | 0.820567286 | 1.22E-20 |
| UVM | CGC | PNPT1 | PTPN11 | 0.820748692 | 1.18E-20 |
| UVM | CGC | PNPT1 | ATF1 | 0.821137303 | 1.09E-20 |
| UVM | CGC | PNPT1 | TOP1 | 0.823767288 | 6.48E-21 |
| UVM | CGC | PNPT1 | PALB2 | 0.824155966 | 5.99E-21 |
| UVM | CGC | PNPT1 | ARHGAP5 | 0.825101818 | 4.95E-21 |
| UVM | CGC | PNPT1 | USP8 | 0.825364853 | 4.69E-21 |
| UVM | CGC | PNPT1 | RABEP1 | 0.8261998 | 3.96E-21 |
| UVM | CGC | PNPT1 | PHF6 | 0.826462895 | 3.75E-21 |
| UVM | CGC | PNPT1 | ITGAV | 0.827068988 | 3.31E-21 |
| UVM | CGC | PNPT1 | SMAD4 | 0.8287961 | 2.32E-21 |
| UVM | CGC | PNPT1 | DICER1 | 0.829229084 | 2.12E-21 |
| UVM | CGC | PNPT1 | BIRC6 | 0.833185247 | 9.20E-22 |
| UVM | CGC | PNPT1 | PWWP2A | 0.836637842 | 4.36E-22 |
| UVM | CGC | PNPT1 | STAG2 | 0.837258678 | 3.81E-22 |
| UVM | CGC | PNPT1 | EZH2 | 0.839628384 | 2.25E-22 |
| UVM | CGC | PNPT1 | RAD17 | 0.854531622 | 6.76E-24 |
| UVM | CGC | PNPT1 | KTN1 | 0.854674609 | 6.52E-24 |
| UVM | CGC | PNPT1 | RANBP2 | 0.856267397 | 4.38E-24 |
| UVM | CGC | PNPT1 | MSH2 | 0.858247902 | 2.65E-24 |
| UVM | CGC | PNPT1 | BRCA2 | 0.862820258 | 8.09E-25 |
| UVM | CGC | PNPT1 | EML4 | 0.863445629 | 6.85E-25 |
| UVM | CGC | PNPT1 | DDX5 | 0.864942827 | 4.59E-25 |
| UVM | CGC | PNPT1 | ZMYM2 | 0.865421548 | 4.03E-25 |
| UVM | CGC | PNPT1 | KRAS | 0.867894455 | 2.06E-25 |
| UVM | CGC | PNPT1 | KIF5B | 0.869498554 | 1.32E-25 |
| UVM | CGC | PNPT1 | BMPR1A | 0.871080605 | 8.45E-26 |
| UVM | CGC | PNPT1 | ETNK1 | 0.876062351 | 2.00E-26 |
| UVM | CGC | PNPT1 | CUL3 | 0.881373895 | 4.03E-27 |
| UVM | CGC | PNPT1 | ATM | 0.887196034 | 6.35E-28 |
| UVM | CGC | PNPT1 | CREB1 | 0.889082298 | 3.41E-28 |
| UVM | CGC | PNPT1 | POT1 | 0.891574316 | 1.48E-28 |
| UVM | CGC | PNPT1 | BAZ1A | 0.89321398 | 8.41E-29 |
| UVM | CGC | PNPT1 | SF3B1 | 0.896021054 | 3.14E-29 |
| UVM | CGC | PNPT1 | FBXO11 | 0.901317095 | 4.54E-30 |
| UVM | CGC | PNPT1 | CDC73 | 0.90770177 | 3.78E-31 |
| UVM | CGC | PNPT1 | SUZ12 | 0.909865726 | 1.56E-31 |
| UVM | CGC | PNPT1 | PMS1 | 0.92875591 | 2.34E-35 |
| UVM | CGC | PNPT1 | XPO1 | 0.933367677 | 1.88E-36 |
| UVM | Epifactor | PNPT1 | PHIP | 0.800053411 | 5.50E-19 |
| UVM | Epifactor | PNPT1 | RAD54B | 0.800593011 | 5.00E-19 |
| UVM | Epifactor | PNPT1 | TRIM24 | 0.807473562 | 1.46E-19 |
| UVM | Epifactor | PNPT1 | DNTTIP2 | 0.809848428 | 9.47E-20 |
| UVM | Epifactor | PNPT1 | SMARCAD1 | 0.810836045 | 7.88E-20 |
| UVM | Epifactor | PNPT1 | NBN | 0.811624692 | 6.81E-20 |
| UVM | Epifactor | PNPT1 | SS18L1 | 0.812677987 | 5.59E-20 |
| UVM | Epifactor | PNPT1 | BRMS1L | 0.815263735 | 3.43E-20 |
| UVM | Epifactor | PNPT1 | RB1 | 0.815930145 | 3.02E-20 |
| UVM | Epifactor | PNPT1 | ARID2 | 0.816606434 | 2.65E-20 |
| UVM | Epifactor | PNPT1 | CHUK | 0.817311729 | 2.31E-20 |
| UVM | Epifactor | PNPT1 | EPC1 | 0.819367013 | 1.55E-20 |
| UVM | Epifactor | PNPT1 | SMARCA5 | 0.823921242 | 6.28E-21 |
| UVM | Epifactor | PNPT1 | ANP32E | 0.826240268 | 3.92E-21 |
| UVM | Epifactor | PNPT1 | TADA1 | 0.826380072 | 3.81E-21 |
| UVM | Epifactor | PNPT1 | ARID4B | 0.82719051 | 3.23E-21 |
| UVM | Epifactor | PNPT1 | HCFC2 | 0.827364624 | 3.12E-21 |
| UVM | Epifactor | PNPT1 | TAF2 | 0.827512826 | 3.02E-21 |
| UVM | Epifactor | PNPT1 | MBTD1 | 0.830503104 | 1.62E-21 |
| UVM | Epifactor | PNPT1 | SIRT1 | 0.831053522 | 1.45E-21 |
| UVM | Epifactor | PNPT1 | CBX3 | 0.831233302 | 1.39E-21 |
| UVM | Epifactor | PNPT1 | SP100 | 0.831665718 | 1.27E-21 |
| UVM | Epifactor | PNPT1 | CLOCK | 0.833614328 | 8.39E-22 |
| UVM | Epifactor | PNPT1 | EID1 | 0.834190147 | 7.41E-22 |
| UVM | Epifactor | PNPT1 | BAZ2B | 0.834248083 | 7.32E-22 |
| UVM | Epifactor | PNPT1 | BRCC3 | 0.838388673 | 2.97E-22 |
| UVM | Epifactor | PNPT1 | SUPT7L | 0.839226814 | 2.46E-22 |
| UVM | Epifactor | PNPT1 | EZH2 | 0.839628384 | 2.25E-22 |
| UVM | Epifactor | PNPT1 | CHD1 | 0.839810864 | 2.16E-22 |
| UVM | Epifactor | PNPT1 | RMI1 | 0.841407982 | 1.51E-22 |
| UVM | Epifactor | PNPT1 | NIPBL | 0.841531586 | 1.47E-22 |
| UVM | Epifactor | PNPT1 | CTBP2 | 0.842250322 | 1.25E-22 |
| UVM | Epifactor | PNPT1 | PARG | 0.84282422 | 1.10E-22 |
| UVM | Epifactor | PNPT1 | RCOR3 | 0.842967013 | 1.06E-22 |
| UVM | Epifactor | PNPT1 | UHRF2 | 0.843105842 | 1.03E-22 |
| UVM | Epifactor | PNPT1 | MASTL | 0.845170146 | 6.39E-23 |
| UVM | Epifactor | PNPT1 | OGT | 0.84605865 | 5.19E-23 |
| UVM | Epifactor | PNPT1 | PHF20L1 | 0.849363251 | 2.38E-23 |
| UVM | Epifactor | PNPT1 | ARID4A | 0.850737128 | 1.71E-23 |
| UVM | Epifactor | PNPT1 | ACTR6 | 0.8511449 | 1.55E-23 |
| UVM | Epifactor | PNPT1 | YY1 | 0.85324584 | 9.29E-24 |
| UVM | Epifactor | PNPT1 | INO80D | 0.854304951 | 7.15E-24 |
| UVM | Epifactor | PNPT1 | BRWD1 | 0.858670173 | 2.38E-24 |
| UVM | Epifactor | PNPT1 | SMEK1 | 0.858787369 | 2.31E-24 |
| UVM | Epifactor | PNPT1 | JMJD1C | 0.859053505 | 2.16E-24 |
| UVM | Epifactor | PNPT1 | CHD9 | 0.859563014 | 1.89E-24 |
| UVM | Epifactor | PNPT1 | TAF7 | 0.860487176 | 1.49E-24 |
| UVM | Epifactor | PNPT1 | CDK17 | 0.862307818 | 9.26E-25 |
| UVM | Epifactor | PNPT1 | BRCA2 | 0.862820258 | 8.09E-25 |
| UVM | Epifactor | PNPT1 | ZMYM2 | 0.865421548 | 4.03E-25 |
| UVM | Epifactor | PNPT1 | RLIM | 0.866222083 | 3.25E-25 |
| UVM | Epifactor | PNPT1 | ZRANB3 | 0.867805256 | 2.11E-25 |
| UVM | Epifactor | PNPT1 | AEBP2 | 0.868529131 | 1.73E-25 |
| UVM | Epifactor | PNPT1 | TDG | 0.868746883 | 1.62E-25 |
| UVM | Epifactor | PNPT1 | ATF2 | 0.871596406 | 7.30E-26 |
| UVM | Epifactor | PNPT1 | HAT1 | 0.875377181 | 2.45E-26 |
| UVM | Epifactor | PNPT1 | FAM175B | 0.876129078 | 1.96E-26 |
| UVM | Epifactor | PNPT1 | HMGB1 | 0.878602194 | 9.40E-27 |
| UVM | Epifactor | PNPT1 | USP15 | 0.880612579 | 5.10E-27 |
| UVM | Epifactor | PNPT1 | CUL3 | 0.881373895 | 4.03E-27 |
| UVM | Epifactor | PNPT1 | EPC2 | 0.882308435 | 3.02E-27 |
| UVM | Epifactor | PNPT1 | CUL5 | 0.882810793 | 2.58E-27 |
| UVM | Epifactor | PNPT1 | ATM | 0.887196034 | 6.35E-28 |
| UVM | Epifactor | PNPT1 | ATAD2B | 0.888445255 | 4.21E-28 |
| UVM | Epifactor | PNPT1 | YEATS4 | 0.888907451 | 3.62E-28 |
| UVM | Epifactor | PNPT1 | NSL1 | 0.889917496 | 2.58E-28 |
| UVM | Epifactor | PNPT1 | CUL2 | 0.890841602 | 1.89E-28 |
| UVM | Epifactor | PNPT1 | BAZ1A | 0.89321398 | 8.41E-29 |
| UVM | Epifactor | PNPT1 | TLK1 | 0.894127126 | 6.13E-29 |
| UVM | Epifactor | PNPT1 | SF3B1 | 0.896021054 | 3.14E-29 |
| UVM | Epifactor | PNPT1 | PRKAA1 | 0.897890634 | 1.61E-29 |
| UVM | Epifactor | PNPT1 | PCGF6 | 0.897989696 | 1.55E-29 |
| UVM | Epifactor | PNPT1 | UCHL5 | 0.902942237 | 2.45E-30 |
| UVM | Epifactor | PNPT1 | CDC73 | 0.90770177 | 3.78E-31 |
| UVM | Epifactor | PNPT1 | SUZ12 | 0.909865726 | 1.56E-31 |
| UVM | Epifactor | PNPT1 | SMEK2 | 0.924661575 | 1.91E-34 |
| UVM | IUPHAR | PNPT1 | PHIP | 0.800053411 | 5.50E-19 |
| UVM | IUPHAR | PNPT1 | SCYL2 | 0.800111605 | 5.44E-19 |
| UVM | IUPHAR | PNPT1 | MFN1 | 0.802509142 | 3.57E-19 |
| UVM | IUPHAR | PNPT1 | SLC35F5 | 0.803039167 | 3.25E-19 |
| UVM | IUPHAR | PNPT1 | ATP6V1C1 | 0.803188202 | 3.16E-19 |
| UVM | IUPHAR | PNPT1 | GLS | 0.803451 | 3.02E-19 |
| UVM | IUPHAR | PNPT1 | SMG1 | 0.805106898 | 2.25E-19 |
| UVM | IUPHAR | PNPT1 | EGLN1 | 0.805322519 | 2.16E-19 |
| UVM | IUPHAR | PNPT1 | PIK3C2A | 0.806182851 | 1.85E-19 |
| UVM | IUPHAR | PNPT1 | NR3C1 | 0.806737685 | 1.67E-19 |
| UVM | IUPHAR | PNPT1 | SLC26A2 | 0.8072207 | 1.53E-19 |
| UVM | IUPHAR | PNPT1 | TRIM24 | 0.807473562 | 1.46E-19 |
| UVM | IUPHAR | PNPT1 | NEK1 | 0.812288635 | 6.01E-20 |
| UVM | IUPHAR | PNPT1 | HSP90AA1 | 0.812290597 | 6.01E-20 |
| UVM | IUPHAR | PNPT1 | TRPC1 | 0.812539489 | 5.74E-20 |
| UVM | IUPHAR | PNPT1 | ATP11C | 0.813091027 | 5.17E-20 |
| UVM | IUPHAR | PNPT1 | IRAK4 | 0.815903442 | 3.03E-20 |
| UVM | IUPHAR | PNPT1 | SLK | 0.815903737 | 3.03E-20 |
| UVM | IUPHAR | PNPT1 | NFE2L2 | 0.816123467 | 2.91E-20 |
| UVM | IUPHAR | PNPT1 | CYP20A1 | 0.816760728 | 2.57E-20 |
| UVM | IUPHAR | PNPT1 | CHUK | 0.817311729 | 2.31E-20 |
| UVM | IUPHAR | PNPT1 | DYRK1A | 0.820447582 | 1.25E-20 |
| UVM | IUPHAR | PNPT1 | IDI1 | 0.8217478 | 9.70E-21 |
| UVM | IUPHAR | PNPT1 | CYP2R1 | 0.822857976 | 7.77E-21 |
| UVM | IUPHAR | PNPT1 | TOP1 | 0.823767288 | 6.48E-21 |
| UVM | IUPHAR | PNPT1 | PIK3C3 | 0.823790059 | 6.45E-21 |
| UVM | IUPHAR | PNPT1 | SLC30A9 | 0.825043147 | 5.01E-21 |
| UVM | IUPHAR | PNPT1 | SLC37A3 | 0.826796669 | 3.50E-21 |
| UVM | IUPHAR | PNPT1 | ITGAV | 0.827068988 | 3.31E-21 |
