|
|||||||
|
Fusion Protein:FGFR2-C10orf118 |
Fusion Gene and Fusion Protein Summary |
Fusion gene summary |
| Fusion partner gene information | Fusion gene name: FGFR2-C10orf118 | FusionPDB ID: 30278 | FusionGDB2.0 ID: 30281 | Hgene | Tgene | Gene symbol | FGFR2 | C10orf118 | Gene ID | 2263 | 55088 |
| Gene name | fibroblast growth factor receptor 2 | coiled-coil domain containing 186 | |
| Synonyms | BBDS|BEK|BFR-1|CD332|CEK3|CFD1|ECT1|JWS|K-SAM|KGFR|TK14|TK25 | C10orf118|CCCP-1|golgin104 | |
| Cytomap | 10q26.13 | 10q25.3 | |
| Type of gene | protein-coding | protein-coding | |
| Description | fibroblast growth factor receptor 2BEK fibroblast growth factor receptorbacteria-expressed kinasekeratinocyte growth factor receptorprotein tyrosine kinase, receptor like 14 | coiled-coil domain-containing protein 186CTCL tumor antigen HD-CL-01/L14-2CTCL tumor antigen L14-2 | |
| Modification date | 20200322 | 20200313 | |
| UniProtAcc | P21802 Main function of 5'-partner protein: FUNCTION: Tyrosine-protein kinase that acts as cell-surface receptor for fibroblast growth factors and plays an essential role in the regulation of cell proliferation, differentiation, migration and apoptosis, and in the regulation of embryonic development. Required for normal embryonic patterning, trophoblast function, limb bud development, lung morphogenesis, osteogenesis and skin development. Plays an essential role in the regulation of osteoblast differentiation, proliferation and apoptosis, and is required for normal skeleton development. Promotes cell proliferation in keratinocytes and immature osteoblasts, but promotes apoptosis in differentiated osteoblasts. Phosphorylates PLCG1, FRS2 and PAK4. Ligand binding leads to the activation of several signaling cascades. Activation of PLCG1 leads to the production of the cellular signaling molecules diacylglycerol and inositol 1,4,5-trisphosphate. Phosphorylation of FRS2 triggers recruitment of GRB2, GAB1, PIK3R1 and SOS1, and mediates activation of RAS, MAPK1/ERK2, MAPK3/ERK1 and the MAP kinase signaling pathway, as well as of the AKT1 signaling pathway. FGFR2 signaling is down-regulated by ubiquitination, internalization and degradation. Mutations that lead to constitutive kinase activation or impair normal FGFR2 maturation, internalization and degradation lead to aberrant signaling. Over-expressed FGFR2 promotes activation of STAT1. {ECO:0000269|PubMed:12529371, ECO:0000269|PubMed:15190072, ECO:0000269|PubMed:15629145, ECO:0000269|PubMed:16384934, ECO:0000269|PubMed:16597617, ECO:0000269|PubMed:17311277, ECO:0000269|PubMed:17623664, ECO:0000269|PubMed:18374639, ECO:0000269|PubMed:19103595, ECO:0000269|PubMed:19387476, ECO:0000269|PubMed:19410646, ECO:0000269|PubMed:21596750, ECO:0000269|PubMed:8663044}. | . | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000346997, ENST00000351936, ENST00000356226, ENST00000357555, ENST00000358487, ENST00000360144, ENST00000369056, ENST00000369059, ENST00000369060, ENST00000369061, ENST00000457416, ENST00000478859, ENST00000359354, ENST00000490349, | ENST00000369285, ENST00000369286, ENST00000497592, ENST00000543782, ENST00000369287, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 24 X 20 X 12=5760 | 1 X 1 X 1=1 |
| # samples | 38 | 1 | |
| ** MAII score | log2(38/5760*10)=-3.92199748799873 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(1/1*10)=3.32192809488736 | |
| Fusion gene context | PubMed: FGFR2 [Title/Abstract] AND C10orf118 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: FGFR2 [Title/Abstract] AND C10orf118 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | FGFR2(123243212)-C10orf118(115910979), # samples:2 | ||
| Anticipated loss of major functional domain due to fusion event. | FGFR2-C10orf118 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FGFR2-C10orf118 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FGFR2-C10orf118 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FGFR2-C10orf118 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FGFR2-C10orf118 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. FGFR2-C10orf118 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. FGFR2-C10orf118 seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | FGFR2 | GO:0008284 | positive regulation of cell proliferation | 8663044 |
| Hgene | FGFR2 | GO:0008543 | fibroblast growth factor receptor signaling pathway | 8663044|15629145 |
| Hgene | FGFR2 | GO:0018108 | peptidyl-tyrosine phosphorylation | 15629145|16844695 |
| Hgene | FGFR2 | GO:0046777 | protein autophosphorylation | 15629145 |
Four levels of functional features of fusion genesGo to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr10:123243212/chr10:115910979) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
Fusion gene breakpoints across FGFR2 (5'-gene)* Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Fusion gene breakpoints across C10orf118 (3'-gene)* Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Top |
Fusion Amino Acid Sequences |
Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000369061 | FGFR2 | chr10 | 123243212 | - | ENST00000369287 | C10orf118 | chr10 | 115910979 | - | 8334 | 2115 | 48 | 4052 | 1334 |
| ENST00000346997 | FGFR2 | chr10 | 123243212 | - | ENST00000369287 | C10orf118 | chr10 | 115910979 | - | 8526 | 2307 | 12 | 4244 | 1410 |
| ENST00000369056 | FGFR2 | chr10 | 123243212 | - | ENST00000369287 | C10orf118 | chr10 | 115910979 | - | 8547 | 2328 | 24 | 4265 | 1413 |
DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000369061 | ENST00000369287 | FGFR2 | chr10 | 123243212 | - | C10orf118 | chr10 | 115910979 | - | 0.000100885 | 0.99989915 |
| ENST00000346997 | ENST00000369287 | FGFR2 | chr10 | 123243212 | - | C10orf118 | chr10 | 115910979 | - | 7.68E-05 | 0.9999232 |
| ENST00000369056 | ENST00000369287 | FGFR2 | chr10 | 123243212 | - | C10orf118 | chr10 | 115910979 | - | 8.84E-05 | 0.99991167 |
Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for FGFR2-C10orf118 |
+/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| FGFR2 | chr10 | 123243212 | C10orf118 | chr10 | 115910979 | 2115 | 689 | EDLDRILTLTTNELESRIEELNKEVK |
| FGFR2 | chr10 | 123243212 | C10orf118 | chr10 | 115910979 | 2307 | 765 | EDLDRILTLTTNELESRIEELNKEVK |
| FGFR2 | chr10 | 123243212 | C10orf118 | chr10 | 115910979 | 2328 | 768 | EDLDRILTLTTNELESRIEELNKEVK |
Top |
Potential FusionNeoAntigen Information of FGFR2-C10orf118 in HLA I |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| FGFR2-C10orf118_123243212_115910979.msa |
Potential FusionNeoAntigen Information* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-B08:01 | ELESRIEEL | 0.9784 | 0.7747 | 12 | 21 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-A02:22 | ILTLTTNEL | 0.9727 | 0.5486 | 5 | 14 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-A02:13 | ILTLTTNEL | 0.9293 | 0.6468 | 5 | 14 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-A02:27 | ILTLTTNEL | 0.9201 | 0.5609 | 5 | 14 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-A02:04 | ILTLTTNEL | 0.878 | 0.578 | 5 | 14 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-A02:38 | ILTLTTNEL | 0.8658 | 0.6081 | 5 | 14 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-A02:19 | ELESRIEEL | 0.2262 | 0.5285 | 12 | 21 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-B39:13 | NELESRIEEL | 0.9492 | 0.9262 | 11 | 21 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-C01:17 | ILTLTTNEL | 0.4825 | 0.9359 | 5 | 14 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-C01:30 | ILTLTTNEL | 0.0785 | 0.96 | 5 | 14 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-B08:18 | ELESRIEEL | 0.9784 | 0.7747 | 12 | 21 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-B08:12 | ELESRIEEL | 0.9361 | 0.8804 | 12 | 21 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-A69:01 | TTNELESRI | 0.9093 | 0.7414 | 9 | 18 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-C01:03 | ILTLTTNEL | 0.7082 | 0.9377 | 5 | 14 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-B15:73 | ILTLTTNEL | 0.5889 | 0.9394 | 5 | 14 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-B15:30 | ILTLTTNEL | 0.5363 | 0.9033 | 5 | 14 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-C01:02 | ILTLTTNEL | 0.4918 | 0.9322 | 5 | 14 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-B40:04 | NELESRIEEL | 0.9984 | 0.6754 | 11 | 21 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | HLA-B41:03 | NELESRIEEL | 0.9843 | 0.5991 | 11 | 21 |
Top |
Potential FusionNeoAntigen Information of FGFR2-C10orf118 in HLA II |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| FGFR2-C10orf118_123243212_115910979.msa |
Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0102 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0123 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0403 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0411 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0411 | DRILTLTTNELESRI | 3 | 18 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0417 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0424 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0427 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0439 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0441 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0442 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0444 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0446 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0449 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0450 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0450 | DRILTLTTNELESRI | 3 | 18 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0451 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0452 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0456 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0459 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0460 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0467 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0467 | DRILTLTTNELESRI | 3 | 18 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0469 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0471 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0478 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0478 | DRILTLTTNELESRI | 3 | 18 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0479 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0482 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0485 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0488 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0488 | DRILTLTTNELESRI | 3 | 18 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0491 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-0491 | DRILTLTTNELESRI | 3 | 18 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1201 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1203 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1205 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1206 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1207 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1208 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1210 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1211 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1212 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1213 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1214 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1215 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1217 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1218 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1219 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1221 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1222 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1223 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1410 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1410 | DRILTLTTNELESRI | 3 | 18 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1410 | DLDRILTLTTNELES | 1 | 16 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1534 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1615 | LDRILTLTTNELESR | 2 | 17 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1615 | DRILTLTTNELESRI | 3 | 18 |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 | DRB1-1615 | DLDRILTLTTNELES | 1 | 16 |
Top |
Fusion breakpoint peptide structures of FGFR2-C10orf118 |
3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 5717 | LTLTTNELESRIEE | FGFR2 | C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2307 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FGFR2-C10orf118 |
Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens* We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 5717 | LTLTTNELESRIEE | -7.15543 | -7.26883 |
| HLA-B14:02 | 3BVN | 5717 | LTLTTNELESRIEE | -4.77435 | -5.80965 |
| HLA-B52:01 | 3W39 | 5717 | LTLTTNELESRIEE | -6.80875 | -6.92215 |
| HLA-B52:01 | 3W39 | 5717 | LTLTTNELESRIEE | -4.20386 | -5.23916 |
| HLA-A11:01 | 4UQ2 | 5717 | LTLTTNELESRIEE | -7.5194 | -8.5547 |
| HLA-A11:01 | 4UQ2 | 5717 | LTLTTNELESRIEE | -6.9601 | -7.0735 |
| HLA-A24:02 | 5HGA | 5717 | LTLTTNELESRIEE | -7.52403 | -7.63743 |
| HLA-A24:02 | 5HGA | 5717 | LTLTTNELESRIEE | -5.82433 | -6.85963 |
| HLA-B27:05 | 6PYJ | 5717 | LTLTTNELESRIEE | -3.28285 | -4.31815 |
| HLA-B44:05 | 3DX8 | 5717 | LTLTTNELESRIEE | -5.91172 | -6.94702 |
| HLA-B44:05 | 3DX8 | 5717 | LTLTTNELESRIEE | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of FGFR2-C10orf118 |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 11 | 21 | NELESRIEEL | AATGAGTTAGAATCAAGAATAGAAGAACTT |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 12 | 21 | ELESRIEEL | GAGTTAGAATCAAGAATAGAAGAACTT |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 5 | 14 | ILTLTTNEL | ATTCTCACTCTCACAACCAATGAGTTA |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 9 | 18 | TTNELESRI | ACAACCAATGAGTTAGAATCAAGAATA |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 1 | 16 | DLDRILTLTTNELES | GACTTGGATCGAATTCTCACTCTCACAACCAATGAGTTAGAATCA |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 2 | 17 | LDRILTLTTNELESR | TTGGATCGAATTCTCACTCTCACAACCAATGAGTTAGAATCAAGA |
| FGFR2-C10orf118 | chr10 | 123243212 | chr10 | 115910979 | 3 | 18 | DRILTLTTNELESRI | GATCGAATTCTCACTCTCACAACCAATGAGTTAGAATCAAGAATA |
Top |
Information of the samples that have these potential fusion neoantigens of FGFR2-C10orf118 |
These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| CHOL | FGFR2-C10orf118 | chr10 | 123243212 | ENST00000346997 | chr10 | 115910979 | ENST00000369287 | TCGA-W5-AA2Z-01A |
Top |
Potential target of CAR-T therapy development for FGFR2-C10orf118 |
Predicted 3D structure. We used RoseTTAFold. |
Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features* Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Hgene | FGFR2 | chr10:123243212 | chr10:115910979 | ENST00000346997 | - | 16 | 17 | 378_398 | 765 | 820.0 | Transmembrane | Helical |
| Hgene | FGFR2 | chr10:123243212 | chr10:115910979 | ENST00000351936 | - | 17 | 18 | 378_398 | 765 | 786.0 | Transmembrane | Helical |
| Hgene | FGFR2 | chr10:123243212 | chr10:115910979 | ENST00000356226 | - | 15 | 16 | 378_398 | 650 | 705.0 | Transmembrane | Helical |
| Hgene | FGFR2 | chr10:123243212 | chr10:115910979 | ENST00000357555 | - | 16 | 17 | 378_398 | 678 | 708.0 | Transmembrane | Helical |
| Hgene | FGFR2 | chr10:123243212 | chr10:115910979 | ENST00000358487 | - | 17 | 18 | 378_398 | 767 | 822.0 | Transmembrane | Helical |
| Hgene | FGFR2 | chr10:123243212 | chr10:115910979 | ENST00000360144 | - | 16 | 17 | 378_398 | 679 | 681.0 | Transmembrane | Helical |
| Hgene | FGFR2 | chr10:123243212 | chr10:115910979 | ENST00000369056 | - | 16 | 17 | 378_398 | 768 | 770.0 | Transmembrane | Helical |
| Hgene | FGFR2 | chr10:123243212 | chr10:115910979 | ENST00000369060 | - | 15 | 16 | 378_398 | 651 | 706.0 | Transmembrane | Helical |
| Hgene | FGFR2 | chr10:123243212 | chr10:115910979 | ENST00000369061 | - | 14 | 15 | 378_398 | 655 | 710.0 | Transmembrane | Helical |
| Hgene | FGFR2 | chr10:123243212 | chr10:115910979 | ENST00000457416 | - | 17 | 18 | 378_398 | 768 | 823.0 | Transmembrane | Helical |
Subcellular localization prediction of the transmembrane domain retained fusion proteins* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to FGFR2-C10orf118 |
Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to FGFR2-C10orf118 |
Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
| Hgene | FGFR2 | C2931196 | Craniofacial dysostosis type 1 | 23 | CTD_human;GENOMICS_ENGLAND;UNIPROT |
| Hgene | FGFR2 | C0220658 | Pfeiffer Syndrome | 21 | CTD_human;GENOMICS_ENGLAND;UNIPROT |
| Hgene | FGFR2 | C0001193 | Apert syndrome | 19 | CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT |
| Hgene | FGFR2 | C0795998 | JACKSON-WEISS SYNDROME | 10 | CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT |
| Hgene | FGFR2 | C0175699 | Saethre-Chotzen Syndrome | 8 | CTD_human;GENOMICS_ENGLAND;ORPHANET |
| Hgene | FGFR2 | C1852406 | Cutis Gyrata Syndrome of Beare And Stevenson | 8 | CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT |
| Hgene | FGFR2 | C2936791 | Antley-Bixler Syndrome, Autosomal Dominant | 7 | CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT |
| Hgene | FGFR2 | C1510455 | Acrocephalosyndactylia | 6 | CTD_human;ORPHANET |
| Hgene | FGFR2 | C0265269 | Lacrimoauriculodentodigital syndrome | 5 | CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT |
| Hgene | FGFR2 | C0010278 | Craniosynostosis | 4 | CTD_human;GENOMICS_ENGLAND |
| Hgene | FGFR2 | C1863389 | Apert-Crouzon Disease | 4 | CTD_human |
| Hgene | FGFR2 | C1865070 | SCAPHOCEPHALY, MAXILLARY RETRUSION, AND MENTAL RETARDATION | 4 | CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT |
| Hgene | FGFR2 | C0006142 | Malignant neoplasm of breast | 3 | CTD_human;UNIPROT |
| Hgene | FGFR2 | C0030044 | Acrocephaly | 3 | CTD_human |
| Hgene | FGFR2 | C0036341 | Schizophrenia | 3 | PSYGENET |
| Hgene | FGFR2 | C0221356 | Brachycephaly | 3 | CTD_human |
| Hgene | FGFR2 | C0265534 | Scaphycephaly | 3 | CTD_human |
| Hgene | FGFR2 | C0265535 | Trigonocephaly | 3 | CTD_human |
| Hgene | FGFR2 | C0376634 | Craniofacial Abnormalities | 3 | CTD_human |
| Hgene | FGFR2 | C0678222 | Breast Carcinoma | 3 | CTD_human |
| Hgene | FGFR2 | C1257931 | Mammary Neoplasms, Human | 3 | CTD_human |
| Hgene | FGFR2 | C1458155 | Mammary Neoplasms | 3 | CTD_human |
| Hgene | FGFR2 | C1833340 | Synostotic Posterior Plagiocephaly | 3 | CTD_human |
| Hgene | FGFR2 | C1860819 | Metopic synostosis | 3 | CTD_human |
| Hgene | FGFR2 | C2931150 | Synostotic Anterior Plagiocephaly | 3 | CTD_human |
| Hgene | FGFR2 | C3281247 | BENT BONE DYSPLASIA SYNDROME | 3 | CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT |
| Hgene | FGFR2 | C4551902 | Craniosynostosis, Type 1 | 3 | CTD_human |
| Hgene | FGFR2 | C4704874 | Mammary Carcinoma, Human | 3 | CTD_human |
| Hgene | FGFR2 | C0008925 | Cleft Palate | 2 | CTD_human |
| Hgene | FGFR2 | C0011570 | Mental Depression | 2 | PSYGENET |
| Hgene | FGFR2 | C0011581 | Depressive disorder | 2 | PSYGENET |
| Hgene | FGFR2 | C0024623 | Malignant neoplasm of stomach | 2 | CGI;CTD_human |
| Hgene | FGFR2 | C0038356 | Stomach Neoplasms | 2 | CGI;CTD_human |
| Hgene | FGFR2 | C1708349 | Hereditary Diffuse Gastric Cancer | 2 | CTD_human |
| Hgene | FGFR2 | C1837218 | Cleft palate, isolated | 2 | CTD_human |
| Hgene | FGFR2 | C0000772 | Multiple congenital anomalies | 1 | CTD_human |
| Hgene | FGFR2 | C0003090 | Ankylosis | 1 | CTD_human |
| Hgene | FGFR2 | C0005586 | Bipolar Disorder | 1 | PSYGENET |
| Hgene | FGFR2 | C0008924 | Cleft upper lip | 1 | CTD_human |
| Hgene | FGFR2 | C0010273 | Craniofacial Dysostosis | 1 | CTD_human |
| Hgene | FGFR2 | C0011757 | Developmental Coordination Disorder | 1 | CTD_human |
| Hgene | FGFR2 | C0014170 | Endometrial Neoplasms | 1 | CTD_human |
| Hgene | FGFR2 | C0018553 | Hamartoma Syndrome, Multiple | 1 | CTD_human |
| Hgene | FGFR2 | C0020796 | Profound Mental Retardation | 1 | CTD_human |
| Hgene | FGFR2 | C0023890 | Liver Cirrhosis | 1 | CTD_human |
| Hgene | FGFR2 | C0024121 | Lung Neoplasms | 1 | CTD_human |
| Hgene | FGFR2 | C0025363 | Mental Retardation, Psychosocial | 1 | CTD_human |
| Hgene | FGFR2 | C0026613 | Motor Skills Disorders | 1 | CTD_human |
| Hgene | FGFR2 | C0033975 | Psychotic Disorders | 1 | PSYGENET |
| Hgene | FGFR2 | C0037268 | Skin Abnormalities | 1 | CTD_human |
| Hgene | FGFR2 | C0037274 | Dermatologic disorders | 1 | CTD_human |
| Hgene | FGFR2 | C0038219 | Status Dysraphicus | 1 | CTD_human |
| Hgene | FGFR2 | C0040427 | Tooth Abnormalities | 1 | CTD_human |
| Hgene | FGFR2 | C0080178 | Spina Bifida | 1 | CTD_human |
| Hgene | FGFR2 | C0152423 | Congenital small ears | 1 | GENOMICS_ENGLAND |
| Hgene | FGFR2 | C0206698 | Cholangiocarcinoma | 1 | CTD_human |
| Hgene | FGFR2 | C0206762 | Limb Deformities, Congenital | 1 | CTD_human |
| Hgene | FGFR2 | C0239946 | Fibrosis, Liver | 1 | CTD_human |
| Hgene | FGFR2 | C0242379 | Malignant neoplasm of lung | 1 | CTD_human |
| Hgene | FGFR2 | C0265326 | Bannayan-Riley-Ruvalcaba Syndrome | 1 | CTD_human |
| Hgene | FGFR2 | C0266508 | Rachischisis | 1 | CTD_human |
| Hgene | FGFR2 | C0345905 | Intrahepatic Cholangiocarcinoma | 1 | CTD_human |
| Hgene | FGFR2 | C0349204 | Nonorganic psychosis | 1 | PSYGENET |
| Hgene | FGFR2 | C0391826 | Lhermitte-Duclos disease | 1 | CTD_human |
| Hgene | FGFR2 | C0476089 | Endometrial Carcinoma | 1 | CGI;CTD_human |
| Hgene | FGFR2 | C0524730 | Odontome | 1 | CTD_human |
| Hgene | FGFR2 | C0699791 | Stomach Carcinoma | 1 | CGI;GENOMICS_ENGLAND |
| Hgene | FGFR2 | C0917816 | Mental deficiency | 1 | CTD_human |
| Hgene | FGFR2 | C1450010 | Plagiocephaly, Nonsynostotic | 1 | CTD_human |
| Hgene | FGFR2 | C1860042 | Antley-Bixler Syndrome with Disordered Steroidogenesis | 1 | CTD_human |
| Hgene | FGFR2 | C1867564 | SCAPHOCEPHALY AND AXENFELD-RIEGER ANOMALY | 1 | GENOMICS_ENGLAND |
| Hgene | FGFR2 | C1959582 | PTEN Hamartoma Tumor Syndrome | 1 | CTD_human |
| Hgene | FGFR2 | C2350233 | Antley-Bixler Syndrome Phenotype | 1 | CTD_human |
| Hgene | FGFR2 | C3267076 | Familial scaphocephaly syndrome | 1 | GENOMICS_ENGLAND |
| Hgene | FGFR2 | C3714756 | Intellectual Disability | 1 | CTD_human |
| Hgene | FGFR2 | C3805278 | Extrahepatic Cholangiocarcinoma | 1 | CTD_human |