Home

Download

Statistics

Examples

Help

Contact

	Gene Summary
	Translation studies in PubMed
	Exon Skipping Events
	Expression
	Expression Regulation
	Associated Genes
	Protein 3D Structure
	Protein-Protein Interaction
	Mutations
	Prognostic Analysis
	Gender Association
	Age Association
	Related Drugs
	Related Diseases

Translation Factor: ALKBH1 (NCBI Gene ID:8846)

Gene Summary

Gene Summary

Gene Information	Gene Name: ALKBH1
	Gene ID: 8846
	Gene Symbol	ALKBH1
	Gene ID	8846
	Gene Name	alkB homolog 1, histone H2A dioxygenase
	Synonyms	ABH\|ABH1\|ALKBH\|alkB\|hABH
	Cytomap	14q24.3
	Type of Gene	protein-coding
	Description	nucleic acid dioxygenase ALKBH1DNA 6mA demethylaseDNA N6-methyl adenine demethylaseDNA N6-methyl adenine demethylase ALKBH1DNA demethylase ALKBH1DNA lyase ABH1DNA oxidative demethylase ALKBH1alkB, alkylation repair homolog 1alkylated DNA repair pr
	Modification date	20200313
	UniProtAcc	Q13686

Child GO biological process term(s) under GO:0006412

GO ID	GO term
GO:0006417	Regulation of translation
GO:0032543	Mitochondrial translation
GO:0006414	Translational elongation
GO:0006413	Translational initiation
GO:0006412	Translation

Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	ALKBH1	GO:0002101	tRNA wobble cytosine modification	27497299
Hgene	ALKBH1	GO:0006281	DNA repair	18603530\|19959401
Hgene	ALKBH1	GO:0006307	DNA dealkylation involved in DNA repair	18603530
Hgene	ALKBH1	GO:0035513	oxidative RNA demethylation	31188562
Hgene	ALKBH1	GO:0042245	RNA repair	18603530
Hgene	ALKBH1	GO:0070989	oxidative demethylation	18603530
Hgene	ALKBH1	GO:0080111	DNA demethylation	18603530\|30017583
Hgene	ALKBH1	GO:1990983	tRNA demethylation	27745969

Inferred gene age of translation factor.

Gene	Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25
ALKBH1	>1119.25

Top

Translation Studies in PubMed

We searched PubMed using 'ALKBH1[title] AND translation [title] AND human.'

Gene	Title	PMID
ALKBH1	ALKBH1-Mediated tRNA Demethylation Regulates Translation	27745969

Top

Exon Skipping Events

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.
For more annotations, please visit our ExonSkipDB.

Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.

ENST	Exon skip start (DNA)	Exon Skip end (DNA)	ORF
ENST00000216489	78141998	78142192	Frame-shift
ENST00000216489	78161080	78161243	Frame-shift

Exon skipping position in the amino acid sequence.

ENST

Exon skip start (DNA)

Exon Skip end (DNA)

Len(transcript seq)

Exon skip start (mRNA)

Exon Skip end (mRNA)

Len(amino acid seq)

Exon skip start (AA)

Exon Skip end (AA)

Potentially (partially) lost protein functional features of UniProt.

UniProtAcc

Exon skip start (AA)

Exon Skip end (AA)

Function feature start (AA)

Function feature end (AA)

Functional feature type

Functional feature desc.

Top

Expression

Gene expression level across TCGA pancancer

Gene expression level across GTEx pantissue

Expression level of gene isoforms across TCGA pancancer

Expression level of gene isoforms across GTEx pantissue

Cancer(tissue) type-specific expression level of Translation factor using z-score distriution

Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples)

Cancer type	Translation factor	FC	adj.pval
HNSC	ALKBH1	-2.39538842109683	0.00633394569399571

Top

Expression Regulation

Translation factor expression regulation through miRNA binding

Cancer type	Gene	miRNA	TargetScan binding score (Context++ score percentile)	Coefficient	Pvalue
LIHC	ALKBH1	hsa-let-7d-5p	87	-0.302697302697303	0.00766371232673974

Translation factor expression regulation through methylation in the promoter of Translation factor

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation)

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through copy number variation of Translation factor

Cancer type	Gene	Coefficient	Pvalue
OV	ALKBH1	-0.139041295	0.003887457
THYM	ALKBH1	-0.192528441	0.028288365

Top

Associated Genes

Strongly correlated genes belong to cellular important gene groups with ALKBH1 (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green)

Cancer type	Gene group	Translation factor	Correlated gene	Coefficient	Pvalue
GBM	Cell metabolism gene	ALKBH1	TIMM9	0.811483232	1.63E-41
GBM	TF	ALKBH1	ZNF410	0.836908598	2.32E-46
MESO	Cell metabolism gene	ALKBH1	MED6	0.824378976	1.02E-22

Top

Protein structure

Protein 3D structure
Visit iCn3D.

Top

Protein-Protein Interaction

Protein-protein interaction networks
* Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

* Edge colors based on TCGA cancer types.

* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P))

Cancer type	Translation factor	Interacting protein coding gene	FC	adj.pval
KIRP	ALKBH1	ALKBH6	-1.38137046714033	0.000121572986245155
KIRP	ALKBH1	TRMT6	2.38633822741832	0.000306400004774332
STAD	ALKBH1	ALKBH7	-2.25872042192086	0.000306400004774332
COAD	ALKBH1	ALKBH5	2.13755552147488	0.000465095043182374
KIRP	ALKBH1	JMJD4	-3.2537264485144	0.000557802151888609
ESCA	ALKBH1	TRMT6	-3.11677766247045	0.0009765625
KICH	ALKBH1	JMJD4	1.33463623165322	0.00225526094436645
CHOL	ALKBH1	ALKBH7	-3.13918152894388	0.00390625
BLCA	ALKBH1	ALKBH4	-3.09121621432787	0.0061798095703125
LUAD	ALKBH1	ALKBH7	1.30688246148035	0.00627510264512955
COAD	ALKBH1	ALKBH7	-1.25428328459223	0.00793844461441041
BLCA	ALKBH1	JMJD4	-1.52263606208823	0.0180816650390625
ESCA	ALKBH1	ALKBH7	2.56033602674724	0.0244140625
READ	ALKBH1	ALKBH5	2.44404366714817	0.03125
HNSC	ALKBH1	JMJD4	-5.92733825731434	0.049041343804447
THCA	ALKBH1	ALKBH8	-1.13053159239926	1.14647631279e-06
COAD	ALKBH1	JMJD4	-2.34879785772121	1.2814998626709e-06
THCA	ALKBH1	ALKBH5	-1.26370742071388	1.35265985423686e-05
LIHC	ALKBH1	ALKBH4	-5.24591243575096	1.3992718911716e-05
STAD	ALKBH1	TRMT6	-5.42863470282606	1.42958015203476e-07
LUSC	ALKBH1	ALKBH2	-5.38089125269464	1.45947399043856e-08
LUAD	ALKBH1	ALKBH4	-1.40168394799171	1.61427770148041e-05
BRCA	ALKBH1	FTO	-2.09494010696594	3.14552302519821e-23
LIHC	ALKBH1	TRMT6	-1.33049543742613	3.4520382341717e-07
LUSC	ALKBH1	ALKBH4	-2.27982380458137	3.67421243367441e-07
KIRC	ALKBH1	ALKBH2	-1.23743665722348	3.85916186028018e-07
PRAD	ALKBH1	JMJD4	1.89663309867934	4.73386230374949e-06
KIRC	ALKBH1	FTO	1.08234124384934	4.81926317698848e-12
HNSC	ALKBH1	ALKBH6	-1.70752653255	4.83197595713137e-06
KIRC	ALKBH1	ALKBH5	1.22008443269992	8.228320553924e-07

Protein-protein interactors with this translation factor (BIOGRID-3.4.160)

PPI interactors with ALKBH1

DNAJB6, MYC, PSMD14, RAB20,

Top

Mutations

Clinically associated variants from ClinVar.

Gene

Chr

Position

RefSeq

VarSeq

RefSeeq

VarType

Pathogenic

Disease

VarInfo

nsSNVs with sample frequency (size of circle) from TCGA 33 cancers.

SNVs and Indels

Gene	Cancer type	Chromosome	Start	End	RefSeeq	MutSeq	Mutation type	AAchange	# samples
ALKBH1	SKCM	chr14	78142163	78142163	G	A	Silent	p.F192F	4
ALKBH1	PRAD	chr14	78140481	78140481	T	C	Missense_Mutation	p.S282G	4
ALKBH1	UCEC	chr14	78146249	78146249	C	A	Missense_Mutation	p.G174C	3
ALKBH1	PAAD	chr14	78142126	78142126	C	T	Missense_Mutation	p.A205T	3
ALKBH1	HNSC	chr14	78161201	78161201	C	T	Nonsense_Mutation	p.W112*	3
ALKBH1	ESCA	chr14	78142116	78142116	C	A	Missense_Mutation	p.G208V	3
ALKBH1	PRAD	chr14	78174327	78174327	G	A	Silent	p.A7A	3
ALKBH1	ACC	chr14	78161095	78161095	G	T	Missense_Mutation	p.S147R	3
ALKBH1	BRCA	chr14	78140379	78140379	C	G	Missense_Mutation	p.D316H	3
ALKBH1	LUAD	chr14	78174335	78174335	C	A	Missense_Mutation	p.A5S	2
ALKBH1	STAD	chr14	78146294	78146294	G	A	Missense_Mutation	p.R159W	2
ALKBH1	UCEC	chr14	78142127	78142127	G	A	Silent	p.A204	2
ALKBH1	SKCM	chr14	78174266	78174266	G	A	Missense_Mutation	p.R28C	2
ALKBH1	LUAD	chr14	78140367	78140367	C	A	Nonsense_Mutation	p.E320*	2
ALKBH1	UCEC	chr14	78161164	78161164	C	A	Missense_Mutation	p.Q124H	2
ALKBH1	PCPG	chr14	78174291	78174291	C	T	Silent		2
ALKBH1	SKCM	chr14	78170753	78170753	G	A	Missense_Mutation	p.P84L	2
ALKBH1	TGCT	chr14	78140329	78140329	G	A	Silent		2
ALKBH1	PCPG	chr14	78174291	78174291	C	T	Silent	p.G19G	2
ALKBH1	HNSC	chr14	78146284	78146284	C	T	Missense_Mutation	p.R162Q	2
ALKBH1	SKCM	chr14	78140264	78140264	G	A	Missense_Mutation	p.P354L	2
ALKBH1	BLCA	chr14	78140190	78140190	C	T	Missense_Mutation	p.E379K	2
ALKBH1	LUAD	chr14	78140172	78140172	T	A	Missense_Mutation	p.I385L	2
ALKBH1	STAD	chr14	78140396	78140396	G	T	Missense_Mutation		2
ALKBH1	LUAD	chr14	78161119	78161119	C	G	Missense_Mutation	p.E139D	2
ALKBH1	STAD	chr14	78140396	78140396	G	T	Missense_Mutation	p.P310H	2
ALKBH1	SARC	chr14	78170719	78170719	G	T	Silent		2
ALKBH1	ESCA	chr14	78142116	78142116	C	A	Missense_Mutation		2
ALKBH1	STAD	chr14	78174328	78174328	G	A	Missense_Mutation	p.A7V	2
ALKBH1	BLCA	chr14	78174278	78174278	G	A	Missense_Mutation		2
ALKBH1	STAD	chr14	78140225	78140225	G	A	Missense_Mutation	p.T367I	2
ALKBH1	CESC	chr14	78142096	78142096	C	T	Missense_Mutation		2
ALKBH1	SKCM	chr14	78140470	78140470	C	G	Missense_Mutation	p.L285F	2
ALKBH1	STAD	chr14	78140528	78140528	G	A	Missense_Mutation	p.T266M	2
ALKBH1	PAAD	chr14	78142126	78142126	C	T	Missense_Mutation		2
ALKBH1	SKCM	chr14	78174243	78174243	G	T	Silent	p.P35P	2
ALKBH1	STAD	chr14	78174225	78174225	T	G	Missense_Mutation	p.E41D	2
ALKBH1	CESC	chr14	78140375	78140375	G	T	Nonsense_Mutation		1
ALKBH1	HNSC	chr14	78140550	78140550	G	A	Missense_Mutation		1
ALKBH1	SKCM	chr14	78170727	78170727	G	A	Missense_Mutation	p.L93F	1
ALKBH1	BLCA	chr14	78174299	78174299	C	T	Missense_Mutation		1
ALKBH1	CESC	chr14	78142096	78142096	C	T	Missense_Mutation	p.E215K	1
ALKBH1	PAAD	chr14	78174236	78174236	C	T	Missense_Mutation	p.A38T	1
ALKBH1	HNSC	chr14	78146284	78146284	C	T	Missense_Mutation		1
ALKBH1	SKCM	chr14	78161215	78161215	G	A	Silent	p.L107L	1
ALKBH1	BLCA	chr14	78140405	78140405	G	T	Missense_Mutation		1
ALKBH1	STAD	chr14	78146264	78146264	G	A	Missense_Mutation	p.R169C	1
ALKBH1	COAD	chr14	78140329	78140329	G	A	Silent	p.S332S	1
ALKBH1	SKCM	chr14	78170732	78170732	T	A	Missense_Mutation	p.Y91F	1
ALKBH1	BLCA	chr14	78174278	78174278	G	A	Missense_Mutation	p.R24W	1
ALKBH1	LUAD	chr14	78142091	78142091	T	A	Silent	p.A216A	1
ALKBH1	COAD	chr14	78140355	78140355	T	A	Missense_Mutation	p.M324L	1
ALKBH1	SKCM	chr14	78146285	78146285	G	A	Nonsense_Mutation	p.R162X	1
ALKBH1	SKCM	chr14	78174204	78174204	C	T	Silent	p.A48A	1
ALKBH1	BLCA	chr14	78142082	78142082	C	T	Silent	p.L219L	1
ALKBH1	LUAD	chr14	78161091	78161091	C	A	Nonsense_Mutation	p.E149*	1
ALKBH1	TGCT	chr14	78140355	78140355	T	A	Missense_Mutation		1
ALKBH1	DLBC	chr14	78174250	78174250	C	T	Missense_Mutation	p.S33N	1
ALKBH1	HNSC	chr14	78140550	78140550	G	A	Missense_Mutation	p.L259F	1
ALKBH1	SKCM	chr14	78170752	78170752	G	A	Silent	p.P84P	1
ALKBH1	THYM	chr14	78140165	78140165	G	T	Missense_Mutation		1
ALKBH1	LGG	chr14	78142174	78142174	A	G	Missense_Mutation	p.Y189H	1
ALKBH1	BLCA	chr14	78174278	78174278	G	T	Silent	p.R24R	1
ALKBH1	THYM	chr14	78140573	78140573	G	T	Missense_Mutation		1
ALKBH1	SKCM	chr14	78146285	78146285	G	A	Nonsense_Mutation	p.R162*	1
ALKBH1	ESCA	chr14	78140430	78140430	C	A	Nonsense_Mutation	p.E299*	1
ALKBH1	PRAD	chr14	78161199	78161199	G	A	Missense_Mutation	p.H113Y	1
ALKBH1	LGG	chr14	78161070	78161102	ACAAGACTTACCTCAGGAACTCTTTGCTCTGTT	-	Splice_Site	p.145_splice	1
ALKBH1	THYM	chr14	78140165	78140165	G	T	Missense_Mutation	p.P387H	1
ALKBH1	BLCA	chr14	78174299	78174299	C	T	Missense_Mutation	p.E17K	1
ALKBH1	LUAD	chr14	78140463	78140463	C	A	Missense_Mutation	p.A288S	1
ALKBH1	SKCM	chr14	78174202	78174202	G	A	Missense_Mutation	p.A49V	1
ALKBH1	LGG	chr14	78142174	78142174	A	G	Missense_Mutation		1
ALKBH1	THYM	chr14	78140573	78140573	G	T	Missense_Mutation	p.S251Y	1
ALKBH1	OV	chr14	78161112	78161112	C	T	Missense_Mutation	p.D142N	1
ALKBH1	ESCA	chr14	78140430	78140430	C	A	Nonsense_Mutation	p.E299X	1
ALKBH1	SARC	chr14	78170757	78170757	G	T	Missense_Mutation		1
ALKBH1	SKCM	chr14	78174201	78174201	G	A	Silent	p.A49A	1
ALKBH1	LIHC	chr14	78170791	78170791	A	G	Silent		1
ALKBH1	THYM	chr14	78174284	78174284	C	T	Missense_Mutation	p.A22T	1
ALKBH1	OV	chr14	77230987	77230987	A	C	Missense_Mutation	p.F101C	1
ALKBH1	GBM	chr14	78140215	78140215	G	T	Missense_Mutation		1
ALKBH1	SKCM	chr14	78146240	78146240	A	G	Missense_Mutation	p.Y177H	1
ALKBH1	BLCA	chr14	78142082	78142082	C	T	Silent		1
ALKBH1	LIHC	chr14	78140238	78140238	T	-	Frame_Shift_Del	p.R363fs	1
ALKBH1	UCEC	chr14	78140489	78140489	G	A	Missense_Mutation	p.S279L	1
ALKBH1	CESC	chr14	78140250	78140250	C	G	Missense_Mutation		1
ALKBH1	HNSC	chr14	78161147	78161147	T	A	Missense_Mutation		1
ALKBH1	SKCM	chr14	78142103	78142103	G	A	Silent	p.F212F	1
ALKBH1	BLCA	chr14	78140190	78140190	C	T	Missense_Mutation		1
ALKBH1	LIHC	chr14	78161103	78161103	C	-	Frame_Shift_Del	p.E145fs	1

Copy number variation (CNV) of ALKBH1
* Click on the image to open the original image in a new window.

Fusion gene breakpoints (product of the structural variants (SVs)) across ALKBH1
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion genes with this translation factor from FusionGDB2.0.

FusionGDB2 ID	Disease	Sample	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand
100023	N/A	AA578610	ALKBH1	chr14	78151775	-	COMMD1	chr2	62363195	-
92760	N/A	FN124628	RILPL2	chr12	123914496	+	ALKBH1	chr14	78152094	+
92760	N/A	AW813119	SIL1	chr5	138442723	+	ALKBH1	chr14	78144525	+
92760	N/A	AY358706	TNMD	chrX	99854882	+	ALKBH1	chr14	78144422	+

Top

Prognostic Analysis

Kaplan-Meier plots with logrank tests of overall survival (OS)

Cancer type

Translation factor

Coefficent

Hazard ratio

Wald test pval

Likelihool ratio pval

Logrank test pval

# samples

Top

Translation factor and Gender

Differential gene expression between female and male. (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
MESO	ALKBH1	0.0069187695133185	0.19
HNSC	ALKBH1	0.00850972562634883	0.22
LGG	ALKBH1	0.0101954996076687	0.25
KIRP	ALKBH1	0.0138214598991418	0.33
PCPG	ALKBH1	0.0475430696300034	1
TGCT	ALKBH1	2.66795429658941e-05	0.00075

Top

Translation factor and Age

Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
LUSC	ALKBH1	0.0202931495709543	0.61
LGG	ALKBH1	0.0440861941332576	1
UVM	ALKBH1	0.00507609561277463	0.16
BLCA	ALKBH1	0.00079931193607281	0.026
THYM	ALKBH1	0.00545825317361396	0.17

Top

Related Drugs

Drugs targeting genes involved in this translation factor.
(DrugBank Version 5.1.8 2021-05-08)

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

Related Diseases

Diseases associated with this translation factor.
(DisGeNet 4.0)

Disease ID

Disease Name

# PubMeds

Disease source