|
||||||
|
Translation Factor: ALKBH1 (NCBI Gene ID:8846) |
|
Gene Summary |
| Gene Information | Gene Name: ALKBH1 | Gene ID: 8846 | Gene Symbol | ALKBH1 | Gene ID | 8846 |
| Gene Name | alkB homolog 1, histone H2A dioxygenase | |
| Synonyms | ABH|ABH1|ALKBH|alkB|hABH | |
| Cytomap | 14q24.3 | |
| Type of Gene | protein-coding | |
| Description | nucleic acid dioxygenase ALKBH1DNA 6mA demethylaseDNA N6-methyl adenine demethylaseDNA N6-methyl adenine demethylase ALKBH1DNA demethylase ALKBH1DNA lyase ABH1DNA oxidative demethylase ALKBH1alkB, alkylation repair homolog 1alkylated DNA repair pr | |
| Modification date | 20200313 | |
| UniProtAcc | Q13686 | |
Child GO biological process term(s) under GO:0006412 |
| GO ID | GO term |
| GO:0006417 | Regulation of translation |
| GO:0032543 | Mitochondrial translation |
| GO:0006414 | Translational elongation |
| GO:0006413 | Translational initiation |
| GO:0006412 | Translation |
Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | ALKBH1 | GO:0002101 | tRNA wobble cytosine modification | 27497299 |
| Hgene | ALKBH1 | GO:0006281 | DNA repair | 18603530|19959401 |
| Hgene | ALKBH1 | GO:0006307 | DNA dealkylation involved in DNA repair | 18603530 |
| Hgene | ALKBH1 | GO:0035513 | oxidative RNA demethylation | 31188562 |
| Hgene | ALKBH1 | GO:0042245 | RNA repair | 18603530 |
| Hgene | ALKBH1 | GO:0070989 | oxidative demethylation | 18603530 |
| Hgene | ALKBH1 | GO:0080111 | DNA demethylation | 18603530|30017583 |
| Hgene | ALKBH1 | GO:1990983 | tRNA demethylation | 27745969 |
Inferred gene age of translation factor. |
| Gene | Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25 |
| ALKBH1 | >1119.25 |
Top |
|
We searched PubMed using 'ALKBH1[title] AND translation [title] AND human.' |
| Gene | Title | PMID |
| ALKBH1 | ALKBH1-Mediated tRNA Demethylation Regulates Translation | 27745969 |
Top |
|
Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. For more annotations, please visit our ExonSkipDB. |
![]() |
Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure. * Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser. |
| ENST | Exon skip start (DNA) | Exon Skip end (DNA) | ORF |
| ENST00000216489 | 78141998 | 78142192 | Frame-shift |
| ENST00000216489 | 78161080 | 78161243 | Frame-shift |
Exon skipping position in the amino acid sequence. |
| ENST | Exon skip start (DNA) | Exon Skip end (DNA) | Len(transcript seq) | Exon skip start (mRNA) | Exon Skip end (mRNA) | Len(amino acid seq) | Exon skip start (AA) | Exon Skip end (AA) |
Potentially (partially) lost protein functional features of UniProt. |
| UniProtAcc | Exon skip start (AA) | Exon Skip end (AA) | Function feature start (AA) | Function feature end (AA) | Functional feature type | Functional feature desc. |
Top |
|
Gene expression level across TCGA pancancer |
![]() |
Gene expression level across GTEx pantissue |
![]() |
Expression level of gene isoforms across TCGA pancancer |
![]() |
Expression level of gene isoforms across GTEx pantissue |
![]() |
Cancer(tissue) type-specific expression level of Translation factor using z-score distriution |
![]() |
Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples) |
![]() |
| Cancer type | Translation factor | FC | adj.pval |
| HNSC | ALKBH1 | -2.39538842109683 | 0.00633394569399571 |
Top |
|
Translation factor expression regulation through miRNA binding |
| Cancer type | Gene | miRNA | TargetScan binding score (Context++ score percentile) | Coefficient | Pvalue |
| LIHC | ALKBH1 | hsa-let-7d-5p | 87 | -0.302697302697303 | 0.00766371232673974 |
Translation factor expression regulation through methylation in the promoter of Translation factor |
| Cancer type | Gene | methyl group b | methyl group a | DEG pval | avg methyl in b | avg methyl in a | avg exp in b | avg exp in a |
Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation) |
| Cancer type | Gene | methyl group b | methyl group a | DEG pval | avg methyl in b | avg methyl in a | avg exp in b | avg exp in a |
Translation factor expression regulation through copy number variation of Translation factor |
| Cancer type | Gene | Coefficient | Pvalue |
| OV | ALKBH1 | -0.139041295 | 0.003887457 |
| THYM | ALKBH1 | -0.192528441 | 0.028288365 |
Top |
|
Strongly correlated genes belong to cellular important gene groups with ALKBH1 (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green) |
![]() |
| Cancer type | Gene group | Translation factor | Correlated gene | Coefficient | Pvalue |
| GBM | Cell metabolism gene | ALKBH1 | TIMM9 | 0.811483232 | 1.63E-41 |
| GBM | TF | ALKBH1 | ZNF410 | 0.836908598 | 2.32E-46 |
| MESO | Cell metabolism gene | ALKBH1 | MED6 | 0.824378976 | 1.02E-22 |
Top |
|
Protein 3D structureVisit iCn3D. |
Top |
|
Protein-protein interaction networks * Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P)) |
![]() |
Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P)) |
![]() |
![]() * Edge colors based on TCGA cancer types. |
* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P)) |
![]() |
| Cancer type | Translation factor | Interacting protein coding gene | FC | adj.pval |
| KIRP | ALKBH1 | ALKBH6 | -1.38137046714033 | 0.000121572986245155 |
| KIRP | ALKBH1 | TRMT6 | 2.38633822741832 | 0.000306400004774332 |
| STAD | ALKBH1 | ALKBH7 | -2.25872042192086 | 0.000306400004774332 |
| COAD | ALKBH1 | ALKBH5 | 2.13755552147488 | 0.000465095043182374 |
| KIRP | ALKBH1 | JMJD4 | -3.2537264485144 | 0.000557802151888609 |
| ESCA | ALKBH1 | TRMT6 | -3.11677766247045 | 0.0009765625 |
| KICH | ALKBH1 | JMJD4 | 1.33463623165322 | 0.00225526094436645 |
| CHOL | ALKBH1 | ALKBH7 | -3.13918152894388 | 0.00390625 |
| BLCA | ALKBH1 | ALKBH4 | -3.09121621432787 | 0.0061798095703125 |
| LUAD | ALKBH1 | ALKBH7 | 1.30688246148035 | 0.00627510264512955 |
| COAD | ALKBH1 | ALKBH7 | -1.25428328459223 | 0.00793844461441041 |
| BLCA | ALKBH1 | JMJD4 | -1.52263606208823 | 0.0180816650390625 |
| ESCA | ALKBH1 | ALKBH7 | 2.56033602674724 | 0.0244140625 |
| READ | ALKBH1 | ALKBH5 | 2.44404366714817 | 0.03125 |
| HNSC | ALKBH1 | JMJD4 | -5.92733825731434 | 0.049041343804447 |
| THCA | ALKBH1 | ALKBH8 | -1.13053159239926 | 1.14647631279e-06 |
| COAD | ALKBH1 | JMJD4 | -2.34879785772121 | 1.2814998626709e-06 |
| THCA | ALKBH1 | ALKBH5 | -1.26370742071388 | 1.35265985423686e-05 |
| LIHC | ALKBH1 | ALKBH4 | -5.24591243575096 | 1.3992718911716e-05 |
| STAD | ALKBH1 | TRMT6 | -5.42863470282606 | 1.42958015203476e-07 |
| LUSC | ALKBH1 | ALKBH2 | -5.38089125269464 | 1.45947399043856e-08 |
| LUAD | ALKBH1 | ALKBH4 | -1.40168394799171 | 1.61427770148041e-05 |
| BRCA | ALKBH1 | FTO | -2.09494010696594 | 3.14552302519821e-23 |
| LIHC | ALKBH1 | TRMT6 | -1.33049543742613 | 3.4520382341717e-07 |
| LUSC | ALKBH1 | ALKBH4 | -2.27982380458137 | 3.67421243367441e-07 |
| KIRC | ALKBH1 | ALKBH2 | -1.23743665722348 | 3.85916186028018e-07 |
| PRAD | ALKBH1 | JMJD4 | 1.89663309867934 | 4.73386230374949e-06 |
| KIRC | ALKBH1 | FTO | 1.08234124384934 | 4.81926317698848e-12 |
| HNSC | ALKBH1 | ALKBH6 | -1.70752653255 | 4.83197595713137e-06 |
| KIRC | ALKBH1 | ALKBH5 | 1.22008443269992 | 8.228320553924e-07 |
Protein-protein interactors with this translation factor (BIOGRID-3.4.160) |
| PPI interactors with ALKBH1 |
| DNAJB6, MYC, PSMD14, RAB20, |
Top |
|
Clinically associated variants from ClinVar. |
| Gene | Chr | Position | RefSeq | VarSeq | RefSeeq | VarType | Pathogenic | Disease | VarInfo |
nsSNVs with sample frequency (size of circle) from TCGA 33 cancers. |
SNVs and Indels |
| Gene | Cancer type | Chromosome | Start | End | RefSeeq | MutSeq | Mutation type | AAchange | # samples |
| ALKBH1 | SKCM | chr14 | 78142163 | 78142163 | G | A | Silent | p.F192F | 4 |
| ALKBH1 | PRAD | chr14 | 78140481 | 78140481 | T | C | Missense_Mutation | p.S282G | 4 |
| ALKBH1 | UCEC | chr14 | 78146249 | 78146249 | C | A | Missense_Mutation | p.G174C | 3 |
| ALKBH1 | PAAD | chr14 | 78142126 | 78142126 | C | T | Missense_Mutation | p.A205T | 3 |
| ALKBH1 | HNSC | chr14 | 78161201 | 78161201 | C | T | Nonsense_Mutation | p.W112* | 3 |
| ALKBH1 | ESCA | chr14 | 78142116 | 78142116 | C | A | Missense_Mutation | p.G208V | 3 |
| ALKBH1 | PRAD | chr14 | 78174327 | 78174327 | G | A | Silent | p.A7A | 3 |
| ALKBH1 | ACC | chr14 | 78161095 | 78161095 | G | T | Missense_Mutation | p.S147R | 3 |
| ALKBH1 | BRCA | chr14 | 78140379 | 78140379 | C | G | Missense_Mutation | p.D316H | 3 |
| ALKBH1 | LUAD | chr14 | 78174335 | 78174335 | C | A | Missense_Mutation | p.A5S | 2 |
| ALKBH1 | STAD | chr14 | 78146294 | 78146294 | G | A | Missense_Mutation | p.R159W | 2 |
| ALKBH1 | UCEC | chr14 | 78142127 | 78142127 | G | A | Silent | p.A204 | 2 |
| ALKBH1 | SKCM | chr14 | 78174266 | 78174266 | G | A | Missense_Mutation | p.R28C | 2 |
| ALKBH1 | LUAD | chr14 | 78140367 | 78140367 | C | A | Nonsense_Mutation | p.E320* | 2 |
| ALKBH1 | UCEC | chr14 | 78161164 | 78161164 | C | A | Missense_Mutation | p.Q124H | 2 |
| ALKBH1 | PCPG | chr14 | 78174291 | 78174291 | C | T | Silent | 2 | |
| ALKBH1 | SKCM | chr14 | 78170753 | 78170753 | G | A | Missense_Mutation | p.P84L | 2 |
| ALKBH1 | TGCT | chr14 | 78140329 | 78140329 | G | A | Silent | 2 | |
| ALKBH1 | PCPG | chr14 | 78174291 | 78174291 | C | T | Silent | p.G19G | 2 |
| ALKBH1 | HNSC | chr14 | 78146284 | 78146284 | C | T | Missense_Mutation | p.R162Q | 2 |
| ALKBH1 | SKCM | chr14 | 78140264 | 78140264 | G | A | Missense_Mutation | p.P354L | 2 |
| ALKBH1 | BLCA | chr14 | 78140190 | 78140190 | C | T | Missense_Mutation | p.E379K | 2 |
| ALKBH1 | LUAD | chr14 | 78140172 | 78140172 | T | A | Missense_Mutation | p.I385L | 2 |
| ALKBH1 | STAD | chr14 | 78140396 | 78140396 | G | T | Missense_Mutation | 2 | |
| ALKBH1 | LUAD | chr14 | 78161119 | 78161119 | C | G | Missense_Mutation | p.E139D | 2 |
| ALKBH1 | STAD | chr14 | 78140396 | 78140396 | G | T | Missense_Mutation | p.P310H | 2 |
| ALKBH1 | ESCA | chr14 | 78142116 | 78142116 | C | A | Missense_Mutation | 2 | |
| ALKBH1 | SARC | chr14 | 78170719 | 78170719 | G | T | Silent | 2 | |
| ALKBH1 | STAD | chr14 | 78174328 | 78174328 | G | A | Missense_Mutation | p.A7V | 2 |
| ALKBH1 | BLCA | chr14 | 78174278 | 78174278 | G | A | Missense_Mutation | 2 | |
| ALKBH1 | STAD | chr14 | 78140225 | 78140225 | G | A | Missense_Mutation | p.T367I | 2 |
| ALKBH1 | CESC | chr14 | 78142096 | 78142096 | C | T | Missense_Mutation | 2 | |
| ALKBH1 | SKCM | chr14 | 78140470 | 78140470 | C | G | Missense_Mutation | p.L285F | 2 |
| ALKBH1 | STAD | chr14 | 78140528 | 78140528 | G | A | Missense_Mutation | p.T266M | 2 |
| ALKBH1 | PAAD | chr14 | 78142126 | 78142126 | C | T | Missense_Mutation | 2 | |
| ALKBH1 | SKCM | chr14 | 78174243 | 78174243 | G | T | Silent | p.P35P | 2 |
| ALKBH1 | STAD | chr14 | 78174225 | 78174225 | T | G | Missense_Mutation | p.E41D | 2 |
| ALKBH1 | CESC | chr14 | 78140375 | 78140375 | G | T | Nonsense_Mutation | 1 | |
| ALKBH1 | HNSC | chr14 | 78140550 | 78140550 | G | A | Missense_Mutation | 1 | |
| ALKBH1 | SKCM | chr14 | 78170727 | 78170727 | G | A | Missense_Mutation | p.L93F | 1 |
| ALKBH1 | BLCA | chr14 | 78174299 | 78174299 | C | T | Missense_Mutation | 1 | |
| ALKBH1 | CESC | chr14 | 78142096 | 78142096 | C | T | Missense_Mutation | p.E215K | 1 |
| ALKBH1 | PAAD | chr14 | 78174236 | 78174236 | C | T | Missense_Mutation | p.A38T | 1 |
| ALKBH1 | HNSC | chr14 | 78146284 | 78146284 | C | T | Missense_Mutation | 1 | |
| ALKBH1 | SKCM | chr14 | 78161215 | 78161215 | G | A | Silent | p.L107L | 1 |
| ALKBH1 | BLCA | chr14 | 78140405 | 78140405 | G | T | Missense_Mutation | 1 | |
| ALKBH1 | STAD | chr14 | 78146264 | 78146264 | G | A | Missense_Mutation | p.R169C | 1 |
| ALKBH1 | COAD | chr14 | 78140329 | 78140329 | G | A | Silent | p.S332S | 1 |
| ALKBH1 | SKCM | chr14 | 78170732 | 78170732 | T | A | Missense_Mutation | p.Y91F | 1 |
| ALKBH1 | BLCA | chr14 | 78174278 | 78174278 | G | A | Missense_Mutation | p.R24W | 1 |
| ALKBH1 | LUAD | chr14 | 78142091 | 78142091 | T | A | Silent | p.A216A | 1 |
| ALKBH1 | COAD | chr14 | 78140355 | 78140355 | T | A | Missense_Mutation | p.M324L | 1 |
| ALKBH1 | SKCM | chr14 | 78146285 | 78146285 | G | A | Nonsense_Mutation | p.R162X | 1 |
| ALKBH1 | SKCM | chr14 | 78174204 | 78174204 | C | T | Silent | p.A48A | 1 |
| ALKBH1 | BLCA | chr14 | 78142082 | 78142082 | C | T | Silent | p.L219L | 1 |
| ALKBH1 | LUAD | chr14 | 78161091 | 78161091 | C | A | Nonsense_Mutation | p.E149* | 1 |
| ALKBH1 | TGCT | chr14 | 78140355 | 78140355 | T | A | Missense_Mutation | 1 | |
| ALKBH1 | DLBC | chr14 | 78174250 | 78174250 | C | T | Missense_Mutation | p.S33N | 1 |
| ALKBH1 | HNSC | chr14 | 78140550 | 78140550 | G | A | Missense_Mutation | p.L259F | 1 |
| ALKBH1 | SKCM | chr14 | 78170752 | 78170752 | G | A | Silent | p.P84P | 1 |
| ALKBH1 | THYM | chr14 | 78140165 | 78140165 | G | T | Missense_Mutation | 1 | |
| ALKBH1 | LGG | chr14 | 78142174 | 78142174 | A | G | Missense_Mutation | p.Y189H | 1 |
| ALKBH1 | BLCA | chr14 | 78174278 | 78174278 | G | T | Silent | p.R24R | 1 |
| ALKBH1 | THYM | chr14 | 78140573 | 78140573 | G | T | Missense_Mutation | 1 | |
| ALKBH1 | ESCA | chr14 | 78140430 | 78140430 | C | A | Nonsense_Mutation | p.E299* | 1 |
| ALKBH1 | PRAD | chr14 | 78161199 | 78161199 | G | A | Missense_Mutation | p.H113Y | 1 |
| ALKBH1 | SKCM | chr14 | 78146285 | 78146285 | G | A | Nonsense_Mutation | p.R162* | 1 |
| ALKBH1 | LGG | chr14 | 78161070 | 78161102 | ACAAGACTTACCTCAGGAACTCTTTGCTCTGTT | - | Splice_Site | p.145_splice | 1 |
| ALKBH1 | BLCA | chr14 | 78174299 | 78174299 | C | T | Missense_Mutation | p.E17K | 1 |
| ALKBH1 | LUAD | chr14 | 78140463 | 78140463 | C | A | Missense_Mutation | p.A288S | 1 |
| ALKBH1 | THYM | chr14 | 78140165 | 78140165 | G | T | Missense_Mutation | p.P387H | 1 |
| ALKBH1 | SKCM | chr14 | 78174202 | 78174202 | G | A | Missense_Mutation | p.A49V | 1 |
| ALKBH1 | LGG | chr14 | 78142174 | 78142174 | A | G | Missense_Mutation | 1 | |
| ALKBH1 | OV | chr14 | 78161112 | 78161112 | C | T | Missense_Mutation | p.D142N | 1 |
| ALKBH1 | THYM | chr14 | 78140573 | 78140573 | G | T | Missense_Mutation | p.S251Y | 1 |
| ALKBH1 | ESCA | chr14 | 78140430 | 78140430 | C | A | Nonsense_Mutation | p.E299X | 1 |
| ALKBH1 | SARC | chr14 | 78170757 | 78170757 | G | T | Missense_Mutation | 1 | |
| ALKBH1 | SKCM | chr14 | 78174201 | 78174201 | G | A | Silent | p.A49A | 1 |
| ALKBH1 | LIHC | chr14 | 78170791 | 78170791 | A | G | Silent | 1 | |
| ALKBH1 | OV | chr14 | 77230987 | 77230987 | A | C | Missense_Mutation | p.F101C | 1 |
| ALKBH1 | THYM | chr14 | 78174284 | 78174284 | C | T | Missense_Mutation | p.A22T | 1 |
| ALKBH1 | GBM | chr14 | 78140215 | 78140215 | G | T | Missense_Mutation | 1 | |
| ALKBH1 | SKCM | chr14 | 78146240 | 78146240 | A | G | Missense_Mutation | p.Y177H | 1 |
| ALKBH1 | BLCA | chr14 | 78142082 | 78142082 | C | T | Silent | 1 | |
| ALKBH1 | LIHC | chr14 | 78140238 | 78140238 | T | - | Frame_Shift_Del | p.R363fs | 1 |
| ALKBH1 | CESC | chr14 | 78140250 | 78140250 | C | G | Missense_Mutation | 1 | |
| ALKBH1 | UCEC | chr14 | 78140489 | 78140489 | G | A | Missense_Mutation | p.S279L | 1 |
| ALKBH1 | HNSC | chr14 | 78161147 | 78161147 | T | A | Missense_Mutation | 1 | |
| ALKBH1 | SKCM | chr14 | 78142103 | 78142103 | G | A | Silent | p.F212F | 1 |
| ALKBH1 | BLCA | chr14 | 78140190 | 78140190 | C | T | Missense_Mutation | 1 | |
| ALKBH1 | LIHC | chr14 | 78161103 | 78161103 | C | - | Frame_Shift_Del | p.E145fs | 1 |
Copy number variation (CNV) of ALKBH1 * Click on the image to open the original image in a new window. |
![]() |
Fusion gene breakpoints (product of the structural variants (SVs)) across ALKBH1 * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Fusion genes with this translation factor from FusionGDB2.0. |
| FusionGDB2 ID | Disease | Sample | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand |
| 100023 | N/A | AA578610 | ALKBH1 | chr14 | 78151775 | - | COMMD1 | chr2 | 62363195 | - |
| 92760 | N/A | FN124628 | RILPL2 | chr12 | 123914496 | + | ALKBH1 | chr14 | 78152094 | + |
| 92760 | N/A | AW813119 | SIL1 | chr5 | 138442723 | + | ALKBH1 | chr14 | 78144525 | + |
| 92760 | N/A | AY358706 | TNMD | chrX | 99854882 | + | ALKBH1 | chr14 | 78144422 | + |
Top |
|
Kaplan-Meier plots with logrank tests of overall survival (OS) |
![]() |
| Cancer type | Translation factor | Coefficent | Hazard ratio | Wald test pval | Likelihool ratio pval | Logrank test pval | # samples |
Top |
|
Differential gene expression between female and male. (Wilcoxon test, pval<0.05) |
![]() |
| Cancer type | Translation factor | pval | adj.p |
| MESO | ALKBH1 | 0.0069187695133185 | 0.19 |
| HNSC | ALKBH1 | 0.00850972562634883 | 0.22 |
| LGG | ALKBH1 | 0.0101954996076687 | 0.25 |
| KIRP | ALKBH1 | 0.0138214598991418 | 0.33 |
| PCPG | ALKBH1 | 0.0475430696300034 | 1 |
| TGCT | ALKBH1 | 2.66795429658941e-05 | 0.00075 |
Top |
|
Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05) |
![]() |
| Cancer type | Translation factor | pval | adj.p |
| LUSC | ALKBH1 | 0.0202931495709543 | 0.61 |
| LGG | ALKBH1 | 0.0440861941332576 | 1 |
| UVM | ALKBH1 | 0.00507609561277463 | 0.16 |
| BLCA | ALKBH1 | 0.00079931193607281 | 0.026 |
| THYM | ALKBH1 | 0.00545825317361396 | 0.17 |
Top |
|
Drugs targeting genes involved in this translation factor. (DrugBank Version 5.1.8 2021-05-08) |
| UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
|
Diseases associated with this translation factor. (DisGeNet 4.0) |
| Disease ID | Disease Name | # PubMeds | Disease source |