| UVM | IUPHAR | PNPT1 | MAGT1 | 0.827417661 | 3.08E-21 |
| UVM | IUPHAR | PNPT1 | PREPL | 0.827473328 | 3.05E-21 |
| UVM | IUPHAR | PNPT1 | PIP5K1A | 0.829034454 | 2.21E-21 |
| UVM | IUPHAR | PNPT1 | PRPF4B | 0.829608869 | 1.96E-21 |
| UVM | IUPHAR | PNPT1 | STK17A | 0.830588587 | 1.59E-21 |
| UVM | IUPHAR | PNPT1 | SIRT1 | 0.831053522 | 1.45E-21 |
| UVM | IUPHAR | PNPT1 | CSNK1A1 | 0.831220672 | 1.40E-21 |
| UVM | IUPHAR | PNPT1 | SP100 | 0.831665718 | 1.27E-21 |
| UVM | IUPHAR | PNPT1 | BIRC6 | 0.833185247 | 9.20E-22 |
| UVM | IUPHAR | PNPT1 | PLA2G12A | 0.833249988 | 9.07E-22 |
| UVM | IUPHAR | PNPT1 | CLOCK | 0.833614328 | 8.39E-22 |
| UVM | IUPHAR | PNPT1 | PLK4 | 0.833643766 | 8.34E-22 |
| UVM | IUPHAR | PNPT1 | BAZ2B | 0.834248083 | 7.32E-22 |
| UVM | IUPHAR | PNPT1 | STK38L | 0.836561203 | 4.43E-22 |
| UVM | IUPHAR | PNPT1 | SLC4A7 | 0.83691189 | 4.11E-22 |
| UVM | IUPHAR | PNPT1 | MAPK6 | 0.837488403 | 3.62E-22 |
| UVM | IUPHAR | PNPT1 | EZH2 | 0.839628384 | 2.25E-22 |
| UVM | IUPHAR | PNPT1 | CDK8 | 0.840153643 | 2.00E-22 |
| UVM | IUPHAR | PNPT1 | SLC25A46 | 0.843305704 | 9.81E-23 |
| UVM | IUPHAR | PNPT1 | MASTL | 0.845170146 | 6.39E-23 |
| UVM | IUPHAR | PNPT1 | PIKFYVE | 0.845942365 | 5.34E-23 |
| UVM | IUPHAR | PNPT1 | BIRC2 | 0.847097168 | 4.07E-23 |
| UVM | IUPHAR | PNPT1 | RPS6KC1 | 0.847901564 | 3.37E-23 |
| UVM | IUPHAR | PNPT1 | MTR | 0.851009686 | 1.60E-23 |
| UVM | IUPHAR | PNPT1 | ABCB10 | 0.851241356 | 1.51E-23 |
| UVM | IUPHAR | PNPT1 | PI4K2B | 0.8524458 | 1.13E-23 |
| UVM | IUPHAR | PNPT1 | VRK2 | 0.856356868 | 4.28E-24 |
| UVM | IUPHAR | PNPT1 | NR2C1 | 0.856864536 | 3.77E-24 |
| UVM | IUPHAR | PNPT1 | BRWD1 | 0.858670173 | 2.38E-24 |
| UVM | IUPHAR | PNPT1 | XIAP | 0.858835572 | 2.28E-24 |
| UVM | IUPHAR | PNPT1 | JMJD1C | 0.859053505 | 2.16E-24 |
| UVM | IUPHAR | PNPT1 | NAPEPLD | 0.860807268 | 1.37E-24 |
| UVM | IUPHAR | PNPT1 | MAP3K2 | 0.861443563 | 1.16E-24 |
| UVM | IUPHAR | PNPT1 | PSMD14 | 0.861963314 | 1.01E-24 |
| UVM | IUPHAR | PNPT1 | TRPM7 | 0.862036729 | 9.94E-25 |
| UVM | IUPHAR | PNPT1 | CDK17 | 0.862307818 | 9.26E-25 |
| UVM | IUPHAR | PNPT1 | USP14 | 0.862981684 | 7.75E-25 |
| UVM | IUPHAR | PNPT1 | NEK7 | 0.863108138 | 7.49E-25 |
| UVM | IUPHAR | PNPT1 | BMPR2 | 0.863230236 | 7.25E-25 |
| UVM | IUPHAR | PNPT1 | HMGCS1 | 0.863239318 | 7.24E-25 |
| UVM | IUPHAR | PNPT1 | SLC39A10 | 0.864419559 | 5.28E-25 |
| UVM | IUPHAR | PNPT1 | RIOK3 | 0.866542832 | 2.98E-25 |
| UVM | IUPHAR | PNPT1 | KRAS | 0.867894455 | 2.06E-25 |
| UVM | IUPHAR | PNPT1 | ATP6V0A2 | 0.869981662 | 1.15E-25 |
| UVM | IUPHAR | PNPT1 | BMPR1A | 0.871080605 | 8.45E-26 |
| UVM | IUPHAR | PNPT1 | TNKS2 | 0.871678004 | 7.13E-26 |
| UVM | IUPHAR | PNPT1 | PPAT | 0.872603622 | 5.48E-26 |
| UVM | IUPHAR | PNPT1 | ADAM17 | 0.874688586 | 3.00E-26 |
| UVM | IUPHAR | PNPT1 | TBK1 | 0.874799703 | 2.90E-26 |
| UVM | IUPHAR | PNPT1 | CSNK1G3 | 0.874927969 | 2.80E-26 |
| UVM | IUPHAR | PNPT1 | HAT1 | 0.875377181 | 2.45E-26 |
| UVM | IUPHAR | PNPT1 | MAP4K3 | 0.875911284 | 2.10E-26 |
| UVM | IUPHAR | PNPT1 | ATM | 0.887196034 | 6.35E-28 |
| UVM | IUPHAR | PNPT1 | ATAD2B | 0.888445255 | 4.21E-28 |
| UVM | IUPHAR | PNPT1 | BAZ1A | 0.89321398 | 8.41E-29 |
| UVM | IUPHAR | PNPT1 | TLK1 | 0.894127126 | 6.13E-29 |
| UVM | IUPHAR | PNPT1 | PRKAA1 | 0.897890634 | 1.61E-29 |
| UVM | IUPHAR | PNPT1 | FBXO11 | 0.901317095 | 4.54E-30 |
| UVM | IUPHAR | PNPT1 | PRMT3 | 0.902258367 | 3.18E-30 |
| UVM | IUPHAR | PNPT1 | XPO1 | 0.933367677 | 1.88E-36 |
| UVM | Kinase | PNPT1 | SCYL2 | 0.800111605 | 5.44E-19 |
| UVM | Kinase | PNPT1 | SMG1 | 0.805106898 | 2.25E-19 |
| UVM | Kinase | PNPT1 | TRIM24 | 0.807473562 | 1.46E-19 |
| UVM | Kinase | PNPT1 | NEK1 | 0.812288635 | 6.01E-20 |
| UVM | Kinase | PNPT1 | PAN3 | 0.814507308 | 3.96E-20 |
| UVM | Kinase | PNPT1 | IRAK4 | 0.815903442 | 3.03E-20 |
| UVM | Kinase | PNPT1 | SLK | 0.815903737 | 3.03E-20 |
| UVM | Kinase | PNPT1 | CHUK | 0.817311729 | 2.31E-20 |
| UVM | Kinase | PNPT1 | COL4A3BP | 0.819071902 | 1.64E-20 |
| UVM | Kinase | PNPT1 | DYRK1A | 0.820447582 | 1.25E-20 |
| UVM | Kinase | PNPT1 | PRPF4B | 0.829608869 | 1.96E-21 |
| UVM | Kinase | PNPT1 | STK17A | 0.830588587 | 1.59E-21 |
| UVM | Kinase | PNPT1 | CSNK1A1 | 0.831220672 | 1.40E-21 |
| UVM | Kinase | PNPT1 | PLK4 | 0.833643766 | 8.34E-22 |
| UVM | Kinase | PNPT1 | STK38L | 0.836561203 | 4.43E-22 |
| UVM | Kinase | PNPT1 | MAPK6 | 0.837488403 | 3.62E-22 |
| UVM | Kinase | PNPT1 | CDK8 | 0.840153643 | 2.00E-22 |
| UVM | Kinase | PNPT1 | MASTL | 0.845170146 | 6.39E-23 |
| UVM | Kinase | PNPT1 | RPS6KC1 | 0.847901564 | 3.37E-23 |
| UVM | Kinase | PNPT1 | VRK2 | 0.856356868 | 4.28E-24 |
| UVM | Kinase | PNPT1 | MAP3K2 | 0.861443563 | 1.16E-24 |
| UVM | Kinase | PNPT1 | TRPM7 | 0.862036729 | 9.94E-25 |
| UVM | Kinase | PNPT1 | CDK17 | 0.862307818 | 9.26E-25 |
| UVM | Kinase | PNPT1 | NEK7 | 0.863108138 | 7.49E-25 |
| UVM | Kinase | PNPT1 | BMPR2 | 0.863230236 | 7.25E-25 |
| UVM | Kinase | PNPT1 | RIOK3 | 0.866542832 | 2.98E-25 |
| UVM | Kinase | PNPT1 | BMPR1A | 0.871080605 | 8.45E-26 |
| UVM | Kinase | PNPT1 | TBK1 | 0.874799703 | 2.90E-26 |
| UVM | Kinase | PNPT1 | CSNK1G3 | 0.874927969 | 2.80E-26 |
| UVM | Kinase | PNPT1 | MAP4K3 | 0.875911284 | 2.10E-26 |
| UVM | Kinase | PNPT1 | ATM | 0.887196034 | 6.35E-28 |
| UVM | Kinase | PNPT1 | BAZ1A | 0.89321398 | 8.41E-29 |
| UVM | Kinase | PNPT1 | TLK1 | 0.894127126 | 6.13E-29 |
| UVM | Kinase | PNPT1 | PRKAA1 | 0.897890634 | 1.61E-29 |
| UVM | TF | PNPT1 | ZNF606 | 0.801747654 | 4.08E-19 |
| UVM | TF | PNPT1 | ZBTB11 | 0.801951339 | 3.94E-19 |
| UVM | TF | PNPT1 | ZNF160 | 0.802653492 | 3.48E-19 |
| UVM | TF | PNPT1 | ZNF572 | 0.802963588 | 3.29E-19 |
| UVM | TF | PNPT1 | ZNF480 | 0.803191534 | 3.16E-19 |
| UVM | TF | PNPT1 | ZNF625 | 0.803882689 | 2.80E-19 |
| UVM | TF | PNPT1 | TERF1 | 0.803940357 | 2.77E-19 |
| UVM | TF | PNPT1 | ZNF143 | 0.805582146 | 2.06E-19 |
| UVM | TF | PNPT1 | NR3C1 | 0.806737685 | 1.67E-19 |
| UVM | TF | PNPT1 | ZNF83 | 0.808099951 | 1.31E-19 |
| UVM | TF | PNPT1 | ZNF230 | 0.808328209 | 1.25E-19 |
| UVM | TF | PNPT1 | MYNN | 0.808640982 | 1.18E-19 |
| UVM | TF | PNPT1 | ZNF678 | 0.808823997 | 1.14E-19 |
| UVM | TF | PNPT1 | ZNF326 | 0.809609551 | 9.89E-20 |
| UVM | TF | PNPT1 | ZNF557 | 0.809701306 | 9.73E-20 |
| UVM | TF | PNPT1 | ZNF420 | 0.80995716 | 9.28E-20 |
| UVM | TF | PNPT1 | ZC3H8 | 0.810242252 | 8.80E-20 |
| UVM | TF | PNPT1 | ZKSCAN5 | 0.810835704 | 7.88E-20 |
| UVM | TF | PNPT1 | ZFX | 0.811178032 | 7.40E-20 |
| UVM | TF | PNPT1 | ZNF799 | 0.811359892 | 7.15E-20 |
| UVM | TF | PNPT1 | SP4 | 0.81147856 | 7.00E-20 |
| UVM | TF | PNPT1 | ZNF714 | 0.811897455 | 6.47E-20 |
| UVM | TF | PNPT1 | ZNF280D | 0.812418705 | 5.87E-20 |
| UVM | TF | PNPT1 | ZNF141 | 0.81302609 | 5.23E-20 |
| UVM | TF | PNPT1 | ZNF148 | 0.813626264 | 4.67E-20 |
| UVM | TF | PNPT1 | ZNF23 | 0.814380609 | 4.05E-20 |
| UVM | TF | PNPT1 | ZFP14 | 0.814531389 | 3.94E-20 |
| UVM | TF | PNPT1 | ZNF354B | 0.814682308 | 3.83E-20 |
| UVM | TF | PNPT1 | NFE2L2 | 0.816123467 | 2.91E-20 |
| UVM | TF | PNPT1 | ARID2 | 0.816606434 | 2.65E-20 |
| UVM | TF | PNPT1 | ZNF565 | 0.816961511 | 2.47E-20 |
| UVM | TF | PNPT1 | ZNF320 | 0.817188906 | 2.37E-20 |
| UVM | TF | PNPT1 | ZNF461 | 0.817602089 | 2.19E-20 |
| UVM | TF | PNPT1 | ELF2 | 0.818306665 | 1.91E-20 |
| UVM | TF | PNPT1 | ZNF75D | 0.818793323 | 1.73E-20 |
| UVM | TF | PNPT1 | ZNF107 | 0.818899547 | 1.70E-20 |
| UVM | TF | PNPT1 | ZNF397 | 0.819061279 | 1.65E-20 |
| UVM | TF | PNPT1 | ZNF680 | 0.82044364 | 1.25E-20 |
| UVM | TF | PNPT1 | ATF1 | 0.821137303 | 1.09E-20 |
| UVM | TF | PNPT1 | ADNP2 | 0.821159781 | 1.09E-20 |
| UVM | TF | PNPT1 | ZNF443 | 0.822395384 | 8.52E-21 |
| UVM | TF | PNPT1 | ZNF260 | 0.822488443 | 8.37E-21 |
| UVM | TF | PNPT1 | ZNF611 | 0.822611297 | 8.16E-21 |
| UVM | TF | PNPT1 | ZNF101 | 0.822746095 | 7.95E-21 |
| UVM | TF | PNPT1 | ZNF569 | 0.823267561 | 7.16E-21 |
| UVM | TF | PNPT1 | ZNF41 | 0.823292675 | 7.12E-21 |
| UVM | TF | PNPT1 | ZNF468 | 0.823679865 | 6.59E-21 |
| UVM | TF | PNPT1 | ZNF44 | 0.82379366 | 6.44E-21 |
| UVM | TF | PNPT1 | ZNF223 | 0.825396024 | 4.66E-21 |
| UVM | TF | PNPT1 | ZBED5 | 0.82595283 | 4.16E-21 |
| UVM | TF | PNPT1 | THAP9 | 0.826024468 | 4.10E-21 |
| UVM | TF | PNPT1 | GABPA | 0.826144672 | 4.00E-21 |
| UVM | TF | PNPT1 | ZNF17 | 0.826768728 | 3.52E-21 |
| UVM | TF | PNPT1 | ZNF721 | 0.826909177 | 3.42E-21 |
| UVM | TF | PNPT1 | ZNF37A | 0.827985536 | 2.74E-21 |
| UVM | TF | PNPT1 | SMAD4 | 0.8287961 | 2.32E-21 |
| UVM | TF | PNPT1 | ZNF780B | 0.829179215 | 2.14E-21 |
| UVM | TF | PNPT1 | HDX | 0.829207064 | 2.13E-21 |
| UVM | TF | PNPT1 | ZNF268 | 0.829627252 | 1.95E-21 |
| UVM | TF | PNPT1 | ZNF555 | 0.83005293 | 1.78E-21 |
| UVM | TF | PNPT1 | ZNF14 | 0.830565796 | 1.60E-21 |
| UVM | TF | PNPT1 | ZNF226 | 0.83057653 | 1.60E-21 |
| UVM | TF | PNPT1 | ZNF100 | 0.830894357 | 1.49E-21 |
| UVM | TF | PNPT1 | ZNF558 | 0.830900758 | 1.49E-21 |
| UVM | TF | PNPT1 | ZNF484 | 0.831193486 | 1.40E-21 |
| UVM | TF | PNPT1 | ZNF658 | 0.831537266 | 1.31E-21 |
| UVM | TF | PNPT1 | SP100 | 0.831665718 | 1.27E-21 |
| UVM | TF | PNPT1 | ZNF546 | 0.831919814 | 1.20E-21 |
| UVM | TF | PNPT1 | ELK3 | 0.832069636 | 1.17E-21 |
| UVM | TF | PNPT1 | ZNF248 | 0.833371657 | 8.84E-22 |
| UVM | TF | PNPT1 | CLOCK | 0.833614328 | 8.39E-22 |
| UVM | TF | PNPT1 | TMF1 | 0.834209023 | 7.38E-22 |
| UVM | TF | PNPT1 | BAZ2B | 0.834248083 | 7.32E-22 |
| UVM | TF | PNPT1 | ZNF281 | 0.834414485 | 7.06E-22 |
| UVM | TF | PNPT1 | ZNF761 | 0.834827801 | 6.46E-22 |
| UVM | TF | PNPT1 | ZNF845 | 0.835067557 | 6.14E-22 |
| UVM | TF | PNPT1 | ZNF225 | 0.835167471 | 6.00E-22 |
| UVM | TF | PNPT1 | ZNF33A | 0.835439979 | 5.66E-22 |
| UVM | TF | PNPT1 | ZNF347 | 0.835859131 | 5.17E-22 |
| UVM | TF | PNPT1 | ZNF302 | 0.835993302 | 5.02E-22 |
| UVM | TF | PNPT1 | ZNF24 | 0.837200671 | 3.85E-22 |
| UVM | TF | PNPT1 | ZNF81 | 0.837304109 | 3.77E-22 |
| UVM | TF | PNPT1 | ZNF84 | 0.837310097 | 3.76E-22 |
| UVM | TF | PNPT1 | ZNF440 | 0.838954483 | 2.62E-22 |
| UVM | TF | PNPT1 | PRDM10 | 0.839433893 | 2.35E-22 |
| UVM | TF | PNPT1 | ZBTB6 | 0.840514138 | 1.85E-22 |
| UVM | TF | PNPT1 | ZNF566 | 0.842023566 | 1.31E-22 |
| UVM | TF | PNPT1 | ZNF780A | 0.842236495 | 1.25E-22 |
| UVM | TF | PNPT1 | ZNF25 | 0.842322903 | 1.23E-22 |
| UVM | TF | PNPT1 | ZNF567 | 0.843533519 | 9.31E-23 |
| UVM | TF | PNPT1 | ZNF10 | 0.843902301 | 8.56E-23 |
| UVM | TF | PNPT1 | ZNF254 | 0.844489077 | 7.47E-23 |
| UVM | TF | PNPT1 | ZNF45 | 0.845079891 | 6.52E-23 |
| UVM | TF | PNPT1 | ZBTB41 | 0.845489153 | 5.93E-23 |
| UVM | TF | PNPT1 | THAP6 | 0.847401762 | 3.79E-23 |
| UVM | TF | PNPT1 | ZNF146 | 0.847718787 | 3.52E-23 |
| UVM | TF | PNPT1 | ZNF432 | 0.847748576 | 3.49E-23 |
| UVM | TF | PNPT1 | LIN54 | 0.84792514 | 3.35E-23 |
| UVM | TF | PNPT1 | JRKL | 0.847989298 | 3.30E-23 |
| UVM | TF | PNPT1 | ZNF451 | 0.848604937 | 2.85E-23 |
| UVM | TF | PNPT1 | ZNF585B | 0.849561432 | 2.27E-23 |
| UVM | TF | PNPT1 | ZNF267 | 0.849879594 | 2.10E-23 |
| UVM | TF | PNPT1 | ZNF12 | 0.850000933 | 2.04E-23 |
| UVM | TF | PNPT1 | ZNF383 | 0.850053535 | 2.02E-23 |
| UVM | TF | PNPT1 | ZNF222 | 0.850525725 | 1.80E-23 |
| UVM | TF | PNPT1 | YY1 | 0.85324584 | 9.29E-24 |
| UVM | TF | PNPT1 | ZNF708 | 0.853883947 | 7.93E-24 |
| UVM | TF | PNPT1 | ZNF182 | 0.854165275 | 7.40E-24 |
| UVM | TF | PNPT1 | ZNF92 | 0.855150904 | 5.79E-24 |
| UVM | TF | PNPT1 | RBAK | 0.855517618 | 5.29E-24 |
| UVM | TF | PNPT1 | ZNF624 | 0.855566831 | 5.22E-24 |
| UVM | TF | PNPT1 | ZNF791 | 0.856382068 | 4.26E-24 |
| UVM | TF | PNPT1 | NR2C1 | 0.856864536 | 3.77E-24 |
| UVM | TF | PNPT1 | ZNF140 | 0.858651846 | 2.39E-24 |
| UVM | TF | PNPT1 | NFXL1 | 0.859139997 | 2.11E-24 |
| UVM | TF | PNPT1 | ZNF431 | 0.859283838 | 2.03E-24 |
| UVM | TF | PNPT1 | ZNF674 | 0.860042321 | 1.67E-24 |
| UVM | TF | PNPT1 | IKZF5 | 0.860535746 | 1.47E-24 |
| UVM | TF | PNPT1 | AHCTF1 | 0.86062211 | 1.44E-24 |
| UVM | TF | PNPT1 | ZNF180 | 0.860797967 | 1.37E-24 |
| UVM | TF | PNPT1 | GPBP1 | 0.861518514 | 1.14E-24 |
| UVM | TF | PNPT1 | ZNF527 | 0.861594975 | 1.12E-24 |
| UVM | TF | PNPT1 | MYBL1 | 0.861661544 | 1.10E-24 |
| UVM | TF | PNPT1 | DMTF1 | 0.861926349 | 1.02E-24 |
| UVM | TF | PNPT1 | ZNF234 | 0.862317418 | 9.23E-25 |
| UVM | TF | PNPT1 | ZNF510 | 0.864149666 | 5.68E-25 |
| UVM | TF | PNPT1 | ZNF136 | 0.864189744 | 5.62E-25 |
| UVM | TF | PNPT1 | TOPORS | 0.864796198 | 4.77E-25 |
| UVM | TF | PNPT1 | PURB | 0.864863758 | 4.69E-25 |
| UVM | TF | PNPT1 | MEF2A | 0.865762067 | 3.68E-25 |
| UVM | TF | PNPT1 | ZNF28 | 0.865940185 | 3.51E-25 |
| UVM | TF | PNPT1 | AEBP2 | 0.868529131 | 1.73E-25 |
| UVM | TF | PNPT1 | ELF1 | 0.869101693 | 1.47E-25 |
| UVM | TF | PNPT1 | ZNF518A | 0.870279628 | 1.06E-25 |
| UVM | TF | PNPT1 | ATF2 | 0.871596406 | 7.30E-26 |
| UVM | TF | PNPT1 | ZNF131 | 0.871695477 | 7.10E-26 |
| UVM | TF | PNPT1 | CREBZF | 0.872108958 | 6.31E-26 |
| UVM | TF | PNPT1 | ZNF138 | 0.873021198 | 4.86E-26 |
| UVM | TF | PNPT1 | SMAD5 | 0.873573634 | 4.14E-26 |
| UVM | TF | PNPT1 | ZNF800 | 0.875148085 | 2.62E-26 |
| UVM | TF | PNPT1 | ZNF430 | 0.876042709 | 2.02E-26 |
| UVM | TF | PNPT1 | ZNF700 | 0.876368028 | 1.83E-26 |
| UVM | TF | PNPT1 | ZNF43 | 0.876463591 | 1.78E-26 |
| UVM | TF | PNPT1 | ZNF195 | 0.877109074 | 1.47E-26 |
| UVM | TF | PNPT1 | ZNF701 | 0.878500165 | 9.69E-27 |
| UVM | TF | PNPT1 | ZNF449 | 0.878732258 | 9.03E-27 |
| UVM | TF | PNPT1 | ZNF26 | 0.879733429 | 6.67E-27 |
| UVM | TF | PNPT1 | THAP5 | 0.879750152 | 6.63E-27 |
| UVM | TF | PNPT1 | ZBTB1 | 0.879821471 | 6.49E-27 |
| UVM | TF | PNPT1 | FOXN2 | 0.882178685 | 3.14E-27 |
| UVM | TF | PNPT1 | BACH1 | 0.884005577 | 1.77E-27 |
| UVM | TF | PNPT1 | ZNF181 | 0.885537421 | 1.09E-27 |
| UVM | TF | PNPT1 | SP3 | 0.888164249 | 4.62E-28 |
| UVM | TF | PNPT1 | CREB1 | 0.889082298 | 3.41E-28 |
| UVM | TF | PNPT1 | PCGF6 | 0.897989696 | 1.55E-29 |
| UVM | TF | PNPT1 | ZNF441 | 0.898531983 | 1.27E-29 |
| UVM | TF | PNPT1 | ZNF675 | 0.900470423 | 6.23E-30 |
| UVM | TF | PNPT1 | PRMT3 | 0.902258367 | 3.18E-30 |
| UVM | TF | PNPT1 | CEBPZ | 0.914631803 | 2.06E-32 |
| UVM | TSG | PNPT1 | EGLN1 | 0.805322519 | 2.16E-19 |
| UVM | TSG | PNPT1 | TRIM24 | 0.807473562 | 1.46E-19 |
| UVM | TSG | PNPT1 | SDHD | 0.810542344 | 8.33E-20 |
| UVM | TSG | PNPT1 | NBN | 0.811624692 | 6.81E-20 |
| UVM | TSG | PNPT1 | RB1 | 0.815930145 | 3.02E-20 |
| UVM | TSG | PNPT1 | IFT88 | 0.816025358 | 2.96E-20 |
| UVM | TSG | PNPT1 | ARID2 | 0.816606434 | 2.65E-20 |
| UVM | TSG | PNPT1 | CHUK | 0.817311729 | 2.31E-20 |
| UVM | TSG | PNPT1 | PTPN12 | 0.817444848 | 2.25E-20 |
| UVM | TSG | PNPT1 | PTPN11 | 0.820748692 | 1.18E-20 |
| UVM | TSG | PNPT1 | PALB2 | 0.824155966 | 5.99E-21 |
| UVM | TSG | PNPT1 | PHF6 | 0.826462895 | 3.75E-21 |
| UVM | TSG | PNPT1 | ITGAV | 0.827068988 | 3.31E-21 |
| UVM | TSG | PNPT1 | SMAD4 | 0.8287961 | 2.32E-21 |
| UVM | TSG | PNPT1 | DICER1 | 0.829229084 | 2.12E-21 |
| UVM | TSG | PNPT1 | SIRT1 | 0.831053522 | 1.45E-21 |
| UVM | TSG | PNPT1 | CSNK1A1 | 0.831220672 | 1.40E-21 |
| UVM | TSG | PNPT1 | SP100 | 0.831665718 | 1.27E-21 |
| UVM | TSG | PNPT1 | CCAR1 | 0.832483769 | 1.07E-21 |
| UVM | TSG | PNPT1 | PPM1A | 0.832599486 | 1.04E-21 |
| UVM | TSG | PNPT1 | VEZT | 0.832868067 | 9.84E-22 |
| UVM | TSG | PNPT1 | PDS5B | 0.833731471 | 8.18E-22 |
| UVM | TSG | PNPT1 | RB1CC1 | 0.835770304 | 5.27E-22 |
| UVM | TSG | PNPT1 | EZH2 | 0.839628384 | 2.25E-22 |
| UVM | TSG | PNPT1 | CHD1 | 0.839810864 | 2.16E-22 |
| UVM | TSG | PNPT1 | UHRF2 | 0.843105842 | 1.03E-22 |
| UVM | TSG | PNPT1 | NEDD4 | 0.844035624 | 8.30E-23 |
| UVM | TSG | PNPT1 | RBBP8 | 0.845405687 | 6.05E-23 |
| UVM | TSG | PNPT1 | TANK | 0.846754457 | 4.41E-23 |
| UVM | TSG | PNPT1 | ANXA7 | 0.852887864 | 1.01E-23 |
| UVM | TSG | PNPT1 | MLH3 | 0.85593972 | 4.76E-24 |
| UVM | TSG | PNPT1 | GGNBP2 | 0.856957992 | 3.68E-24 |
| UVM | TSG | PNPT1 | MSH2 | 0.858247902 | 2.65E-24 |
| UVM | TSG | PNPT1 | GTPBP4 | 0.85935661 | 2.00E-24 |
| UVM | TSG | PNPT1 | NAPEPLD | 0.860807268 | 1.37E-24 |
| UVM | TSG | PNPT1 | DMTF1 | 0.861926349 | 1.02E-24 |
| UVM | TSG | PNPT1 | BRCA2 | 0.862820258 | 8.09E-25 |
| UVM | TSG | PNPT1 | BMPR2 | 0.863230236 | 7.25E-25 |
| UVM | TSG | PNPT1 | TOPORS | 0.864796198 | 4.77E-25 |
| UVM | TSG | PNPT1 | INTS6 | 0.865592177 | 3.85E-25 |
| UVM | TSG | PNPT1 | LIN9 | 0.867959274 | 2.02E-25 |
| UVM | TSG | PNPT1 | BMPR1A | 0.871080605 | 8.45E-26 |
| UVM | TSG | PNPT1 | FAM188A | 0.87201598 | 6.48E-26 |
| UVM | TSG | PNPT1 | APAF1 | 0.877375076 | 1.36E-26 |
| UVM | TSG | PNPT1 | CUL5 | 0.882810793 | 2.58E-27 |
| UVM | TSG | PNPT1 | KRIT1 | 0.885516597 | 1.09E-27 |
| UVM | TSG | PNPT1 | ATM | 0.887196034 | 6.35E-28 |
| UVM | TSG | PNPT1 | WDR11 | 0.887820063 | 5.17E-28 |
| UVM | TSG | PNPT1 | CUL2 | 0.890841602 | 1.89E-28 |
| UVM | TSG | PNPT1 | RINT1 | 0.895328135 | 4.02E-29 |
| UVM | TSG | PNPT1 | PRKAA1 | 0.897890634 | 1.61E-29 |
| UVM | TSG | PNPT1 | DCLRE1A | 0.898992058 | 1.08E-29 |
| UVM | TSG | PNPT1 | GORAB | 0.902313319 | 3.12E-30 |
| UVM | TSG | PNPT1 | SMCHD1 | 0.907087983 | 4.84E-31 |
| UVM | TSG | PNPT1 | CDC73 | 0.90770177 | 3.78E-31 |
| UVM | TSG | PNPT1 | SUZ12 | 0.909865726 | 1.56E-31 |
Top |
|
Protein 3D structureVisit iCn3D. |
Top |
|
Protein-protein interaction networks * Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P)) |
![]() |
Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P)) |
![]() |
![]() * Edge colors based on TCGA cancer types. |
* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P)) |
![]() |
| Cancer type | Translation factor | Interacting protein coding gene | FC | adj.pval |
| KIRP | PNPT1 | EXOSC1 | -1.33151185162103 | 0.000133869703859091 |
| KICH | PNPT1 | EXOSC10 | 1.24998522750894 | 0.000139892101287842 |
| THCA | PNPT1 | SUPV3L1 | 1.16309404438803 | 0.000195372413806617 |
| LIHC | PNPT1 | EXOSC9 | -2.50953051098706 | 0.000201991820198738 |
| THCA | PNPT1 | EXOSC4 | -1.11463631149166 | 0.000207398306454043 |
| STAD | PNPT1 | EXOSC9 | -1.45226188044018 | 0.000306400004774332 |
| KICH | PNPT1 | EXOSC1 | 1.88198428035622 | 0.000556409358978271 |
| PRAD | PNPT1 | EXOSC4 | -4.70182019022102 | 0.000648342999076925 |
| COAD | PNPT1 | EXOSC9 | -2.08916035369094 | 0.000664144754409791 |
| ESCA | PNPT1 | EXOSC5 | -3.73448090208876 | 0.0009765625 |
| STAD | PNPT1 | SUPV3L1 | -2.73690808019925 | 0.00133262807503343 |
| LIHC | PNPT1 | EXOSC4 | 2.269913876739 | 0.00228509329229136 |
| ESCA | PNPT1 | DIS3 | 1.13528932331943 | 0.0029296875 |
| ESCA | PNPT1 | EXOSC9 | -1.29616499696761 | 0.0029296875 |
| LIHC | PNPT1 | DIS3 | 1.39544325555059 | 0.00915034805063108 |
| KICH | PNPT1 | EXOSC7 | 1.11626022550606 | 0.00963503122329712 |
| HNSC | PNPT1 | EXOSC6 | 1.57129641372128 | 0.0154582375123482 |
| UCEC | PNPT1 | EXOSC7 | 1.37141709218626 | 0.015625 |
| CHOL | PNPT1 | EXOSC6 | -2.43444454012501 | 0.0390625 |
| LUAD | PNPT1 | EXOSC9 | -1.70965354341598 | 0.0417265102143948 |
| BRCA | PNPT1 | EXOSC1 | -3.22250485955442 | 1.01918341406027e-11 |
| KIRC | PNPT1 | EXOSC5 | -2.76908351745065 | 1.09859684701495e-11 |
| KIRC | PNPT1 | EXOSC9 | -1.80547222200586 | 1.11862284037858e-09 |
| PRAD | PNPT1 | EXOSC5 | -2.70222350851716 | 1.26099370313262e-05 |
| BRCA | PNPT1 | EXOSC4 | -1.39844269640225 | 1.3684078260725e-15 |
| THCA | PNPT1 | EXOSC5 | -1.76982463038815 | 1.55304155962675e-06 |
| LUAD | PNPT1 | EXOSC5 | -2.21263383713822 | 1.8775400044567e-09 |
| LUAD | PNPT1 | SUPV3L1 | -1.36451925050335 | 3.8615985200212e-08 |
| LUAD | PNPT1 | EXOSC4 | -2.39057665546458 | 5.24732369463512e-07 |
| LUAD | PNPT1 | EXOSC10 | -5.48154088649683 | 6.13939009668372e-06 |
| KIRP | PNPT1 | EXOSC5 | -1.57899571115575 | 6.79492950439454e-06 |
| BRCA | PNPT1 | EXOSC5 | -1.24930553971161 | 9.66917351405126e-09 |
Protein-protein interactors with this translation factor (BIOGRID-3.4.160) |
| PPI interactors with PNPT1 |
| ICT1, SIRT7, DPY30, NUP153, GATC, HSPB1, NCL, NUP214, NUP107, PDLIM1, PRKCSH, NCAPD2, RANGAP1, PTBP1, GRSF1, NXF1, FAHD1, PPA2, HMGCL, CLTB, EIF4A1, PMPCA, PMPCB, NTRK1, LTN1, TBRG4, SUPV3L1, SERPINA12, TMED2, ACAD9, ATP5D, MRPL12, YAF2, EFTUD2, CDC34, MRM1, HSPD1, PDK1, TRMT61B, KIAA1429, AMT, BCL2L13, GFM1, SND1, ADARB1, PLEKHA4, XIRP2, GBP4, PARL, E, nsp15, nsp16, ORF6, IMMP2L, HSCB, AUH, C12orf65, C1QBP, C21orf33, C6orf203, CS, DDX28, FASTKD2, FASTKD3, FASTKD5, GFM2, HINT2, LONP1, LRPPRC, MDH2, METTL15, METTL17, MRPL11, MRPS12, MRPS26, MRRF, MTERF3, MTG1, MTG2, MTIF2, MTIF3, MTRF1, MTRF1L, RPUSD4, SLIRP, SSBP1, TACO1, TFAM, TRUB2, TSFM, TUFM, VWA8, EXD2, CLPP, Apc2, AARS2, COX8A, PDHA1, TRAP1, NUDCD2, UQCRFS1, PFDN5, TCL1A, MALSU1, LRFN2, PDE12, MRPL23, CALR3, QRSL1, TMEM183A, WIF1, OSGEP, PRR3, AURKB, FTSJ2, ZSCAN31, SLC25A10, MRPL42, YARS2, CIART, MRPS17, SERBP1, PCDHA4, EP300, |
Top |
|
Clinically associated variants from ClinVar. |
| Gene | Chr | Position | RefSeq | VarSeq | RefSeeq | VarType | Pathogenic | Disease | VarInfo |
| PNPT1 | chr2 | 55863066 | TTCTA | T | Microsatellite | Benign | not_provided | SO:0001624|3_prime_UTR_variant | SO:0001624|3_prime_UTR_variant |
| PNPT1 | chr2 | 55863110 | CTA | C | Deletion | Benign | not_provided | SO:0001624|3_prime_UTR_variant | SO:0001624|3_prime_UTR_variant |
| PNPT1 | chr2 | 55863213 | A | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001624|3_prime_UTR_variant | SO:0001624|3_prime_UTR_variant |
| PNPT1 | chr2 | 55863301 | A | G | single_nucleotide_variant | Benign | not_provided | SO:0001624|3_prime_UTR_variant | SO:0001624|3_prime_UTR_variant |
| PNPT1 | chr2 | 55863360 | T | TA | Duplication | Benign | Combined_oxidative_phosphorylation_deficiency_13|Deafness,_autosomal_recessive_70|not_specified | SO:0001624|3_prime_UTR_variant | SO:0001624|3_prime_UTR_variant |
| PNPT1 | chr2 | 55863463 | G | A | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55863490 | A | G | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55863511 | C | T | single_nucleotide_variant | Likely_pathogenic | Combined_oxidative_phosphorylation_deficiency_13 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55863562 | C | G | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55863589 | T | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55864403 | C | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55864738 | G | GA | Duplication | Benign | not_specified|not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55864745 | A | C | single_nucleotide_variant | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55864752 | A | T | single_nucleotide_variant | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55864753 | A | G | single_nucleotide_variant | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55865038 | G | T | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55867756 | T | A | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55867763 | T | C | single_nucleotide_variant | Uncertain_significance | Deafness,_autosomal_recessive_70|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55867773 | C | A | single_nucleotide_variant | Pathogenic | Combined_oxidative_phosphorylation_deficiency_13 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55867845 | A | G | single_nucleotide_variant | Benign | not_specified|not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55867856 | T | G | single_nucleotide_variant | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55867938 | A | G | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55870304 | T | G | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55870319 | T | C | single_nucleotide_variant | Benign/Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55870323 | G | A | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55870455 | T | A | single_nucleotide_variant | Uncertain_significance | Combined_oxidative_phosphorylation_deficiency_13 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55870507 | G | A | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55870529 | C | T | single_nucleotide_variant | Benign/Likely_benign | not_specified|not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55870538 | A | G | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55870539 | TCCA | T | Deletion | Uncertain_significance | Deafness,_autosomal_recessive_70|not_provided | SO:0001822|inframe_deletion | SO:0001822|inframe_deletion |
| PNPT1 | chr2 | 55870544 | C | T | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55870554 | G | A | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55870577 | G | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55870697 | T | C | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55870827 | A | G | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55870873 | CA | C | Deletion | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55871762 | C | ATG | Indel | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55871771 | C | T | single_nucleotide_variant | Likely_pathogenic | Combined_oxidative_phosphorylation_deficiency_13 | SO:0001575|splice_donor_variant | SO:0001575|splice_donor_variant |
| PNPT1 | chr2 | 55871797 | G | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55871862 | C | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55871863 | G | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55872076 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55872081 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55872259 | T | C | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55872488 | A | C | single_nucleotide_variant | Pathogenic | Combined_oxidative_phosphorylation_deficiency_13|Deafness,_autosomal_recessive_70 | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55872526 | A | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55872535 | T | G | single_nucleotide_variant | Conflicting_interpretations_of_pathogenicity | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55872538 | T | C | single_nucleotide_variant | Benign | not_specified|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55872550 | A | G | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55872717 | T | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55873123 | C | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55873215 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55873301 | T | A | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55873357 | G | C | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55873385 | C | G | single_nucleotide_variant | Benign | not_specified|not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55873407 | A | G | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55873456 | G | C | single_nucleotide_variant | Uncertain_significance | Combined_oxidative_phosphorylation_deficiency_13|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55873529 | CA | C | Deletion | Benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55873562 | TA | T | Deletion | Likely_pathogenic | not_provided | SO:0001589|frameshift_variant | SO:0001589|frameshift_variant |
| PNPT1 | chr2 | 55873592 | G | A | single_nucleotide_variant | Benign | not_specified|not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55873605 | T | C | single_nucleotide_variant | Pathogenic | Deafness,_autosomal_recessive_70 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55873908 | TGTAA | T | Deletion | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55874293 | A | T | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55874332 | T | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55874492 | G | C | single_nucleotide_variant | Conflicting_interpretations_of_pathogenicity | Combined_oxidative_phosphorylation_deficiency_13|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55874501 | C | T | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55874518 | A | T | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55874521 | C | T | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55874556 | C | G | single_nucleotide_variant | Pathogenic | Combined_oxidative_phosphorylation_deficiency_13 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55874559 | C | T | single_nucleotide_variant | Conflicting_interpretations_of_pathogenicity | Combined_oxidative_phosphorylation_deficiency_13|Deafness,_autosomal_recessive_70|not_specified|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55874565 | C | A | single_nucleotide_variant | Conflicting_interpretations_of_pathogenicity | Combined_oxidative_phosphorylation_deficiency_13|Deafness,_autosomal_recessive_70|Neurodevelopmental_disorder|Inborn_genetic_diseases|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55874598 | G | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55874811 | C | T | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55881816 | C | T | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55881954 | TCCTGCCTTGGCCTCCCAAGGCTCATG | T | Deletion | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55882023 | T | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55882035 | C | G | single_nucleotide_variant | Pathogenic | Combined_oxidative_phosphorylation_deficiency_13 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55882060 | G | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55882077 | T | C | single_nucleotide_variant | Likely_pathogenic | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55882092 | T | C | single_nucleotide_variant | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55882132 | T | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55882247 | A | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55883273 | C | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55883283 | T | C | single_nucleotide_variant | Pathogenic | Deafness,_autosomal_recessive_70 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55883308 | G | A | single_nucleotide_variant | Uncertain_significance | Combined_oxidative_phosphorylation_deficiency_13|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55883317 | G | A | single_nucleotide_variant | Pathogenic | Inborn_genetic_diseases | SO:0001587|nonsense | SO:0001587|nonsense |
| PNPT1 | chr2 | 55883317 | G | T | single_nucleotide_variant | Benign | Combined_oxidative_phosphorylation_deficiency_13|Deafness,_autosomal_recessive_70|not_specified|not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55883325 | A | G | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55883333 | C | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55883346 | G | C | single_nucleotide_variant | Conflicting_interpretations_of_pathogenicity | Combined_oxidative_phosphorylation_deficiency_13|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55883565 | T | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55883713 | C | A | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55883733 | C | A | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55886871 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55887075 | A | G | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55887160 | GC | G | Deletion | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55887176 | T | C | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55887282 | T | G | single_nucleotide_variant | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55887325 | C | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55887325 | C | T | single_nucleotide_variant | Benign/Likely_benign | not_specified|not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55887344 | A | G | single_nucleotide_variant | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55889062 | G | A | single_nucleotide_variant | Benign | Combined_oxidative_phosphorylation_deficiency_13|Deafness,_autosomal_recessive_70|not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55889107 | C | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55889149 | C | T | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55889336 | A | G | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55889454 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55889466 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55894085 | T | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55894090 | A | G | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55894118 | TA | T | Deletion | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55894119 | A | G | single_nucleotide_variant | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55894126 | CTG | C | Microsatellite | Pathogenic | not_provided | SO:0001589|frameshift_variant | SO:0001589|frameshift_variant |
| PNPT1 | chr2 | 55894142 | T | C | single_nucleotide_variant | Pathogenic | Combined_oxidative_phosphorylation_deficiency_13 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55894153 | T | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55894181 | A | G | single_nucleotide_variant | Uncertain_significance | Combined_oxidative_phosphorylation_deficiency_13 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55894203 | G | A | single_nucleotide_variant | Conflicting_interpretations_of_pathogenicity | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55894232 | T | A | single_nucleotide_variant | Benign | not_specified|not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55894240 | T | C | single_nucleotide_variant | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55894243 | G | A | single_nucleotide_variant | Benign | not_specified|not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55894247 | T | C | single_nucleotide_variant | Benign | Combined_oxidative_phosphorylation_deficiency_13|Deafness,_autosomal_recessive_70|not_specified|not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55894269 | A | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55894428 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55894456 | G | A | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55894720 | CA | C | Deletion | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55894858 | G | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55894989 | A | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55895002 | G | C | single_nucleotide_variant | Uncertain_significance | not_specified | SO:0001587|nonsense | SO:0001587|nonsense |
| PNPT1 | chr2 | 55895004 | A | G | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55895048 | T | C | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55895097 | T | C | single_nucleotide_variant | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55895305 | T | C | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55895321 | T | C | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55898203 | A | G | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55898290 | C | G | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55898486 | T | C | single_nucleotide_variant | Benign/Likely_benign | not_specified|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55898929 | A | G | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55898930 | C | T | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55898962 | AAAAAC | A | Microsatellite | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55899092 | T | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55899129 | CT | C | Deletion | Pathogenic | Deafness,_autosomal_recessive_70 | SO:0001589|frameshift_variant | SO:0001589|frameshift_variant |
| PNPT1 | chr2 | 55899142 | G | A | single_nucleotide_variant | Benign | not_specified|not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55899176 | G | A | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55899228 | A | T | single_nucleotide_variant | Benign | Combined_oxidative_phosphorylation_deficiency_13|Deafness,_autosomal_recessive_70|not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55899425 | T | C | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55900032 | G | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55900033 | A | T | single_nucleotide_variant | Benign | not_specified|not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55900042 | C | G | single_nucleotide_variant | Benign/Likely_benign | not_specified|not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55900105 | T | C | single_nucleotide_variant | Benign/Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55900134 | G | T | single_nucleotide_variant | Pathogenic | Combined_oxidative_phosphorylation_deficiency_13 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55900155 | C | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55900206 | C | G | single_nucleotide_variant | Conflicting_interpretations_of_pathogenicity | Combined_oxidative_phosphorylation_deficiency_13|Deafness,_autosomal_recessive_70|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55900217 | A | T | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55900223 | A | G | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55900224 | G | A | single_nucleotide_variant | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55900231 | G | GA | Duplication | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55900283 | A | G | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55900459 | A | G | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55906552 | T | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55906768 | G | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55906884 | T | G | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55906921 | C | T | single_nucleotide_variant | Likely_pathogenic | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55906936 | A | G | single_nucleotide_variant | Benign | not_specified|not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55907560 | TA | T | Deletion | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55907560 | TAAAAAAAA | T | Deletion | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55907757 | G | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55907886 | C | T | single_nucleotide_variant | Likely_pathogenic | Combined_oxidative_phosphorylation_deficiency_13 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55907891 | G | A | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55907893 | A | G | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55907990 | C | T | single_nucleotide_variant | Likely_pathogenic | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55907991 | G | A | single_nucleotide_variant | Likely_benign | not_specified | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55908014 | G | A | single_nucleotide_variant | Conflicting_interpretations_of_pathogenicity | Combined_oxidative_phosphorylation_deficiency_13|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55908065 | G | GA | Duplication | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55908317 | G | C | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55910674 | G | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55910710 | T | C | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55910747 | C | CA | Duplication | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55910747 | CA | C | Deletion | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55910944 | T | C | single_nucleotide_variant | Likely_benign | not_specified | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55910950 | G | A | single_nucleotide_variant | Likely_benign | not_specified | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55910952 | GC | G | Deletion | Likely_pathogenic | Neurodevelopmental_disorder | SO:0001589|frameshift_variant | SO:0001589|frameshift_variant |
| PNPT1 | chr2 | 55910954 | G | A | single_nucleotide_variant | Likely_pathogenic | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55910955 | G | A | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55910961 | T | C | single_nucleotide_variant | Conflicting_interpretations_of_pathogenicity | Combined_oxidative_phosphorylation_deficiency_13|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55910966 | C | T | single_nucleotide_variant | Likely_pathogenic | Combined_oxidative_phosphorylation_deficiency_13|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55910970 | C | T | single_nucleotide_variant | Pathogenic | Combined_oxidative_phosphorylation_deficiency_13 | SO:0001574|splice_acceptor_variant | SO:0001574|splice_acceptor_variant |
| PNPT1 | chr2 | 55910974 | C | A | single_nucleotide_variant | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55910979 | G | T | single_nucleotide_variant | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55912120 | T | C | single_nucleotide_variant | Benign | Combined_oxidative_phosphorylation_deficiency_13|Deafness,_autosomal_recessive_70|not_specified|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55912154 | T | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55912185 | T | A | single_nucleotide_variant | Pathogenic | Deafness,_autosomal_recessive_70 | SO:0001574|splice_acceptor_variant | SO:0001574|splice_acceptor_variant |
| PNPT1 | chr2 | 55912187 | A | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55912191 | A | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55912193 | C | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55912196 | T | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55913206 | G | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55913271 | AT | A | Deletion | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55913468 | A | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55913528 | G | C | single_nucleotide_variant | Uncertain_significance | Combined_oxidative_phosphorylation_deficiency_13 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55913551 | G | A | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55913588 | T | A | single_nucleotide_variant | Benign/Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55913592 | G | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55913592 | G | C | single_nucleotide_variant | Likely_benign | not_specified | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55913644 | C | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55914573 | C | CA | Duplication | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55914621 | T | C | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55914794 | A | G | single_nucleotide_variant | Pathogenic | Combined_oxidative_phosphorylation_deficiency_13 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55914808 | C | G | single_nucleotide_variant | Uncertain_significance | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55914810 | G | C | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55915128 | A | AT | Duplication | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55915128 | AT | A | Deletion | Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55920663 | T | C | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55920749 | C | T | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55920792 | C | G | single_nucleotide_variant | Benign/Likely_benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
| PNPT1 | chr2 | 55920822 | G | C | single_nucleotide_variant | Likely_pathogenic | Deafness,_autosomal_recessive_70 | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55920830 | C | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55920837 | C | G | single_nucleotide_variant | Benign/Likely_benign | not_specified|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| PNPT1 | chr2 | 55920862 | A | G | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55920938 | G | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| PNPT1 | chr2 | 55920983 | G | C | single_nucleotide_variant | Likely_benign | not_specified | SO:0002153|genic_upstream_transcript_variant | SO:0002153|genic_upstream_transcript_variant |
| PNPT1 | chr2 | 55921006 | C | T | single_nucleotide_variant | Likely_benign | not_specified | ||
| PNPT1 | chr2 | 55921116 | C | G | single_nucleotide_variant | Benign | not_provided |
nsSNVs with sample frequency (size of circle) from TCGA 33 cancers. |
SNVs and Indels |
| Gene | Cancer type | Chromosome | Start | End | RefSeeq | MutSeq | Mutation type | AAchange | # samples |
| PNPT1 | KIRP | chr2 | 55908004 | 55908004 | A | G | Missense_Mutation | p.L168P | 4 |
| PNPT1 | PAAD | chr2 | 55874502 | 55874502 | G | A | Missense_Mutation | p.R528C | 3 |
| PNPT1 | UCS | chr2 | 55872564 | 55872564 | G | A | Missense_Mutation | p.A581V | 3 |
| PNPT1 | BLCA | chr2 | 55883317 | 55883317 | G | T | Silent | 3 | |
| PNPT1 | PAAD | chr2 | 55871818 | 55871818 | A | T | Missense_Mutation | p.F620L | 3 |
| PNPT1 | COAD | chr2 | 55863478 | 55863478 | C | T | Missense_Mutation | p.R749Q | 3 |
| PNPT1 | UCEC | chr2 | 55874510 | 55874510 | T | G | Missense_Mutation | p.E525A | 3 |
| PNPT1 | BLCA | chr2 | 55895089 | 55895089 | T | - | Frame_Shift_Del | p.K327fs | 3 |
| PNPT1 | SKCM | chr2 | 55894164 | 55894164 | G | C | Missense_Mutation | p.L380V | 3 |
| PNPT1 | UCEC | chr2 | 55874529 | 55874529 | G | T | Missense_Mutation | p.P519T | 3 |
| PNPT1 | BLCA | chr2 | 55895071 | 55895071 | T | C | Silent | p.P333P | 3 |
| PNPT1 | ESCA | chr2 | 55912086 | 55912086 | C | T | Missense_Mutation | p.R132Q | 3 |
| PNPT1 | PAAD | chr2 | 55871818 | 55871818 | A | T | Missense_Mutation | 2 | |
| PNPT1 | UCEC | chr2 | 55883448 | 55883448 | A | C | Missense_Mutation | p.L448R | 2 |
| PNPT1 | ESCA | chr2 | 55912086 | 55912086 | C | T | Missense_Mutation | 2 | |
| PNPT1 | TGCT | chr2 | 55912120 | 55912120 | T | C | Missense_Mutation | 2 | |
| PNPT1 | HNSC | chr2 | 55895069 | 55895069 | T | G | Missense_Mutation | p.Y334S | 2 |
| PNPT1 | LUAD | chr2 | 55873549 | 55873549 | C | A | Splice_Site | 2 | |
| PNPT1 | PAAD | chr2 | 55874502 | 55874502 | G | A | Missense_Mutation | 2 | |
| PNPT1 | SARC | chr2 | 55887311 | 55887311 | T | C | Missense_Mutation | p.N422S | 2 |
| PNPT1 | SARC | chr2 | 55882064 | 55882064 | C | - | Frame_Shift_Del | p.C489fs | 2 |
| PNPT1 | STAD | chr2 | 55863427 | 55863427 | C | G | Missense_Mutation | p.R766T | 2 |
| PNPT1 | LIHC | chr2 | 55910944 | 55910944 | T | A | Silent | 2 | |
| PNPT1 | STAD | chr2 | 55872550 | 55872550 | A | G | Silent | p.L586L | 2 |
| PNPT1 | THYM | chr2 | 55921011 | 55921011 | G | T | Missense_Mutation | 2 | |
| PNPT1 | LUAD | chr2 | 55874559 | 55874559 | C | G | Missense_Mutation | p.V509L | 2 |
| PNPT1 | PCPG | chr2 | 55900135 | 55900135 | T | C | Silent | 2 | |
| PNPT1 | SKCM | chr2 | 55887307 | 55887307 | G | A | Silent | p.F423F | 2 |
| PNPT1 | STAD | chr2 | 55870544 | 55870544 | C | T | Silent | p.Q641Q | 2 |
| PNPT1 | HNSC | chr2 | 55894127 | 55894127 | T | A | Splice_Site | p.Q392_splice | 2 |
| PNPT1 | PCPG | chr2 | 55900135 | 55900135 | T | C | Silent | p.Q253Q | 2 |
| PNPT1 | SKCM | chr2 | 55912144 | 55912144 | G | A | Missense_Mutation | p.P113S | 2 |
| PNPT1 | STAD | chr2 | 55900055 | 55900055 | G | A | Missense_Mutation | p.S280L | 2 |
| PNPT1 | LIHC | chr2 | 55887311 | 55887311 | T | - | Frame_Shift_Del | p.N422fs | 2 |
| PNPT1 | STAD | chr2 | 55920812 | 55920812 | C | G | Silent | p.V49V | 2 |
| PNPT1 | BRCA | chr2 | 55870522 | 55870522 | C | T | Missense_Mutation | p.V649I | 2 |
| PNPT1 | HNSC | chr2 | 55894127 | 55894127 | T | A | Missense_Mutation | p.Q392L | 2 |
| PNPT1 | KIRP | chr2 | 55894199 | 55894199 | C | A | Missense_Mutation | 2 | |
| PNPT1 | LIHC | chr2 | 55907883 | 55907883 | G | - | Frame_Shift_Del | p.L177fs | 2 |
| PNPT1 | LUAD | chr2 | 55874526 | 55874526 | C | A | Nonsense_Mutation | p.E520* | 2 |
| PNPT1 | SKCM | chr2 | 55920892 | 55920892 | G | A | Silent | p.L23L | 2 |
| PNPT1 | STAD | chr2 | 55870530 | 55870530 | G | A | Missense_Mutation | p.T646M | 2 |
| PNPT1 | UCEC | chr2 | 55871819 | 55871819 | A | C | Missense_Mutation | p.F620C | 2 |
| PNPT1 | BRCA | chr2 | 55894154 | 55894154 | G | A | Missense_Mutation | p.S383L | 2 |
| PNPT1 | LIHC | chr2 | 55910944 | 55910944 | T | A | Silent | p.P143P | 2 |
| PNPT1 | STAD | chr2 | 55907854 | 55907854 | T | C | Silent | p.G186G | 2 |
| PNPT1 | UCEC | chr2 | 55872517 | 55872517 | G | A | Nonsense_Mutation | p.R597* | 2 |
| PNPT1 | BRCA | chr2 | 55920943 | 55920943 | A | C | Missense_Mutation | p.Y6D | 2 |
| PNPT1 | HNSC | chr2 | 55894167 | 55894167 | T | - | Frame_Shift_Del | p.T379fs | 2 |
| PNPT1 | BLCA | chr2 | 55900125 | 55900125 | G | T | Missense_Mutation | p.Q257K | 2 |
| PNPT1 | LUAD | chr2 | 55912132 | 55912132 | G | C | Missense_Mutation | p.L117V | 2 |
| PNPT1 | UCEC | chr2 | 55883311 | 55883311 | A | C | Missense_Mutation | p.F466V | 2 |
| PNPT1 | CESC | chr2 | 55883471 | 55883471 | G | A | Silent | 2 | |
| PNPT1 | BLCA | chr2 | 55882034 | 55882034 | C | T | Splice_Site | 2 | |
| PNPT1 | LIHC | chr2 | 55900045 | 55900045 | A | - | Frame_Shift_Del | p.I283fs | 2 |
| PNPT1 | SARC | chr2 | 55887311 | 55887311 | T | C | Missense_Mutation | 2 | |
| PNPT1 | LIHC | chr2 | 55908051 | 55908051 | A | G | Silent | 1 | |
| PNPT1 | CESC | chr2 | 55906874 | 55906874 | C | A | Nonsense_Mutation | 1 | |
| PNPT1 | BLCA | chr2 | 55908017 | 55908017 | C | T | Missense_Mutation | 1 | |
| PNPT1 | LIHC | chr2 | 55887319 | 55887319 | T | - | Frame_Shift_Del | p.K419fs | 1 |
| PNPT1 | SARC | chr2 | 55882064 | 55882064 | C | - | Frame_Shift_Del | 1 | |
| PNPT1 | SKCM | chr2 | 55894190 | 55894190 | C | T | Missense_Mutation | p.S371N | 1 |
| PNPT1 | BLCA | chr2 | 55908017 | 55908017 | C | T | Missense_Mutation | p.E164K | 1 |
| PNPT1 | KIRP | chr2 | 55863466 | 55863466 | T | C | Missense_Mutation | p.Q753R | 1 |
| PNPT1 | LIHC | chr2 | 55906857 | 55906857 | A | G | Silent | 1 | |
| PNPT1 | UCS | chr2 | 55872564 | 55872564 | G | A | Missense_Mutation | 1 | |
| PNPT1 | CESC | chr2 | 55883471 | 55883471 | G | A | Silent | p.V440 | 1 |
| PNPT1 | BLCA | chr2 | 55920907 | 55920907 | C | T | Missense_Mutation | 1 | |
| PNPT1 | GBM | chr2 | 55874482 | 55874482 | C | G | Missense_Mutation | p.L534_splice | 1 |
| PNPT1 | LIHC | chr2 | 55900170 | 55900170 | A | - | Frame_Shift_Del | p.C242fs | 1 |
| PNPT1 | SKCM | chr2 | 55907865 | 55907865 | G | A | Missense_Mutation | p.P183S | 1 |
| PNPT1 | THCA | chr2 | 55907895 | 55907895 | C | A | Splice_Site | 1 | |
| PNPT1 | BLCA | chr2 | 55920907 | 55920907 | C | T | Missense_Mutation | p.D18N | 1 |
| PNPT1 | HNSC | chr2 | 55873415 | 55873415 | C | G | Missense_Mutation | p.E573Q | 1 |
| PNPT1 | LUAD | chr2 | 55895085 | 55895085 | G | C | Missense_Mutation | p.P329A | 1 |
| PNPT1 | LIHC | chr2 | 55872485 | 55872485 | T | C | Silent | 1 | |
| PNPT1 | BLCA | chr2 | 55898469 | 55898469 | C | T | Missense_Mutation | 1 | |
| PNPT1 | CHOL | chr2 | 55874589 | 55874589 | C | A | Splice_Site | 1 | |
| PNPT1 | HNSC | chr2 | 55900087 | 55900087 | G | C | Silent | 1 | |
| PNPT1 | LIHC | chr2 | 55895026 | 55895026 | A | - | Frame_Shift_Del | p.F348fs | 1 |
| PNPT1 | THYM | chr2 | 55913527 | 55913527 | G | T | Missense_Mutation | 1 | |
| PNPT1 | BLCA | chr2 | 55870295 | 55870295 | G | A | Silent | p.I689I | 1 |
| PNPT1 | HNSC | chr2 | 55920943 | 55920943 | A | G | Missense_Mutation | p.Y6H | 1 |
| PNPT1 | KIRP | chr2 | 55870498 | 55870498 | T | C | Missense_Mutation | p.M657V | 1 |
| PNPT1 | LUAD | chr2 | 55895050 | 55895050 | G | C | Missense_Mutation | p.F340L | 1 |
| PNPT1 | BLCA | chr2 | 55883275 | 55883275 | C | G | Missense_Mutation | 1 | |
| PNPT1 | BLCA | chr2 | 55870295 | 55870295 | G | A | Silent | 1 | |
| PNPT1 | HNSC | chr2 | 55895069 | 55895069 | T | G | Missense_Mutation | 1 | |
| PNPT1 | LIHC | chr2 | 55872558 | 55872558 | T | - | Frame_Shift_Del | p.K583fs | 1 |
| PNPT1 | SARC | chr2 | 55870339 | 55870339 | G | T | Missense_Mutation | 1 | |
| PNPT1 | BLCA | chr2 | 55863489 | 55863489 | C | G | Missense_Mutation | p.M745I | 1 |
| PNPT1 | HNSC | chr2 | 55900074 | 55900074 | G | A | Nonsense_Mutation | p.Q274* | 1 |
| PNPT1 | KIRP | chr2 | 55900032 | 55900032 | G | C | Missense_Mutation | p.H288D | 1 |
| PNPT1 | LIHC | chr2 | 55906857 | 55906857 | A | G | Silent | p.T213T | 1 |
| PNPT1 | BLCA | chr2 | 55874511 | 55874511 | C | T | Missense_Mutation | 1 | |
| PNPT1 | COAD | chr2 | 55867798 | 55867798 | C | T | Silent | p.A704A | 1 |
| PNPT1 | BLCA | chr2 | 55863489 | 55863489 | C | G | Missense_Mutation | 1 | |
| PNPT1 | HNSC | chr2 | 55870313 | 55870313 | G | T | Silent | 1 | |
| PNPT1 | LIHC | chr2 | 55883317 | 55883317 | G | - | Frame_Shift_Del | p.R464fs | 1 |
| PNPT1 | KIRP | chr2 | 55900121 | 55900121 | C | T | Missense_Mutation | p.G258D | 1 |
| PNPT1 | LUAD | chr2 | 55867787 | 55867787 | T | C | Missense_Mutation | p.H708R | 1 |
| PNPT1 | LIHC | chr2 | 55871841 | 55871846 | GAACCT | - | In_Frame_Del | p.611_613del | 1 |
| PNPT1 | BLCA | chr2 | 55895089 | 55895089 | T | - | Frame_Shift_Del | 1 | |
| PNPT1 | COAD | chr2 | 55873414 | 55873414 | T | C | Missense_Mutation | p.E573G | 1 |
| PNPT1 | BLCA | chr2 | 55898469 | 55898469 | C | T | Missense_Mutation | p.E321K | 1 |
| PNPT1 | HNSC | chr2 | 55920943 | 55920943 | A | G | Missense_Mutation | 1 | |
| PNPT1 | LUAD | chr2 | 55920933 | 55920933 | G | C | Missense_Mutation | p.S9W | 1 |
| PNPT1 | UCEC | chr2 | 55895034 | 55895034 | C | A | Nonsense_Mutation | p.E346* | 1 |
| PNPT1 | BLCA | chr2 | 55882034 | 55882034 | C | T | Splice_Site | p.G499_splice | 1 |
| PNPT1 | HNSC | chr2 | 55900087 | 55900087 | G | C | Silent | p.T269T | 1 |
| PNPT1 | KIRP | chr2 | 55908004 | 55908004 | A | G | Missense_Mutation | 1 | |
| PNPT1 | LUAD | chr2 | 55921012 | 55921012 | A | T | Splice_Site | 1 | |
| PNPT1 | READ | chr2 | 55906921 | 55906921 | C | T | Missense_Mutation | p.R192Q | 1 |
| PNPT1 | BLCA | chr2 | 55895071 | 55895071 | T | C | Silent | 1 | |
| PNPT1 | COAD | chr2 | 55898471 | 55898471 | G | A | Missense_Mutation | p.T320M | 1 |
| PNPT1 | BLCA | chr2 | 55883275 | 55883275 | C | G | Missense_Mutation | p.E478Q | 1 |
| PNPT1 | HNSC | chr2 | 55914784 | 55914784 | A | G | Missense_Mutation | 1 | |
| PNPT1 | LUAD | chr2 | 55894185 | 55894185 | C | A | Nonsense_Mutation | p.E373* | 1 |
| PNPT1 | LUSC | chr2 | 55895077 | 55895077 | G | C | Silent | p.A331A | 1 |
| PNPT1 | READ | chr2 | 55872499 | 55872499 | T | G | Missense_Mutation | p.N603H | 1 |
| PNPT1 | BLCA | chr2 | 55895095 | 55895095 | T | G | Splice_Site | 1 | |
| PNPT1 | COAD | chr2 | 55900197 | 55900197 | C | T | Missense_Mutation | p.A233T | 1 |
| PNPT1 | BLCA | chr2 | 55874511 | 55874511 | C | T | Missense_Mutation | p.E525K | 1 |
| PNPT1 | HNSC | chr2 | 55873415 | 55873415 | C | G | Missense_Mutation | 1 | |
| PNPT1 | HNSC | chr2 | 55894995 | 55894995 | A | G | Splice_Site | p.R358_splice | 1 |
| PNPT1 | LGG | chr2 | 55873622 | 55873622 | C | A | Splice_Site | 1 | |
| PNPT1 | LUSC | chr2 | 55920888 | 55920888 | G | T | Missense_Mutation | p.P24Q | 1 |
| PNPT1 | READ | chr2 | 55906867 | 55906867 | G | T | Missense_Mutation | p.S210Y | 1 |
| PNPT1 | BLCA | chr2 | 55900125 | 55900125 | G | T | Missense_Mutation | 1 | |
| PNPT1 | COAD | chr2 | 55906912 | 55906912 | A | T | Missense_Mutation | p.I195K | 1 |
| PNPT1 | HNSC | chr2 | 55874497 | 55874497 | C | T | Silent | 1 | |
| PNPT1 | LUAD | chr2 | 55912159 | 55912159 | C | A | Missense_Mutation | p.A108S | 1 |
| PNPT1 | SKCM | chr2 | 55913524 | 55913524 | G | A | Missense_Mutation | p.S93F | 1 |
| PNPT1 | LUSC | chr2 | 55870350 | 55870350 | T | A | Splice_Site | p.Q672_splice | 1 |
| PNPT1 | LIHC | chr2 | 55872538 | 55872538 | T | C | Missense_Mutation | 1 | |
| PNPT1 | LIHC | chr2 | 55873424 | 55873424 | T | - | Frame_Shift_Del | p.I570fs | 1 |
| PNPT1 | SARC | chr2 | 55863457 | 55863457 | G | T | Missense_Mutation | 1 | |
| PNPT1 | BLCA | chr2 | 55920859 | 55920859 | G | T | Missense_Mutation | 1 | |
| PNPT1 | COAD | chr2 | 55867766 | 55867766 | C | T | Missense_Mutation | p.R715Q | 1 |
| PNPT1 | STAD | chr2 | 55874501 | 55874501 | C | T | Missense_Mutation | p.R528H | 1 |
| PNPT1 | HNSC | chr2 | 55874497 | 55874497 | C | T | Silent | p.L529L | 1 |
| PNPT1 | LIHC | chr2 | 55889160 | 55889160 | A | G | Missense_Mutation | 1 | |
| PNPT1 | LUSC | chr2 | 55899142 | 55899142 | G | A | Silent | p.Y302Y | 1 |
| PNPT1 | KIRP | chr2 | 55863462 | 55863462 | C | T | Silent | p.S754S | 1 |
| PNPT1 | SKCM | chr2 | 55913551 | 55913551 | G | A | Missense_Mutation | p.A84V | 1 |
| PNPT1 | STAD | chr2 | 55908054 | 55908054 | C | A | Splice_Site | p.V152_splice | 1 |
| PNPT1 | BLCA | chr2 | 55920859 | 55920859 | G | T | Missense_Mutation | p.Q34K | 1 |
| PNPT1 | HNSC | chr2 | 55914784 | 55914784 | A | G | Missense_Mutation | p.V73A | 1 |
| PNPT1 | LUAD | chr2 | 55908017 | 55908017 | C | A | Nonsense_Mutation | p.E164* | 1 |
Copy number variation (CNV) of PNPT1 * Click on the image to open the original image in a new window. |
![]() |
Fusion gene breakpoints (product of the structural variants (SVs)) across PNPT1 * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Fusion genes with this translation factor from FusionGDB2.0. |
| FusionGDB2 ID | Disease | Sample | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand |
| 84055 | N/A | CS190193 | HSP90AA1 | chr14 | 102551711 | + | PNPT1 | chr2 | 55906862 | - |
| 86765 | N/A | BF895069 | PNPT1 | chr2 | 55899697 | - | ASAP1 | chr8 | 131065683 | + |
| 100354 | STAD | TCGA-D7-A6F2 | PNPT1 | chr2 | 55910919 | - | FBXO11 | chr2 | 48050499 | - |
| 84055 | N/A | BI025641 | PNPT1 | chr2 | 55898480 | - | PNPT1 | chr2 | 55894144 | + |
| 84055 | N/A | BQ378709 | PNPT1 | chr2 | 55894211 | + | PNPT1 | chr2 | 55873579 | + |
| 84056 | LIHC | TCGA-UB-A7MB-01A | SMEK2 | chr2 | 55831114 | - | PNPT1 | chr2 | 55864734 | - |
Top |
|
Kaplan-Meier plots with logrank tests of overall survival (OS) |
![]() |
| Cancer type | Translation factor | Coefficent | Hazard ratio | Wald test pval | Likelihool ratio pval | Logrank test pval | # samples |
Top |
|
Differential gene expression between female and male. (Wilcoxon test, pval<0.05) |
![]() |
| Cancer type | Translation factor | pval | adj.p |
| LUAD | PNPT1 | 0.000325316908494329 | 0.0088 |
| LUSC | PNPT1 | 0.0116681303543322 | 0.3 |
| KIRC | PNPT1 | 0.0128867296072515 | 0.32 |
| GBM | PNPT1 | 0.0266263430559731 | 0.64 |
| KIRP | PNPT1 | 0.0332164779217466 | 0.76 |
| TGCT | PNPT1 | 2.44298208510894e-05 | 0.00068 |
Top |
|
Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05) |
![]() |
| Cancer type | Translation factor | pval | adj.p |
| STAD | PNPT1 | 0.020991766011156 | 0.63 |
| KIRC | PNPT1 | 0.00218349112160951 | 0.072 |
| BRCA | PNPT1 | 0.00928947499372885 | 0.29 |
| PAAD | PNPT1 | 0.00425016002710594 | 0.14 |
| ESCA | PNPT1 | 0.0316600278246185 | 0.92 |
Top |
|
Drugs targeting genes involved in this translation factor. (DrugBank Version 5.1.8 2021-05-08) |
| UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
|
Diseases associated with this translation factor. (DisGeNet 4.0) |
| Disease ID | Disease Name | # PubMeds | Disease source |
| C1824925 | DEAFNESS, AUTOSOMAL RECESSIVE 70 | 4 | CTD_human;GENOMICS_ENGLAND;UNIPROT |
| C3554129 | COMBINED OXIDATIVE PHOSPHORYLATION DEFICIENCY 13 | 4 | CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT |
| C0557874 | Global developmental delay | 1 | GENOMICS_ENGLAND |
| C1846647 | DEAFNESS, AUTOSOMAL RECESSIVE (disorder) | 1 | CLINGEN |
| C2239176 | Liver carcinoma | 1 | CTD_human |