![]() |
|||||||
|
Fusion Protein:ANKS1B-ERP29 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ANKS1B-ERP29 | FusionPDB ID: 4806 | FusionGDB2.0 ID: 4806 | Hgene | Tgene | Gene symbol | ANKS1B | ERP29 | Gene ID | 56899 | 10961 |
Gene name | ankyrin repeat and sterile alpha motif domain containing 1B | endoplasmic reticulum protein 29 | |
Synonyms | AIDA|AIDA-1|ANKS2|EB-1|EB1|cajalin-2 | C12orf8|ERp28|ERp31|HEL-S-107|PDI-DB|PDIA9 | |
Cytomap | 12q23.1 | 12q24.13 | |
Type of gene | protein-coding | protein-coding | |
Description | ankyrin repeat and sterile alpha motif domain-containing protein 1BE2a-Pbx1-associated proteinamyloid-beta precursor protein intracellular domain associated protein 1cajalin 2 | endoplasmic reticulum resident protein 29endoplasmic reticulum lumenal protein ERp28endoplasmic reticulum resident protein 28endoplasmic reticulum resident protein 31epididymis secretory protein Li 107protein disulfide isomerase family A, member 9 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q7Z6G8 Main function of 5'-partner protein: FUNCTION: Isoform 2 may participate in the regulation of nucleoplasmic coilin protein interactions in neuronal and transformed cells.; FUNCTION: Isoform 3 can regulate global protein synthesis by altering nucleolar numbers. {ECO:0000250, ECO:0000269|PubMed:15347684, ECO:0000269|PubMed:15862129}.; FUNCTION: Isoform 4 may play a role as a modulator of APP processing. Overexpression can down-regulate APP processing. | P30040 Main function of 5'-partner protein: FUNCTION: Does not seem to be a disulfide isomerase. Plays an important role in the processing of secretory proteins within the endoplasmic reticulum (ER), possibly by participating in the folding of proteins in the ER. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000329257, ENST00000332712, ENST00000333732, ENST00000341752, ENST00000546568, ENST00000546960, ENST00000547010, ENST00000547446, ENST00000547776, ENST00000549025, ENST00000549493, ENST00000549558, ENST00000550693, ENST00000550833, | ENST00000546477, ENST00000455836, ENST00000261735, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 19 X 19 X 6=2166 | 8 X 8 X 4=256 |
# samples | 21 | 8 | |
** MAII score | log2(21/2166*10)=-3.3665720099422 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(8/256*10)=-1.67807190511264 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: ANKS1B [Title/Abstract] AND ERP29 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ANKS1B [Title/Abstract] AND ERP29 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ANKS1B(99166820)-ERP29(112457560), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | ANKS1B-ERP29 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ANKS1B-ERP29 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ANKS1B-ERP29 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ANKS1B-ERP29 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ANKS1B-ERP29 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. ANKS1B-ERP29 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | ERP29 | GO:0000187 | activation of MAPK activity | 22064321 |
Tgene | ERP29 | GO:0001934 | positive regulation of protein phosphorylation | 22064321 |
Tgene | ERP29 | GO:0010628 | positive regulation of gene expression | 22064321 |
Tgene | ERP29 | GO:0010629 | negative regulation of gene expression | 22064321 |
Tgene | ERP29 | GO:0050709 | negative regulation of protein secretion | 22064321 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr12:99166820/chr12:112457560) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000547776 | ANKS1B | chr12 | 99166820 | - | ENST00000261735 | ERP29 | chr12 | 112457560 | + | 4945 | 3504 | 0 | 4145 | 1381 |
ENST00000329257 | ANKS1B | chr12 | 99166820 | - | ENST00000261735 | ERP29 | chr12 | 112457560 | + | 4945 | 3504 | 0 | 4145 | 1381 |
ENST00000547010 | ANKS1B | chr12 | 99166820 | - | ENST00000261735 | ERP29 | chr12 | 112457560 | + | 3793 | 2352 | 189 | 2993 | 934 |
ENST00000549558 | ANKS1B | chr12 | 99166820 | - | ENST00000261735 | ERP29 | chr12 | 112457560 | + | 2697 | 1256 | 218 | 1897 | 559 |
ENST00000550693 | ANKS1B | chr12 | 99166820 | - | ENST00000261735 | ERP29 | chr12 | 112457560 | + | 2769 | 1328 | 218 | 1969 | 583 |
ENST00000549493 | ANKS1B | chr12 | 99166820 | - | ENST00000261735 | ERP29 | chr12 | 112457560 | + | 2967 | 1526 | 236 | 2167 | 643 |
ENST00000547446 | ANKS1B | chr12 | 99166820 | - | ENST00000261735 | ERP29 | chr12 | 112457560 | + | 2467 | 1026 | 87 | 1667 | 526 |
ENST00000546568 | ANKS1B | chr12 | 99166820 | - | ENST00000261735 | ERP29 | chr12 | 112457560 | + | 2443 | 1002 | 0 | 1643 | 547 |
ENST00000332712 | ANKS1B | chr12 | 99166820 | - | ENST00000261735 | ERP29 | chr12 | 112457560 | + | 2515 | 1074 | 0 | 1715 | 571 |
ENST00000546960 | ANKS1B | chr12 | 99166820 | - | ENST00000261735 | ERP29 | chr12 | 112457560 | + | 2623 | 1182 | 0 | 1823 | 607 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000547776 | ENST00000261735 | ANKS1B | chr12 | 99166820 | - | ERP29 | chr12 | 112457560 | + | 0.000557588 | 0.9994424 |
ENST00000329257 | ENST00000261735 | ANKS1B | chr12 | 99166820 | - | ERP29 | chr12 | 112457560 | + | 0.000539128 | 0.9994609 |
ENST00000547010 | ENST00000261735 | ANKS1B | chr12 | 99166820 | - | ERP29 | chr12 | 112457560 | + | 0.000443278 | 0.9995567 |
ENST00000549558 | ENST00000261735 | ANKS1B | chr12 | 99166820 | - | ERP29 | chr12 | 112457560 | + | 0.000646802 | 0.99935323 |
ENST00000550693 | ENST00000261735 | ANKS1B | chr12 | 99166820 | - | ERP29 | chr12 | 112457560 | + | 0.00067239 | 0.99932766 |
ENST00000549493 | ENST00000261735 | ANKS1B | chr12 | 99166820 | - | ERP29 | chr12 | 112457560 | + | 0.000798506 | 0.9992015 |
ENST00000547446 | ENST00000261735 | ANKS1B | chr12 | 99166820 | - | ERP29 | chr12 | 112457560 | + | 0.000604265 | 0.9993957 |
ENST00000546568 | ENST00000261735 | ANKS1B | chr12 | 99166820 | - | ERP29 | chr12 | 112457560 | + | 0.000678944 | 0.9993211 |
ENST00000332712 | ENST00000261735 | ANKS1B | chr12 | 99166820 | - | ERP29 | chr12 | 112457560 | + | 0.000705564 | 0.9992944 |
ENST00000546960 | ENST00000261735 | ANKS1B | chr12 | 99166820 | - | ERP29 | chr12 | 112457560 | + | 0.000770538 | 0.99922943 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ANKS1B-ERP29 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ANKS1B | chr12 | 99166820 | ERP29 | chr12 | 112457560 | 1002 | 334 | NHHYCHVFTAFDVVIPKSKFVLVKFD |
ANKS1B | chr12 | 99166820 | ERP29 | chr12 | 112457560 | 1026 | 313 | NHHYCHVFTAFDVVIPKSKFVLVKFD |
ANKS1B | chr12 | 99166820 | ERP29 | chr12 | 112457560 | 1074 | 358 | NHHYCHVFTAFDVVIPKSKFVLVKFD |
ANKS1B | chr12 | 99166820 | ERP29 | chr12 | 112457560 | 1182 | 394 | NHHYCHVFTAFDVVIPKSKFVLVKFD |
ANKS1B | chr12 | 99166820 | ERP29 | chr12 | 112457560 | 1256 | 346 | NHHYCHVFTAFDVVIPKSKFVLVKFD |
ANKS1B | chr12 | 99166820 | ERP29 | chr12 | 112457560 | 1328 | 370 | NHHYCHVFTAFDVVIPKSKFVLVKFD |
ANKS1B | chr12 | 99166820 | ERP29 | chr12 | 112457560 | 1526 | 430 | NHHYCHVFTAFDVVIPKSKFVLVKFD |
ANKS1B | chr12 | 99166820 | ERP29 | chr12 | 112457560 | 2352 | 721 | NHHYCHVFTAFDVVIPKSKFVLVKFD |
ANKS1B | chr12 | 99166820 | ERP29 | chr12 | 112457560 | 3504 | 1168 | NHHYCHVFTAFDVVIPKSKFVLVKFD |
Top |
Potential FusionNeoAntigen Information of ANKS1B-ERP29 in HLA I |
![]() |
ANKS1B-ERP29_99166820_112457560.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A30:08 | TAFDVVIPK | 0.9598 | 0.5619 | 8 | 17 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A02:38 | VVIPKSKFV | 0.8271 | 0.6502 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A02:21 | VVIPKSKFV | 0.8172 | 0.6836 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A02:20 | VVIPKSKFV | 0.7774 | 0.5905 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A02:35 | VVIPKSKFV | 0.7526 | 0.6279 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A02:13 | VVIPKSKFV | 0.7326 | 0.6397 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A30:08 | VVIPKSKFV | 0.6792 | 0.7136 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-B52:01 | VVIPKSKFV | 0.5088 | 0.8532 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C15:06 | VVIPKSKFV | 0.9932 | 0.9349 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C15:04 | VVIPKSKFV | 0.9902 | 0.9071 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C03:07 | VVIPKSKFV | 0.9885 | 0.9877 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C04:06 | VVIPKSKFV | 0.9824 | 0.907 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C06:03 | VVIPKSKFV | 0.8857 | 0.9843 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C12:04 | VVIPKSKFV | 0.8801 | 0.9898 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C12:12 | VVIPKSKFV | 0.7695 | 0.8534 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C02:06 | VVIPKSKFV | 0.3289 | 0.9403 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C04:10 | AFDVVIPKSKF | 1 | 0.6911 | 9 | 20 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C04:07 | AFDVVIPKSKF | 1 | 0.7157 | 9 | 20 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A25:01 | DVVIPKSKF | 0.9977 | 0.7767 | 11 | 20 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A68:02 | HVFTAFDVV | 0.9964 | 0.7004 | 5 | 14 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C15:02 | VVIPKSKFV | 0.9963 | 0.9035 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C15:05 | VVIPKSKFV | 0.9951 | 0.9202 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A69:01 | HVFTAFDVV | 0.994 | 0.6576 | 5 | 14 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C15:09 | VVIPKSKFV | 0.9902 | 0.9071 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A30:01 | TAFDVVIPK | 0.9509 | 0.7296 | 8 | 17 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C16:02 | VVIPKSKFV | 0.9211 | 0.9934 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A02:03 | VVIPKSKFV | 0.8849 | 0.6032 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C16:04 | VVIPKSKFV | 0.8278 | 0.9478 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A02:14 | VVIPKSKFV | 0.8197 | 0.5351 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A02:06 | VVIPKSKFV | 0.8172 | 0.6836 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C06:02 | VVIPKSKFV | 0.7844 | 0.9886 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C06:17 | VVIPKSKFV | 0.7844 | 0.9886 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-A69:01 | VVIPKSKFV | 0.7789 | 0.8237 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C12:03 | VVIPKSKFV | 0.7318 | 0.9426 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C06:06 | VVIPKSKFV | 0.6151 | 0.99 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-B15:13 | DVVIPKSKF | 0.4309 | 0.6014 | 11 | 20 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C06:08 | VVIPKSKFV | 0.2875 | 0.9768 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C02:10 | VVIPKSKFV | 0.1725 | 0.9678 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C02:02 | VVIPKSKFV | 0.1725 | 0.9678 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C07:04 | VVIPKSKFV | 0.1279 | 0.936 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C17:01 | VVIPKSKFV | 0.0336 | 0.8705 | 12 | 21 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C01:02 | VVIPKSKFVL | 0.8976 | 0.9438 | 12 | 22 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C18:01 | AFDVVIPKSKF | 1 | 0.7386 | 9 | 20 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | HLA-C04:01 | AFDVVIPKSKF | 1 | 0.7157 | 9 | 20 |
Top |
Potential FusionNeoAntigen Information of ANKS1B-ERP29 in HLA II |
![]() |
ANKS1B-ERP29_99166820_112457560.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | DRB1-1170 | AFDVVIPKSKFVLVK | 9 | 24 |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 | DRB1-1343 | AFDVVIPKSKFVLVK | 9 | 24 |
Top |
Fusion breakpoint peptide structures of ANKS1B-ERP29 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
9935 | VFTAFDVVIPKSKF | ANKS1B | ERP29 | chr12 | 99166820 | chr12 | 112457560 | 3504 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ANKS1B-ERP29 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 9935 | VFTAFDVVIPKSKF | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 9935 | VFTAFDVVIPKSKF | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 9935 | VFTAFDVVIPKSKF | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 9935 | VFTAFDVVIPKSKF | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 9935 | VFTAFDVVIPKSKF | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 9935 | VFTAFDVVIPKSKF | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 9935 | VFTAFDVVIPKSKF | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 9935 | VFTAFDVVIPKSKF | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 9935 | VFTAFDVVIPKSKF | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 9935 | VFTAFDVVIPKSKF | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 9935 | VFTAFDVVIPKSKF | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of ANKS1B-ERP29 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 11 | 20 | DVVIPKSKF | GATGTGGTCATTCCCAAAAGCAAGTTC |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 12 | 21 | VVIPKSKFV | GTGGTCATTCCCAAAAGCAAGTTCGTC |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 12 | 22 | VVIPKSKFVL | GTGGTCATTCCCAAAAGCAAGTTCGTCTTG |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 5 | 14 | HVFTAFDVV | CATGTGTTTACTGCCTTTGATGTGGTC |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 8 | 17 | TAFDVVIPK | ACTGCCTTTGATGTGGTCATTCCCAAA |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 9 | 20 | AFDVVIPKSKF | GCCTTTGATGTGGTCATTCCCAAAAGCAAGTTC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
ANKS1B-ERP29 | chr12 | 99166820 | chr12 | 112457560 | 9 | 24 | AFDVVIPKSKFVLVK | GCCTTTGATGTGGTCATTCCCAAAAGCAAGTTCGTCTTGGTGAAG |
Top |
Information of the samples that have these potential fusion neoantigens of ANKS1B-ERP29 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
SKCM | ANKS1B-ERP29 | chr12 | 99166820 | ENST00000329257 | chr12 | 112457560 | ENST00000261735 | TCGA-D3-A5GL-06A |
Top |
Potential target of CAR-T therapy development for ANKS1B-ERP29 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ANKS1B-ERP29 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ANKS1B-ERP29 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |