|
|||||||
|
Fusion Protein:ARRB1-PRCP |
Fusion Gene and Fusion Protein Summary |
Fusion gene summary |
| Fusion partner gene information | Fusion gene name: ARRB1-PRCP | FusionPDB ID: 6845 | FusionGDB2.0 ID: 6845 | Hgene | Tgene | Gene symbol | ARRB1 | PRCP | Gene ID | 408 | 5547 |
| Gene name | arrestin beta 1 | prolylcarboxypeptidase | |
| Synonyms | ARB1|ARR1 | HUMPCP|PCP | |
| Cytomap | 11q13.4 | 11q14.1 | |
| Type of gene | protein-coding | protein-coding | |
| Description | beta-arrestin-1arrestin 2non-visual arrestin-2 | lysosomal Pro-X carboxypeptidaseangiotensinase Clysosomal carboxypeptidase Cproline carboxypeptidase | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | P49407 Main function of 5'-partner protein: FUNCTION: Functions in regulating agonist-mediated G-protein coupled receptor (GPCR) signaling by mediating both receptor desensitization and resensitization processes. During homologous desensitization, beta-arrestins bind to the GPRK-phosphorylated receptor and sterically preclude its coupling to the cognate G-protein; the binding appears to require additional receptor determinants exposed only in the active receptor conformation. The beta-arrestins target many receptors for internalization by acting as endocytic adapters (CLASPs, clathrin-associated sorting proteins) and recruiting the GPRCs to the adapter protein 2 complex 2 (AP-2) in clathrin-coated pits (CCPs). However, the extent of beta-arrestin involvement appears to vary significantly depending on the receptor, agonist and cell type. Internalized arrestin-receptor complexes traffic to intracellular endosomes, where they remain uncoupled from G-proteins. Two different modes of arrestin-mediated internalization occur. Class A receptors, like ADRB2, OPRM1, ENDRA, D1AR and ADRA1B dissociate from beta-arrestin at or near the plasma membrane and undergo rapid recycling. Class B receptors, like AVPR2, AGTR1, NTSR1, TRHR and TACR1 internalize as a complex with arrestin and traffic with it to endosomal vesicles, presumably as desensitized receptors, for extended periods of time. Receptor resensitization then requires that receptor-bound arrestin is removed so that the receptor can be dephosphorylated and returned to the plasma membrane. Involved in internalization of P2RY4 and UTP-stimulated internalization of P2RY2. Involved in phosphorylation-dependent internalization of OPRD1 ands subsequent recycling. Involved in the degradation of cAMP by recruiting cAMP phosphodiesterases to ligand-activated receptors. Beta-arrestins function as multivalent adapter proteins that can switch the GPCR from a G-protein signaling mode that transmits short-lived signals from the plasma membrane via small molecule second messengers and ion channels to a beta-arrestin signaling mode that transmits a distinct set of signals that are initiated as the receptor internalizes and transits the intracellular compartment. Acts as signaling scaffold for MAPK pathways such as MAPK1/3 (ERK1/2). ERK1/2 activated by the beta-arrestin scaffold is largely excluded from the nucleus and confined to cytoplasmic locations such as endocytic vesicles, also called beta-arrestin signalosomes. Recruits c-Src/SRC to ADRB2 resulting in ERK activation. GPCRs for which the beta-arrestin-mediated signaling relies on both ARRB1 and ARRB2 (codependent regulation) include ADRB2, F2RL1 and PTH1R. For some GPCRs the beta-arrestin-mediated signaling relies on either ARRB1 or ARRB2 and is inhibited by the other respective beta-arrestin form (reciprocal regulation). Inhibits ERK1/2 signaling in AGTR1- and AVPR2-mediated activation (reciprocal regulation). Is required for SP-stimulated endocytosis of NK1R and recruits c-Src/SRC to internalized NK1R resulting in ERK1/2 activation, which is required for the antiapoptotic effects of SP. Is involved in proteinase-activated F2RL1-mediated ERK activity. Acts as signaling scaffold for the AKT1 pathway. Is involved in alpha-thrombin-stimulated AKT1 signaling. Is involved in IGF1-stimulated AKT1 signaling leading to increased protection from apoptosis. Involved in activation of the p38 MAPK signaling pathway and in actin bundle formation. Involved in F2RL1-mediated cytoskeletal rearrangement and chemotaxis. Involved in AGTR1-mediated stress fiber formation by acting together with GNAQ to activate RHOA. Appears to function as signaling scaffold involved in regulation of MIP-1-beta-stimulated CCR5-dependent chemotaxis. Involved in attenuation of NF-kappa-B-dependent transcription in response to GPCR or cytokine stimulation by interacting with and stabilizing CHUK. May serve as nuclear messenger for GPCRs. Involved in OPRD1-stimulated transcriptional regulation by translocating to CDKN1B and FOS promoter regions and recruiting EP300 resulting in acetylation of histone H4. Involved in regulation of LEF1 transcriptional activity via interaction with DVL1 and/or DVL2 Also involved in regulation of receptors other than GPCRs. Involved in Toll-like receptor and IL-1 receptor signaling through the interaction with TRAF6 which prevents TRAF6 autoubiquitination and oligomerization required for activation of NF-kappa-B and JUN. Binds phosphoinositides. Binds inositolhexakisphosphate (InsP6) (By similarity). Involved in IL8-mediated granule release in neutrophils. Required for atypical chemokine receptor ACKR2-induced RAC1-LIMK1-PAK1-dependent phosphorylation of cofilin (CFL1) and for the up-regulation of ACKR2 from endosomal compartment to cell membrane, increasing its efficiency in chemokine uptake and degradation. Involved in the internalization of the atypical chemokine receptor ACKR3. Negatively regulates the NOTCH signaling pathway by mediating the ubiquitination and degradation of NOTCH1 by ITCH. Participates in the recruitment of the ubiquitin-protein ligase to the receptor (PubMed:23886940). {ECO:0000250, ECO:0000269|PubMed:12464600, ECO:0000269|PubMed:14711824, ECO:0000269|PubMed:15475570, ECO:0000269|PubMed:15611106, ECO:0000269|PubMed:15671180, ECO:0000269|PubMed:15878855, ECO:0000269|PubMed:16144840, ECO:0000269|PubMed:16280323, ECO:0000269|PubMed:16378096, ECO:0000269|PubMed:16492667, ECO:0000269|PubMed:16709866, ECO:0000269|PubMed:18337459, ECO:0000269|PubMed:18419762, ECO:0000269|PubMed:19620252, ECO:0000269|PubMed:19643177, ECO:0000269|PubMed:22457824, ECO:0000269|PubMed:23341447, ECO:0000269|PubMed:23633677, ECO:0000269|PubMed:23886940}. | . | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000360025, ENST00000393505, ENST00000420843, | ENST00000525772, ENST00000313010, ENST00000393399, ENST00000535099, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 18 X 10 X 9=1620 | 9 X 8 X 6=432 |
| # samples | 23 | 11 | |
| ** MAII score | log2(23/1620*10)=-2.81628804682761 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(11/432*10)=-1.97352778863881 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: ARRB1 [Title/Abstract] AND PRCP [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: ARRB1 [Title/Abstract] AND PRCP [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ARRB1(75062632)-PRCP(82550467), # samples:2 | ||
| Anticipated loss of major functional domain due to fusion event. | ARRB1-PRCP seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ARRB1-PRCP seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | ARRB1 | GO:0031397 | negative regulation of protein ubiquitination | 16378096 |
| Hgene | ARRB1 | GO:0032088 | negative regulation of NF-kappaB transcription factor activity | 16378096 |
| Hgene | ARRB1 | GO:0032715 | negative regulation of interleukin-6 production | 16378096 |
| Hgene | ARRB1 | GO:0032717 | negative regulation of interleukin-8 production | 16378096 |
| Hgene | ARRB1 | GO:0070374 | positive regulation of ERK1 and ERK2 cascade | 10644702 |
Four levels of functional features of fusion genesGo to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr11:75062632/chr11:82550467) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
Fusion gene breakpoints across ARRB1 (5'-gene)* Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Fusion gene breakpoints across PRCP (3'-gene)* Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Top |
Fusion Amino Acid Sequences |
Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000420843 | ARRB1 | chr11 | 75062632 | - | ENST00000313010 | PRCP | chr11 | 82549616 | - | 1927 | 118 | 16 | 522 | 168 |
| ENST00000420843 | ARRB1 | chr11 | 75062632 | - | ENST00000393399 | PRCP | chr11 | 82549616 | - | 1061 | 118 | 16 | 522 | 168 |
| ENST00000420843 | ARRB1 | chr11 | 75062632 | - | ENST00000535099 | PRCP | chr11 | 82549616 | - | 639 | 118 | 16 | 522 | 168 |
| ENST00000393505 | ARRB1 | chr11 | 75062632 | - | ENST00000313010 | PRCP | chr11 | 82549616 | - | 2051 | 242 | 44 | 646 | 200 |
| ENST00000393505 | ARRB1 | chr11 | 75062632 | - | ENST00000393399 | PRCP | chr11 | 82549616 | - | 1185 | 242 | 44 | 646 | 200 |
| ENST00000393505 | ARRB1 | chr11 | 75062632 | - | ENST00000535099 | PRCP | chr11 | 82549616 | - | 763 | 242 | 44 | 646 | 200 |
| ENST00000360025 | ARRB1 | chr11 | 75062632 | - | ENST00000313010 | PRCP | chr11 | 82549616 | - | 1927 | 118 | 16 | 522 | 168 |
| ENST00000360025 | ARRB1 | chr11 | 75062632 | - | ENST00000393399 | PRCP | chr11 | 82549616 | - | 1061 | 118 | 16 | 522 | 168 |
| ENST00000360025 | ARRB1 | chr11 | 75062632 | - | ENST00000535099 | PRCP | chr11 | 82549616 | - | 639 | 118 | 16 | 522 | 168 |
| ENST00000420843 | ARRB1 | chr11 | 75062632 | - | ENST00000313010 | PRCP | chr11 | 82550467 | - | 2092 | 118 | 16 | 687 | 223 |
| ENST00000420843 | ARRB1 | chr11 | 75062632 | - | ENST00000393399 | PRCP | chr11 | 82550467 | - | 1226 | 118 | 16 | 687 | 223 |
| ENST00000420843 | ARRB1 | chr11 | 75062632 | - | ENST00000535099 | PRCP | chr11 | 82550467 | - | 804 | 118 | 16 | 687 | 223 |
| ENST00000393505 | ARRB1 | chr11 | 75062632 | - | ENST00000313010 | PRCP | chr11 | 82550467 | - | 2216 | 242 | 44 | 811 | 255 |
| ENST00000393505 | ARRB1 | chr11 | 75062632 | - | ENST00000393399 | PRCP | chr11 | 82550467 | - | 1350 | 242 | 44 | 811 | 255 |
| ENST00000393505 | ARRB1 | chr11 | 75062632 | - | ENST00000535099 | PRCP | chr11 | 82550467 | - | 928 | 242 | 44 | 811 | 255 |
| ENST00000360025 | ARRB1 | chr11 | 75062632 | - | ENST00000313010 | PRCP | chr11 | 82550467 | - | 2092 | 118 | 16 | 687 | 223 |
| ENST00000360025 | ARRB1 | chr11 | 75062632 | - | ENST00000393399 | PRCP | chr11 | 82550467 | - | 1226 | 118 | 16 | 687 | 223 |
| ENST00000360025 | ARRB1 | chr11 | 75062632 | - | ENST00000535099 | PRCP | chr11 | 82550467 | - | 804 | 118 | 16 | 687 | 223 |
DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000420843 | ENST00000313010 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82549616 | - | 0.061036192 | 0.93896383 |
| ENST00000420843 | ENST00000393399 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82549616 | - | 0.055471014 | 0.94452894 |
| ENST00000420843 | ENST00000535099 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82549616 | - | 0.017895248 | 0.9821047 |
| ENST00000393505 | ENST00000313010 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82549616 | - | 0.023207936 | 0.97679204 |
| ENST00000393505 | ENST00000393399 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82549616 | - | 0.028480252 | 0.97151977 |
| ENST00000393505 | ENST00000535099 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82549616 | - | 0.01989625 | 0.98010373 |
| ENST00000360025 | ENST00000313010 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82549616 | - | 0.061036192 | 0.93896383 |
| ENST00000360025 | ENST00000393399 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82549616 | - | 0.055471014 | 0.94452894 |
| ENST00000360025 | ENST00000535099 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82549616 | - | 0.017895248 | 0.9821047 |
| ENST00000420843 | ENST00000313010 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82550467 | - | 0.043498747 | 0.95650125 |
| ENST00000420843 | ENST00000393399 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82550467 | - | 0.036736496 | 0.9632635 |
| ENST00000420843 | ENST00000535099 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82550467 | - | 0.019402849 | 0.9805972 |
| ENST00000393505 | ENST00000313010 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82550467 | - | 0.019871537 | 0.98012847 |
| ENST00000393505 | ENST00000393399 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82550467 | - | 0.028374655 | 0.9716253 |
| ENST00000393505 | ENST00000535099 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82550467 | - | 0.017121984 | 0.98287797 |
| ENST00000360025 | ENST00000313010 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82550467 | - | 0.043498747 | 0.95650125 |
| ENST00000360025 | ENST00000393399 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82550467 | - | 0.036736496 | 0.9632635 |
| ENST00000360025 | ENST00000535099 | ARRB1 | chr11 | 75062632 | - | PRCP | chr11 | 82550467 | - | 0.019402849 | 0.9805972 |
Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ARRB1-PRCP |
+/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| ARRB1 | chr11 | 75062632 | PRCP | chr11 | 82549616 | 118 | 34 | PATVADHGRQRDPACTEVVMPFCTNG |
| ARRB1 | chr11 | 75062632 | PRCP | chr11 | 82549616 | 242 | 66 | PATVADHGRQRDPACTEVVMPFCTNG |
| ARRB1 | chr11 | 75062632 | PRCP | chr11 | 82550467 | 118 | 34 | PATVADHGRQRDPVVCQYLKNPNVSD |
| ARRB1 | chr11 | 75062632 | PRCP | chr11 | 82550467 | 242 | 66 | PATVADHGRQRDPVVCQYLKNPNVSD |
Top |
Potential FusionNeoAntigen Information of ARRB1-PRCP in HLA I |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| ARRB1-PRCP_75062632_82549616.msa | |
| ARRB1-PRCP_75062632_82550467.msa |
Potential FusionNeoAntigen Information* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B39:24 | QRDPACTEV | 0.9962 | 0.8421 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B39:06 | QRDPACTEV | 0.996 | 0.9482 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B39:01 | QRDPACTEV | 0.9954 | 0.9623 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B38:02 | QRDPACTEV | 0.9902 | 0.9859 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B38:01 | QRDPACTEV | 0.9898 | 0.9871 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B35:01 | DPACTEVVM | 0.9874 | 0.8596 | 11 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B35:08 | DPACTEVVM | 0.9732 | 0.7702 | 11 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B35:03 | DPACTEVVM | 0.9614 | 0.8415 | 11 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B35:04 | DPACTEVVM | 0.8253 | 0.95 | 11 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B35:02 | DPACTEVVM | 0.8253 | 0.95 | 11 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B08:09 | HGRQRDPAC | 0.7508 | 0.7112 | 6 | 15 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B07:10 | QRDPACTEV | 0.0616 | 0.6934 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B48:01 | RQRDPACTEV | 0.9746 | 0.8081 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B13:02 | RQRDPACTEV | 0.7209 | 0.9239 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B39:01 | QRDPACTEVVM | 0.9989 | 0.9714 | 9 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B38:01 | QRDPACTEVVM | 0.9965 | 0.9907 | 9 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B38:02 | QRDPACTEVVM | 0.9961 | 0.9896 | 9 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B48:01 | RQRDPACTEVV | 0.9935 | 0.8158 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B13:02 | RQRDPACTEVV | 0.9574 | 0.9381 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B39:09 | QRDPACTEV | 0.9951 | 0.9245 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B39:12 | QRDPACTEV | 0.9948 | 0.9646 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B39:05 | QRDPACTEV | 0.9896 | 0.9565 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B73:01 | QRDPACTEV | 0.9554 | 0.9271 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B35:12 | DPACTEVVM | 0.8253 | 0.95 | 11 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-C07:13 | QRDPACTEV | 0.7893 | 0.9638 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B39:10 | DPACTEVVM | 0.3446 | 0.941 | 11 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B15:04 | RQRDPACTEV | 0.9639 | 0.9141 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B39:09 | QRDPACTEVVM | 0.9987 | 0.9499 | 9 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B39:05 | QRDPACTEVVM | 0.9963 | 0.9663 | 9 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B39:31 | QRDPACTEV | 0.996 | 0.9621 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B38:05 | QRDPACTEV | 0.9898 | 0.9871 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B35:77 | DPACTEVVM | 0.9874 | 0.8596 | 11 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B35:23 | DPACTEVVM | 0.9852 | 0.8681 | 11 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B35:24 | DPACTEVVM | 0.9805 | 0.8611 | 11 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-C18:01 | QRDPACTEV | 0.9614 | 0.9426 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B15:09 | QRDPACTEV | 0.9528 | 0.9511 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B39:11 | QRDPACTEV | 0.8288 | 0.8797 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B35:09 | DPACTEVVM | 0.8253 | 0.95 | 11 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B35:22 | DPACTEVVM | 0.7004 | 0.6298 | 11 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-C07:22 | QRDPACTEV | 0.6896 | 0.8106 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-C06:06 | QRDPACTEV | 0.6833 | 0.993 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-C07:04 | QRDPACTEV | 0.5977 | 0.9502 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B18:07 | DPACTEVVM | 0.3321 | 0.8073 | 11 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B15:73 | RQRDPACTEV | 0.9833 | 0.9597 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B15:30 | RQRDPACTEV | 0.9622 | 0.9515 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B48:05 | RQRDPACTEV | 0.9016 | 0.7265 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B39:31 | QRDPACTEVVM | 0.999 | 0.9715 | 9 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B39:11 | QRDPACTEVVM | 0.9968 | 0.9192 | 9 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B38:05 | QRDPACTEVVM | 0.9965 | 0.9907 | 9 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B15:73 | RQRDPACTEVV | 0.9963 | 0.9499 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B15:09 | QRDPACTEVVM | 0.989 | 0.9544 | 9 | 20 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | HLA-B48:05 | RQRDPACTEVV | 0.9527 | 0.7604 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B27:04 | QRDPVVCQY | 0.9964 | 0.6006 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B38:01 | QRDPVVCQY | 0.5678 | 0.9705 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B38:02 | QRDPVVCQY | 0.5386 | 0.9685 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:18 | QRDPVVCQY | 0.5195 | 0.6681 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:03 | QRDPVVCQY | 0.4821 | 0.7399 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:01 | RQRDPVVCQY | 0.9999 | 0.7476 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B39:24 | QRDPVVCQYL | 0.9968 | 0.5888 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B27:04 | RQRDPVVCQY | 0.9964 | 0.5243 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B39:01 | QRDPVVCQYL | 0.9946 | 0.9111 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:25 | RQRDPVVCQY | 0.9928 | 0.8078 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B38:01 | QRDPVVCQYL | 0.9916 | 0.9687 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B38:02 | QRDPVVCQYL | 0.9884 | 0.968 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:02 | RQRDPVVCQY | 0.9805 | 0.8518 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:03 | RQRDPVVCQY | 0.9424 | 0.6072 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-A30:08 | RQRDPVVCQY | 0.9402 | 0.5974 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B07:10 | QRDPVVCQYL | 0.5456 | 0.5206 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B27:04 | GRQRDPVVCQY | 0.9999 | 0.5431 | 7 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:01 | RQRDPVVCQYL | 0.9996 | 0.704 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B48:01 | RQRDPVVCQYL | 0.9974 | 0.5119 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:01 | GRQRDPVVCQY | 0.9872 | 0.7056 | 7 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B13:02 | RQRDPVVCQYL | 0.979 | 0.6096 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B13:01 | RQRDPVVCQYL | 0.9716 | 0.8844 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B07:10 | RQRDPVVCQYL | 0.9332 | 0.5282 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:95 | QRDPVVCQY | 0.9909 | 0.6796 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:27 | QRDPVVCQY | 0.9858 | 0.9302 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:05 | QRDPVVCQY | 0.984 | 0.9373 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:29 | QRDPVVCQY | 0.9701 | 0.8979 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:19 | QRDPVVCQY | 0.9231 | 0.7306 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:46 | QRDPVVCQY | 0.9156 | 0.8724 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:80 | QRDPVVCQY | 0.8663 | 0.9139 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:67 | QRDPVVCQY | 0.8663 | 0.9139 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:10 | QRDPVVCQY | 0.8514 | 0.9408 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:13 | QRDPVVCQY | 0.8412 | 0.8866 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:04 | RQRDPVVCQ | 0.7144 | 0.6424 | 8 | 17 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B39:12 | QRDPVVCQY | 0.5969 | 0.8909 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B39:09 | QRDPVVCQY | 0.5807 | 0.598 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:21 | QRDPVVCQY | 0.5048 | 0.8373 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C12:16 | QRDPVVCQY | 0.0678 | 0.9466 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:07 | RQRDPVVCQY | 0.9995 | 0.5026 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:04 | RQRDPVVCQY | 0.9986 | 0.7929 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B39:09 | QRDPVVCQYL | 0.9952 | 0.6827 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:05 | QRDPVVCQYL | 0.9947 | 0.9456 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B39:12 | QRDPVVCQYL | 0.993 | 0.9155 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B39:05 | QRDPVVCQYL | 0.9894 | 0.9051 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:13 | QRDPVVCQYL | 0.9891 | 0.9106 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:95 | QRDPVVCQYL | 0.9886 | 0.6526 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:27 | QRDPVVCQYL | 0.9869 | 0.9226 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:19 | RQRDPVVCQY | 0.9828 | 0.6479 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:21 | RQRDPVVCQY | 0.9805 | 0.7676 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:29 | QRDPVVCQYL | 0.9804 | 0.901 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C12:16 | RQRDPVVCQY | 0.9682 | 0.9328 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:95 | RQRDPVVCQY | 0.9638 | 0.5423 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:67 | RQRDPVVCQY | 0.9531 | 0.8799 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:80 | RQRDPVVCQY | 0.9531 | 0.8799 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:46 | RQRDPVVCQY | 0.9465 | 0.8148 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:27 | RQRDPVVCQY | 0.9388 | 0.8994 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C12:16 | QRDPVVCQYL | 0.9344 | 0.9541 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:10 | RQRDPVVCQY | 0.9339 | 0.9145 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:46 | QRDPVVCQYL | 0.9227 | 0.8773 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:19 | QRDPVVCQYL | 0.9029 | 0.7097 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:05 | RQRDPVVCQY | 0.902 | 0.7094 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:10 | QRDPVVCQYL | 0.8929 | 0.943 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:31 | RQRDPVVCQY | 0.8048 | 0.7253 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:04 | RQRDPVVCQYL | 0.9995 | 0.7386 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:07 | RQRDPVVCQYL | 0.9994 | 0.5214 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:07 | GRQRDPVVCQY | 0.9898 | 0.5225 | 7 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:04 | GRQRDPVVCQY | 0.9802 | 0.7764 | 7 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B27:10 | QRDPVVCQY | 0.996 | 0.6727 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:01 | QRDPVVCQY | 0.9894 | 0.6751 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:17 | QRDPVVCQY | 0.9823 | 0.9289 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:02 | QRDPVVCQY | 0.8663 | 0.9139 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:22 | QRDPVVCQY | 0.8436 | 0.7261 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C18:01 | QRDPVVCQY | 0.8058 | 0.8566 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-A30:01 | RQRDPVVCQ | 0.7712 | 0.6607 | 8 | 17 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B48:02 | QRDPVVCQY | 0.7479 | 0.8935 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:04 | QRDPVVCQY | 0.7311 | 0.9511 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B38:05 | QRDPVVCQY | 0.5678 | 0.9705 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C06:08 | QRDPVVCQY | 0.4371 | 0.9782 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B18:03 | QRDPVVCQY | 0.3952 | 0.8321 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C06:06 | QRDPVVCQY | 0.3952 | 0.9882 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B18:08 | QRDPVVCQY | 0.3511 | 0.7922 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C03:67 | QRDPVVCQY | 0.3336 | 0.962 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B18:06 | QRDPVVCQY | 0.3312 | 0.8505 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C04:04 | QRDPVVCQY | 0.3305 | 0.8924 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:09 | QRDPVVCQY | 0.2157 | 0.7541 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:54 | QRDPVVCQY | 0.082 | 0.8185 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:68 | QRDPVVCQY | 0.0683 | 0.5683 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C06:02 | QRDPVVCQY | 0.0171 | 0.9863 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C06:17 | QRDPVVCQY | 0.0171 | 0.9863 | 9 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:27 | RQRDPVVCQY | 0.9999 | 0.7812 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:34 | RQRDPVVCQY | 0.9999 | 0.7476 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:33 | RQRDPVVCQY | 0.9999 | 0.7476 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:50 | RQRDPVVCQY | 0.9999 | 0.8523 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:125 | RQRDPVVCQY | 0.9999 | 0.7476 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:135 | RQRDPVVCQY | 0.9999 | 0.7761 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:12 | RQRDPVVCQY | 0.9997 | 0.7293 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:24 | RQRDPVVCQY | 0.9997 | 0.7555 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:35 | RQRDPVVCQY | 0.9991 | 0.7562 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:53 | RQRDPVVCQY | 0.9989 | 0.7375 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B27:06 | QRDPVVCQYL | 0.9985 | 0.5607 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B27:10 | RQRDPVVCQY | 0.997 | 0.5872 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B39:31 | QRDPVVCQYL | 0.9953 | 0.912 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C18:01 | QRDPVVCQYL | 0.9945 | 0.9387 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:39 | RQRDPVVCQY | 0.9932 | 0.6867 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B38:05 | QRDPVVCQYL | 0.9916 | 0.9687 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:54 | RQRDPVVCQY | 0.9914 | 0.6956 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:01 | QRDPVVCQYL | 0.9875 | 0.6316 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C06:06 | QRDPVVCQYL | 0.9833 | 0.9881 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:22 | QRDPVVCQYL | 0.9793 | 0.7274 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:73 | RQRDPVVCQY | 0.9665 | 0.7497 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:22 | RQRDPVVCQY | 0.9663 | 0.6467 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:04 | QRDPVVCQYL | 0.9655 | 0.9428 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:01 | RQRDPVVCQY | 0.9648 | 0.5279 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B39:11 | QRDPVVCQYL | 0.9635 | 0.9098 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C07:02 | RQRDPVVCQY | 0.9531 | 0.8799 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C06:08 | QRDPVVCQYL | 0.9522 | 0.9718 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:30 | RQRDPVVCQY | 0.9509 | 0.862 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C02:10 | RQRDPVVCQY | 0.9449 | 0.9045 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C02:02 | RQRDPVVCQY | 0.9449 | 0.9045 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-A30:01 | RQRDPVVCQY | 0.9442 | 0.6819 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:20 | RQRDPVVCQY | 0.9061 | 0.7823 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C06:17 | QRDPVVCQYL | 0.8809 | 0.9862 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-C06:02 | QRDPVVCQYL | 0.8809 | 0.9862 | 9 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B35:28 | RQRDPVVCQY | 0.8692 | 0.823 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B48:02 | RQRDPVVCQY | 0.8103 | 0.7871 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-A32:01 | RQRDPVVCQY | 0.8014 | 0.8774 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B35:20 | RQRDPVVCQY | 0.7723 | 0.8487 | 8 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B27:10 | GRQRDPVVCQY | 0.9999 | 0.5648 | 7 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:125 | RQRDPVVCQYL | 0.9996 | 0.704 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:34 | RQRDPVVCQYL | 0.9996 | 0.704 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:135 | RQRDPVVCQYL | 0.9996 | 0.7115 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:33 | RQRDPVVCQYL | 0.9996 | 0.704 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:50 | RQRDPVVCQYL | 0.9995 | 0.8522 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:24 | RQRDPVVCQYL | 0.9994 | 0.7234 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:35 | RQRDPVVCQYL | 0.9993 | 0.7291 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:73 | RQRDPVVCQYL | 0.9975 | 0.8199 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:30 | RQRDPVVCQYL | 0.9973 | 0.8564 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:53 | RQRDPVVCQYL | 0.9959 | 0.6877 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:35 | GRQRDPVVCQY | 0.9876 | 0.7351 | 7 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:135 | GRQRDPVVCQY | 0.9873 | 0.7467 | 7 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:34 | GRQRDPVVCQY | 0.9872 | 0.7056 | 7 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:125 | GRQRDPVVCQY | 0.9872 | 0.7056 | 7 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:33 | GRQRDPVVCQY | 0.9872 | 0.7056 | 7 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:50 | GRQRDPVVCQY | 0.9825 | 0.7919 | 7 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:53 | GRQRDPVVCQY | 0.9764 | 0.7082 | 7 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:54 | RQRDPVVCQYL | 0.9683 | 0.654 | 8 | 19 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B15:54 | GRQRDPVVCQY | 0.9613 | 0.6734 | 7 | 18 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | HLA-B39:02 | RQRDPVVCQYL | 0.9423 | 0.9229 | 8 | 19 |
Top |
Potential FusionNeoAntigen Information of ARRB1-PRCP in HLA II |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| ARRB1-PRCP_75062632_82549616.msa | |
| ARRB1-PRCP_75062632_82550467.msa |
Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | DRB1-1332 | PATVADHGRQRDPAC | 0 | 15 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 | DRB1-1348 | PATVADHGRQRDPAC | 0 | 15 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | DRB1-1304 | PATVADHGRQRDPVV | 0 | 15 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | DRB1-1332 | PATVADHGRQRDPVV | 0 | 15 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | DRB1-1338 | PATVADHGRQRDPVV | 0 | 15 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | DRB1-1348 | PATVADHGRQRDPVV | 0 | 15 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | DRB1-1365 | PATVADHGRQRDPVV | 0 | 15 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | DRB1-1375 | PATVADHGRQRDPVV | 0 | 15 |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 | DRB1-1393 | PATVADHGRQRDPVV | 0 | 15 |
Top |
Fusion breakpoint peptide structures of ARRB1-PRCP |
3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 3332 | HGRQRDPACTEVVM | ARRB1 | PRCP | chr11 | 75062632 | chr11 | 82549616 | 118 |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 3335 | HGRQRDPVVCQYLK | ARRB1 | PRCP | chr11 | 75062632 | chr11 | 82550467 | 118 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ARRB1-PRCP |
Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens* We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 3332 | HGRQRDPACTEVVM | -6.01316 | -6.12656 |
| HLA-B14:02 | 3BVN | 3332 | HGRQRDPACTEVVM | -3.92858 | -4.96388 |
| HLA-B52:01 | 3W39 | 3332 | HGRQRDPACTEVVM | -5.92102 | -6.95632 |
| HLA-B52:01 | 3W39 | 3332 | HGRQRDPACTEVVM | -4.84472 | -4.95812 |
| HLA-A24:02 | 5HGA | 3332 | HGRQRDPACTEVVM | -8.26357 | -9.29887 |
| HLA-A24:02 | 5HGA | 3332 | HGRQRDPACTEVVM | -7.03366 | -7.14706 |
| HLA-B44:05 | 3DX8 | 3332 | HGRQRDPACTEVVM | -6.13971 | -6.25311 |
| HLA-B44:05 | 3DX8 | 3332 | HGRQRDPACTEVVM | -5.20728 | -6.24258 |
| HLA-A02:01 | 6TDR | 3332 | HGRQRDPACTEVVM | -5.28864 | -5.40204 |
| HLA-B14:02 | 3BVN | 3335 | HGRQRDPVVCQYLK | -7.4838 | -7.5956 |
| HLA-B14:02 | 3BVN | 3335 | HGRQRDPVVCQYLK | -3.16066 | -4.20376 |
| HLA-B52:01 | 3W39 | 3335 | HGRQRDPVVCQYLK | -6.93679 | -7.04859 |
| HLA-B52:01 | 3W39 | 3335 | HGRQRDPVVCQYLK | -6.10064 | -7.14374 |
| HLA-A11:01 | 4UQ2 | 3335 | HGRQRDPVVCQYLK | -7.21307 | -7.32487 |
| HLA-A24:02 | 5HGA | 3335 | HGRQRDPVVCQYLK | -6.56769 | -6.67949 |
| HLA-A24:02 | 5HGA | 3335 | HGRQRDPVVCQYLK | -4.65311 | -5.69621 |
| HLA-B44:05 | 3DX8 | 3335 | HGRQRDPVVCQYLK | -6.68002 | -6.79182 |
| HLA-B44:05 | 3DX8 | 3335 | HGRQRDPVVCQYLK | -3.22493 | -4.26803 |
Top |
Vaccine Design for the FusionNeoAntigens of ARRB1-PRCP |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 11 | 20 | DPACTEVVM | GACCCGGCCTGCACAGAAGTAGTCATG |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 6 | 15 | HGRQRDPAC | CATGGGCGACAAAGGGACCCGGCCTGC |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 8 | 18 | RQRDPACTEV | CGACAAAGGGACCCGGCCTGCACAGAAGTA |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 8 | 19 | RQRDPACTEVV | CGACAAAGGGACCCGGCCTGCACAGAAGTAGTC |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 9 | 18 | QRDPACTEV | CAAAGGGACCCGGCCTGCACAGAAGTA |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 9 | 20 | QRDPACTEVVM | CAAAGGGACCCGGCCTGCACAGAAGTAGTCATG |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 7 | 18 | GRQRDPVVCQY | GGGCGACAAAGGGACCCGGTAGTGTGCCAGTAT |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 8 | 17 | RQRDPVVCQ | CGACAAAGGGACCCGGTAGTGTGCCAG |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 8 | 18 | RQRDPVVCQY | CGACAAAGGGACCCGGTAGTGTGCCAGTAT |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 8 | 19 | RQRDPVVCQYL | CGACAAAGGGACCCGGTAGTGTGCCAGTATTTG |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 9 | 18 | QRDPVVCQY | CAAAGGGACCCGGTAGTGTGCCAGTAT |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 9 | 19 | QRDPVVCQYL | CAAAGGGACCCGGTAGTGTGCCAGTATTTG |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82549616 | 0 | 15 | PATVADHGRQRDPAC | CCTGCGACCGTCGCGGACCATGGGCGACAAAGGGACCCGGCCTGC |
| ARRB1-PRCP | chr11 | 75062632 | chr11 | 82550467 | 0 | 15 | PATVADHGRQRDPVV | CCTGCGACCGTCGCGGACCATGGGCGACAAAGGGACCCGGTAGTG |
Top |
Information of the samples that have these potential fusion neoantigens of ARRB1-PRCP |
These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| SKCM | ARRB1-PRCP | chr11 | 75062632 | ENST00000360025 | chr11 | 82549616 | ENST00000313010 | TCGA-EE-A2GR-06A |
| SKCM | ARRB1-PRCP | chr11 | 75062632 | ENST00000360025 | chr11 | 82550467 | ENST00000313010 | TCGA-EE-A2GR-06A |
Top |
Potential target of CAR-T therapy development for ARRB1-PRCP |
Predicted 3D structure. We used RoseTTAFold. |
Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features* Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Subcellular localization prediction of the transmembrane domain retained fusion proteins* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ARRB1-PRCP |
Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ARRB1-PRCP |
Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |