|
|||||||
|
Fusion Protein:ZFP36L1-DAGLB |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: ZFP36L1-DAGLB | FusionPDB ID: 101038 | FusionGDB2.0 ID: 101038 | Hgene | Tgene | Gene symbol | ZFP36L1 | DAGLB | Gene ID | 677 | 221955 |
| Gene name | ZFP36 ring finger protein like 1 | diacylglycerol lipase beta | |
| Synonyms | BRF1|Berg36|ERF-1|ERF1|RNF162B|TIS11B|cMG1 | DAGLBETA|KCCR13L | |
| Cytomap | 14q24.1 | 7p22.1 | |
| Type of gene | protein-coding | protein-coding | |
| Description | mRNA decay activator protein ZFP36L1EGF-response factor 1TPA-induced sequence 11bZFP36-like 1butyrate response factor 1early response factor Berg36zinc finger protein 36, C3H type-like 1zinc finger protein 36, C3H1 type-like 1zinc finger protein, | sn1-specific diacylglycerol lipase betaDGL-beta | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | Q07352 Main function of 5'-partner protein: FUNCTION: Zinc-finger RNA-binding protein that destabilizes several cytoplasmic AU-rich element (ARE)-containing mRNA transcripts by promoting their poly(A) tail removal or deadenylation, and hence provide a mechanism for attenuating protein synthesis (PubMed:12198173, PubMed:15538381, PubMed:15467755, PubMed:17030608, PubMed:19179481, PubMed:20702587, PubMed:24700863, PubMed:25106868, PubMed:25014217, PubMed:26542173). Acts as a 3'-untranslated region (UTR) ARE mRNA-binding adapter protein to communicate signaling events to the mRNA decay machinery (PubMed:15687258). Functions by recruiting the CCR4-NOT deadenylase complex and components of the cytoplasmic RNA decay machinery to the bound ARE-containing mRNAs, and hence promotes ARE-mediated mRNA deadenylation and decay processes (PubMed:15687258, PubMed:18326031, PubMed:25106868). Induces also the degradation of ARE-containing mRNAs even in absence of poly(A) tail (By similarity). Binds to 3'-UTR ARE of numerous mRNAs (PubMed:12198173, PubMed:15538381, PubMed:15467755, PubMed:17030608, PubMed:19179481, PubMed:20702587, PubMed:24700863, PubMed:25106868, PubMed:25014217, PubMed:26542173). Positively regulates early adipogenesis by promoting ARE-mediated mRNA decay of immediate early genes (IEGs) (By similarity). Promotes ARE-mediated mRNA decay of mineralocorticoid receptor NR3C2 mRNA in response to hypertonic stress (PubMed:24700863). Negatively regulates hematopoietic/erythroid cell differentiation by promoting ARE-mediated mRNA decay of the transcription factor STAT5B mRNA (PubMed:20702587). Positively regulates monocyte/macrophage cell differentiation by promoting ARE-mediated mRNA decay of the cyclin-dependent kinase CDK6 mRNA (PubMed:26542173). Promotes degradation of ARE-containing pluripotency-associated mRNAs in embryonic stem cells (ESCs), such as NANOG, through a fibroblast growth factor (FGF)-induced MAPK-dependent signaling pathway, and hence attenuates ESC self-renewal and positively regulates mesendoderm differentiation (By similarity). May play a role in mediating pro-apoptotic effects in malignant B-cells by promoting ARE-mediated mRNA decay of BCL2 mRNA (PubMed:25014217). In association with ZFP36L2 maintains quiescence on developing B lymphocytes by promoting ARE-mediated decay of several mRNAs encoding cell cycle regulators that help B cells progress through the cell cycle, and hence ensuring accurate variable-diversity-joining (VDJ) recombination and functional immune cell formation (By similarity). Together with ZFP36L2 is also necessary for thymocyte development and prevention of T-cell acute lymphoblastic leukemia (T-ALL) transformation by promoting ARE-mediated mRNA decay of the oncogenic transcription factor NOTCH1 mRNA (By similarity). Participates in the delivery of target ARE-mRNAs to processing bodies (PBs) (PubMed:17369404). In addition to its cytosolic mRNA-decay function, plays a role in the regulation of nuclear mRNA 3'-end processing; modulates mRNA 3'-end maturation efficiency of the DLL4 mRNA through binding with an ARE embedded in a weak noncanonical polyadenylation (poly(A)) signal in endothelial cells (PubMed:21832157). Also involved in the regulation of stress granule (SG) and P-body (PB) formation and fusion (PubMed:15967811). Plays a role in vasculogenesis and endocardial development (By similarity). Plays a role in the regulation of keratinocyte proliferation, differentiation and apoptosis (PubMed:27182009). Plays a role in myoblast cell differentiation (By similarity). {ECO:0000250|UniProtKB:P17431, ECO:0000250|UniProtKB:P23950, ECO:0000269|PubMed:12198173, ECO:0000269|PubMed:15467755, ECO:0000269|PubMed:15538381, ECO:0000269|PubMed:15687258, ECO:0000269|PubMed:15967811, ECO:0000269|PubMed:17030608, ECO:0000269|PubMed:17369404, ECO:0000269|PubMed:18326031, ECO:0000269|PubMed:19179481, ECO:0000269|PubMed:20702587, ECO:0000269|PubMed:21832157, ECO:0000269|PubMed:24700863, ECO:0000269|PubMed:25014217, ECO:0000269|PubMed:25106868, ECO:0000269|PubMed:26542173, ECO:0000269|PubMed:27182009}. | Q8NCG7 Main function of 5'-partner protein: FUNCTION: Lipase that catalyzes the hydrolysis of arachidonic acid (AA)-esterified diacylglycerols (DAGs) to produce the principal endocannabinoid, 2-arachidonoylglycerol (2-AG) which can be further cleaved by downstream enzymes to release arachidonic acid (AA) for cyclooxygenase (COX)-mediated eicosanoid production (PubMed:14610053). Preferentially hydrolyzes DAGs at the sn-1 position in a calcium-dependent manner and has negligible activity against other lipids including monoacylglycerols and phospholipids (PubMed:14610053). Plays a key role in the regulation of 2-AG and AA pools utilized by COX1/2 to generate lipid mediators of macrophage and microglia inflammatory responses. Functions also as a polyunsaturated fatty acids-specific triacylglycerol lipase in macrophages. Plays an important role to support the metabolic and signaling demands of macrophages (By similarity). {ECO:0000250|UniProtKB:Q91WC9, ECO:0000269|PubMed:14610053}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000336440, ENST00000439696, ENST00000408913, ENST00000555997, | ENST00000428902, ENST00000421761, ENST00000479922, ENST00000297056, ENST00000425398, ENST00000436575, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 12 X 11 X 4=528 | 4 X 4 X 3=48 |
| # samples | 12 | 4 | |
| ** MAII score | log2(12/528*10)=-2.13750352374993 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(4/48*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: ZFP36L1 [Title/Abstract] AND DAGLB [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: ZFP36L1 [Title/Abstract] AND DAGLB [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ZFP36L1(69259598)-DAGLB(6450011), # samples:2 | ||
| Anticipated loss of major functional domain due to fusion event. | ZFP36L1-DAGLB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZFP36L1-DAGLB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZFP36L1-DAGLB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZFP36L1-DAGLB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | ZFP36L1 | GO:0000165 | MAPK cascade | 18326031|20166898 |
| Hgene | ZFP36L1 | GO:0009611 | response to wounding | 27182009 |
| Hgene | ZFP36L1 | GO:0010468 | regulation of gene expression | 20166898 |
| Hgene | ZFP36L1 | GO:0014065 | phosphatidylinositol 3-kinase signaling | 15538381 |
| Hgene | ZFP36L1 | GO:0031440 | regulation of mRNA 3'-end processing | 21832157 |
| Hgene | ZFP36L1 | GO:0032869 | cellular response to insulin stimulus | 15538381 |
| Hgene | ZFP36L1 | GO:0043488 | regulation of mRNA stability | 15467755|15538381|15687258|18326031|19179481|20702587|24700863|25014217|26542173 |
| Hgene | ZFP36L1 | GO:0045647 | negative regulation of erythrocyte differentiation | 20702587 |
| Hgene | ZFP36L1 | GO:0045657 | positive regulation of monocyte differentiation | 26542173 |
| Hgene | ZFP36L1 | GO:0061158 | 3'-UTR-mediated mRNA destabilization | 15467755|15538381|15687258|18326031|19179481|24700863|26542173 |
| Hgene | ZFP36L1 | GO:0070371 | ERK1 and ERK2 cascade | 25106868 |
| Hgene | ZFP36L1 | GO:0071320 | cellular response to cAMP | 19179481 |
| Hgene | ZFP36L1 | GO:0071356 | cellular response to tumor necrosis factor | 20166898 |
| Hgene | ZFP36L1 | GO:0071364 | cellular response to epidermal growth factor stimulus | 20166898 |
| Hgene | ZFP36L1 | GO:0071375 | cellular response to peptide hormone stimulus | 15467755|19179481 |
| Hgene | ZFP36L1 | GO:0071385 | cellular response to glucocorticoid stimulus | 20166898 |
| Hgene | ZFP36L1 | GO:0071560 | cellular response to transforming growth factor beta stimulus | 20166898 |
| Tgene | DAGLB | GO:0019369 | arachidonic acid metabolic process | 14610053 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr14:69259598/chr7:6450011) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across ZFP36L1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across DAGLB (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000439696 | ZFP36L1 | chr14 | 69259598 | - | ENST00000297056 | DAGLB | chr7 | 6450011 | - | 1517 | 359 | 302 | 808 | 168 |
| ENST00000439696 | ZFP36L1 | chr14 | 69259598 | - | ENST00000425398 | DAGLB | chr7 | 6450011 | - | 1129 | 359 | 302 | 808 | 168 |
| ENST00000439696 | ZFP36L1 | chr14 | 69259598 | - | ENST00000436575 | DAGLB | chr7 | 6450011 | - | 1046 | 359 | 302 | 808 | 168 |
| ENST00000336440 | ZFP36L1 | chr14 | 69259598 | - | ENST00000297056 | DAGLB | chr7 | 6450011 | - | 3013 | 1855 | 1798 | 2304 | 168 |
| ENST00000336440 | ZFP36L1 | chr14 | 69259598 | - | ENST00000425398 | DAGLB | chr7 | 6450011 | - | 2625 | 1855 | 1798 | 2304 | 168 |
| ENST00000336440 | ZFP36L1 | chr14 | 69259598 | - | ENST00000436575 | DAGLB | chr7 | 6450011 | - | 2542 | 1855 | 1798 | 2304 | 168 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000439696 | ENST00000297056 | ZFP36L1 | chr14 | 69259598 | - | DAGLB | chr7 | 6450011 | - | 0.07451538 | 0.9254846 |
| ENST00000439696 | ENST00000425398 | ZFP36L1 | chr14 | 69259598 | - | DAGLB | chr7 | 6450011 | - | 0.0521076 | 0.9478924 |
| ENST00000439696 | ENST00000436575 | ZFP36L1 | chr14 | 69259598 | - | DAGLB | chr7 | 6450011 | - | 0.042889077 | 0.9571109 |
| ENST00000336440 | ENST00000297056 | ZFP36L1 | chr14 | 69259598 | - | DAGLB | chr7 | 6450011 | - | 0.09222474 | 0.9077753 |
| ENST00000336440 | ENST00000425398 | ZFP36L1 | chr14 | 69259598 | - | DAGLB | chr7 | 6450011 | - | 0.078593925 | 0.9214061 |
| ENST00000336440 | ENST00000436575 | ZFP36L1 | chr14 | 69259598 | - | DAGLB | chr7 | 6450011 | - | 0.07062348 | 0.9293765 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ZFP36L1-DAGLB |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| ZFP36L1 | chr14 | 69259598 | DAGLB | chr7 | 6450011 | 1855 | 19 | SATIFDLSEVLCKYKILLHGLWYELF |
| ZFP36L1 | chr14 | 69259598 | DAGLB | chr7 | 6450011 | 359 | 19 | SATIFDLSEVLCKYKILLHGLWYELF |
Top |
Potential FusionNeoAntigen Information of ZFP36L1-DAGLB in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| ZFP36L1-DAGLB_69259598_6450011.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 1855 | HLA-A02:04 | VLCKYKILL | 0.8871 | 0.7525 | 9 | 18 |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 1855 | HLA-B15:02 | DLSEVLCKY | 0.8321 | 0.7317 | 5 | 14 |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 1855 | HLA-B15:21 | DLSEVLCKY | 0.8526 | 0.7303 | 5 | 14 |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 1855 | HLA-B15:31 | DLSEVLCKY | 0.7625 | 0.6913 | 5 | 14 |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 1855 | HLA-A25:01 | DLSEVLCKY | 0.9931 | 0.532 | 5 | 14 |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 1855 | HLA-B40:04 | SEVLCKYKI | 0.9887 | 0.6383 | 7 | 16 |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 1855 | HLA-B35:24 | DLSEVLCKY | 0.9206 | 0.7739 | 5 | 14 |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 1855 | HLA-B35:23 | DLSEVLCKY | 0.76 | 0.7125 | 5 | 14 |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 1855 | HLA-B35:20 | DLSEVLCKY | 0.7383 | 0.7764 | 5 | 14 |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 1855 | HLA-B15:11 | DLSEVLCKY | 0.6988 | 0.6432 | 5 | 14 |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 1855 | HLA-B15:08 | DLSEVLCKY | 0.6886 | 0.628 | 5 | 14 |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 1855 | HLA-B18:04 | DLSEVLCKY | 0.4729 | 0.7792 | 5 | 14 |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 1855 | HLA-B18:07 | DLSEVLCKY | 0.1553 | 0.6663 | 5 | 14 |
Top |
Potential FusionNeoAntigen Information of ZFP36L1-DAGLB in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of ZFP36L1-DAGLB |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 5618 | LSEVLCKYKILLHG | ZFP36L1 | DAGLB | chr14 | 69259598 | chr7 | 6450011 | 1855 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ZFP36L1-DAGLB |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 5618 | LSEVLCKYKILLHG | -7.15543 | -7.26883 |
| HLA-B14:02 | 3BVN | 5618 | LSEVLCKYKILLHG | -4.77435 | -5.80965 |
| HLA-B52:01 | 3W39 | 5618 | LSEVLCKYKILLHG | -6.80875 | -6.92215 |
| HLA-B52:01 | 3W39 | 5618 | LSEVLCKYKILLHG | -4.20386 | -5.23916 |
| HLA-A11:01 | 4UQ2 | 5618 | LSEVLCKYKILLHG | -7.5194 | -8.5547 |
| HLA-A11:01 | 4UQ2 | 5618 | LSEVLCKYKILLHG | -6.9601 | -7.0735 |
| HLA-A24:02 | 5HGA | 5618 | LSEVLCKYKILLHG | -7.52403 | -7.63743 |
| HLA-A24:02 | 5HGA | 5618 | LSEVLCKYKILLHG | -5.82433 | -6.85963 |
| HLA-B27:05 | 6PYJ | 5618 | LSEVLCKYKILLHG | -3.28285 | -4.31815 |
| HLA-B44:05 | 3DX8 | 5618 | LSEVLCKYKILLHG | -5.91172 | -6.94702 |
| HLA-B44:05 | 3DX8 | 5618 | LSEVLCKYKILLHG | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of ZFP36L1-DAGLB |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 5 | 14 | DLSEVLCKY | GACTTGAGCGAAGTTTTATGCAAGTAC |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 7 | 16 | SEVLCKYKI | AGCGAAGTTTTATGCAAGTACAAGATC |
| ZFP36L1-DAGLB | chr14 | 69259598 | chr7 | 6450011 | 9 | 18 | VLCKYKILL | GTTTTATGCAAGTACAAGATCTTGCTG |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of ZFP36L1-DAGLB |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| ESCA | ZFP36L1-DAGLB | chr14 | 69259598 | ENST00000336440 | chr7 | 6450011 | ENST00000297056 | TCGA-L5-A88W |
Top |
Potential target of CAR-T therapy development for ZFP36L1-DAGLB |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
| ZFP36L1 | chr14 | 69259598 | ENST00000336440 | DAGLB | chr7 | 6450011 | ENST00000297056 |  |
Top |
Related Drugs to ZFP36L1-DAGLB |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ZFP36L1-DAGLB |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies