Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:BRAF-C7orf10

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: BRAF-C7orf10
	FusionPDB ID: 10116
	FusionGDB2.0 ID: 10134
		Hgene	Tgene
	Gene symbol	BRAF	C7orf10
	Gene ID	673	79783
	Gene name	B-Raf proto-oncogene, serine/threonine kinase	succinyl-CoA:glutarate-CoA transferase
	Synonyms	B-RAF1\|B-raf\|BRAF1\|NS7\|RAFB1	C7orf10\|DERP13\|GA3\|ORF19
	Cytomap	7q34	7p14.1
	Type of gene	protein-coding	protein-coding
	Description	serine/threonine-protein kinase B-raf94 kDa B-raf proteinB-Raf proto-oncogene serine/threonine-protein kinase (p94)B-Raf serine/threonine-proteinmurine sarcoma viral (v-raf) oncogene homolog B1proto-oncogene B-Rafv-raf murine sarcoma viral oncogene	succinate--hydroxymethylglutarate CoA-transferaseRussel-Silver syndrome candidatedermal papilla-derived protein 13succinylCoA:glutarate-CoA transferase
	Modification date	20200329	20200313
	UniProtAcc	P15056 Main function of 5'-partner protein: FUNCTION: Protein kinase involved in the transduction of mitogenic signals from the cell membrane to the nucleus (Probable). Phosphorylates MAP2K1, and thereby activates the MAP kinase signal transduction pathway (PubMed:21441910, PubMed:29433126). May play a role in the postsynaptic responses of hippocampal neurons (PubMed:1508179). {ECO:0000269\|PubMed:1508179, ECO:0000269\|PubMed:21441910, ECO:0000269\|PubMed:29433126, ECO:0000305}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000288602,	ENST00000464028, ENST00000540834, ENST00000309930, ENST00000335693, ENST00000401647,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	28 X 21 X 11=6468	13 X 14 X 14=2548
	# samples	32	24
	** MAII score	log2(32/6468*10)=-4.3371758685863 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(24/2548*10)=-3.40825896664778 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: BRAF [Title/Abstract] AND C7orf10 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: BRAF [Title/Abstract] AND C7orf10 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	BRAF(140624366)-C7orf10(40789033), # samples:2
Anticipated loss of major functional domain due to fusion event.	BRAF-C7orf10 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BRAF-C7orf10 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BRAF-C7orf10 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. BRAF-C7orf10 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	BRAF	GO:0000186	activation of MAPKK activity	29433126
Hgene	BRAF	GO:0006468	protein phosphorylation	17563371
Hgene	BRAF	GO:0010828	positive regulation of glucose transmembrane transport	23010278
Hgene	BRAF	GO:0033138	positive regulation of peptidyl-serine phosphorylation	19667065
Hgene	BRAF	GO:0043066	negative regulation of apoptotic process	19667065
Hgene	BRAF	GO:0070374	positive regulation of ERK1 and ERK2 cascade	22065586
Hgene	BRAF	GO:0071277	cellular response to calcium ion	18567582
Hgene	BRAF	GO:0090150	establishment of protein localization to membrane	23010278

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:140624366/chr7:40789033)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across BRAF (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across C7orf10 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000288602	BRAF	chr7	140624366	-	ENST00000309930	C7orf10	chr7	40789033	+	706	199	61	426	121
ENST00000288602	BRAF	chr7	140624366	-	ENST00000401647	C7orf10	chr7	40789033	+	579	199	61	426	121
ENST00000288602	BRAF	chr7	140624366	-	ENST00000335693	C7orf10	chr7	40789033	+	711	199	61	426	121

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000288602	ENST00000309930	BRAF	chr7	140624366	-	C7orf10	chr7	40789033	+	0.018630447	0.9813696
ENST00000288602	ENST00000401647	BRAF	chr7	140624366	-	C7orf10	chr7	40789033	+	0.012796818	0.9872032
ENST00000288602	ENST00000335693	BRAF	chr7	140624366	-	C7orf10	chr7	40789033	+	0.017738093	0.9822619

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for BRAF-C7orf10

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
BRAF	chr7	140624366	C7orf10	chr7	40789033	199	46	AASSAADPAIPEEVLHNGLVMEMEHP

Top

Potential FusionNeoAntigen Information of BRAF-C7orf10 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

BRAF-C7orf10_140624366_40789033.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B51:01	DPAIPEEV	0.9992	0.6233	6	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B18:01	EEVLHNGL	0.9906	0.8307	11	19
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:03	DPAIPEEVL	0.9456	0.8901	6	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:08	DPAIPEEVL	0.9149	0.8619	6	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:02	DPAIPEEVL	0.7595	0.9711	6	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:04	DPAIPEEVL	0.7595	0.9711	6	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:03	IPEEVLHNGL	0.9151	0.8857	9	19
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B81:01	ADPAIPEEVL	0.8396	0.6545	5	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:03	ADPAIPEEVL	0.7784	0.9144	5	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:04	IPEEVLHNGL	0.7643	0.9173	9	19
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:02	IPEEVLHNGL	0.7643	0.9173	9	19
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B78:01	DPAIPEEV	0.999	0.7543	6	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B51:08	DPAIPEEV	0.9977	0.7512	6	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:12	DPAIPEEVL	0.7595	0.9711	6	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B78:01	DPAIPEEVL	0.7011	0.6031	6	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B39:10	DPAIPEEVL	0.4108	0.9222	6	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B42:02	DPAIPEEVL	0.2401	0.6573	6	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C05:09	AADPAIPEEV	0.9999	0.9917	4	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C08:15	AADPAIPEEV	0.9998	0.9945	4	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C08:03	AADPAIPEEV	0.8621	0.9955	4	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B56:04	ADPAIPEEVL	0.8023	0.5159	5	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:12	IPEEVLHNGL	0.7643	0.9173	9	19
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B07:12	ADPAIPEEVL	0.7642	0.555	5	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B39:10	ADPAIPEEVL	0.6869	0.9566	5	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B42:01	IPEEVLHNGL	0.6304	0.6152	9	19
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B39:10	IPEEVLHNGL	0.5864	0.8554	9	19
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C05:09	AADPAIPEEVL	1	0.9747	4	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C08:15	AADPAIPEEVL	1	0.9832	4	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C08:13	AADPAIPEEVL	0.9997	0.9828	4	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C08:04	AADPAIPEEVL	0.9997	0.9828	4	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C08:03	AADPAIPEEVL	0.9979	0.9919	4	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-A02:07	AIPEEVLHNGL	0.6816	0.5044	8	19
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B51:14	DPAIPEEV	0.999	0.594	6	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B51:21	DPAIPEEV	0.9988	0.6176	6	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B51:09	DPAIPEEV	0.9981	0.7187	6	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B18:05	EEVLHNGL	0.9906	0.8307	11	19
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B18:03	EEVLHNGL	0.988	0.819	11	19
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B18:06	EEVLHNGL	0.9869	0.8492	11	19
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B51:29	DPAIPEEV	0.9779	0.6369	6	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B51:05	DPAIPEEV	0.9769	0.5249	6	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B59:01	DPAIPEEV	0.815	0.5469	6	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-A25:01	EVLHNGLVM	0.9971	0.8583	12	21
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:23	DPAIPEEVL	0.9461	0.9032	6	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:24	DPAIPEEVL	0.9019	0.9197	6	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:09	DPAIPEEVL	0.7595	0.9711	6	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B53:02	DPAIPEEVL	0.7094	0.5165	6	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B67:01	DPAIPEEVL	0.5237	0.7987	6	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B18:07	DPAIPEEVL	0.1184	0.8621	6	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C05:01	AADPAIPEEV	0.9999	0.9917	4	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C04:03	AADPAIPEEV	0.9999	0.9415	4	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C08:02	AADPAIPEEV	0.9998	0.9945	4	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B18:11	EEVLHNGLVM	0.9088	0.6986	11	21
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C08:01	AADPAIPEEV	0.8621	0.9955	4	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B56:02	ADPAIPEEVL	0.8023	0.5159	5	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:09	IPEEVLHNGL	0.7643	0.9173	9	19
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:13	ADPAIPEEVL	0.7535	0.9182	5	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B67:01	ADPAIPEEVL	0.7068	0.9184	5	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B67:01	IPEEVLHNGL	0.6152	0.5647	9	19
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C04:03	AADPAIPEEVL	1	0.8735	4	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C08:02	AADPAIPEEVL	1	0.9832	4	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C05:01	AADPAIPEEVL	1	0.9747	4	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C03:06	AADPAIPEEVL	0.9996	0.9826	4	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C01:02	AIPEEVLHNGL	0.9992	0.9301	8	19
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-C08:01	AADPAIPEEVL	0.9979	0.9919	4	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B07:13	AADPAIPEEVL	0.9973	0.8686	4	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-A68:02	SAADPAIPEEV	0.9969	0.7377	3	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B35:13	AADPAIPEEVL	0.9963	0.9268	4	15
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-A69:01	SAADPAIPEEV	0.9922	0.8298	3	14
BRAF-C7orf10	chr7	140624366	chr7	40789033	199	HLA-B67:01	AADPAIPEEVL	0.9905	0.9519	4	15

Top

Potential FusionNeoAntigen Information of BRAF-C7orf10 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of BRAF-C7orf10

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1290	DPAIPEEVLHNGLV	BRAF	C7orf10	chr7	140624366	chr7	40789033	199

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of BRAF-C7orf10

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1290	DPAIPEEVLHNGLV	-7.15543	-7.26883
HLA-B14:02	3BVN	1290	DPAIPEEVLHNGLV	-4.77435	-5.80965
HLA-B52:01	3W39	1290	DPAIPEEVLHNGLV	-6.80875	-6.92215
HLA-B52:01	3W39	1290	DPAIPEEVLHNGLV	-4.20386	-5.23916
HLA-A11:01	4UQ2	1290	DPAIPEEVLHNGLV	-7.5194	-8.5547
HLA-A11:01	4UQ2	1290	DPAIPEEVLHNGLV	-6.9601	-7.0735
HLA-A24:02	5HGA	1290	DPAIPEEVLHNGLV	-7.52403	-7.63743
HLA-A24:02	5HGA	1290	DPAIPEEVLHNGLV	-5.82433	-6.85963
HLA-B27:05	6PYJ	1290	DPAIPEEVLHNGLV	-3.28285	-4.31815
HLA-B44:05	3DX8	1290	DPAIPEEVLHNGLV	-5.91172	-6.94702
HLA-B44:05	3DX8	1290	DPAIPEEVLHNGLV	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of BRAF-C7orf10

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
BRAF-C7orf10	chr7	140624366	chr7	40789033	11	19	EEVLHNGL	GAGGAGGTATTACACAATGGCCTC
BRAF-C7orf10	chr7	140624366	chr7	40789033	11	21	EEVLHNGLVM	GAGGAGGTATTACACAATGGCCTCGTTATG
BRAF-C7orf10	chr7	140624366	chr7	40789033	12	21	EVLHNGLVM	GAGGTATTACACAATGGCCTCGTTATG
BRAF-C7orf10	chr7	140624366	chr7	40789033	3	14	SAADPAIPEEV	TCGGCTGCGGACCCTGCCATTCCGGAGGAGGTA
BRAF-C7orf10	chr7	140624366	chr7	40789033	4	14	AADPAIPEEV	GCTGCGGACCCTGCCATTCCGGAGGAGGTA
BRAF-C7orf10	chr7	140624366	chr7	40789033	4	15	AADPAIPEEVL	GCTGCGGACCCTGCCATTCCGGAGGAGGTATTA
BRAF-C7orf10	chr7	140624366	chr7	40789033	5	15	ADPAIPEEVL	GCGGACCCTGCCATTCCGGAGGAGGTATTA
BRAF-C7orf10	chr7	140624366	chr7	40789033	6	14	DPAIPEEV	GACCCTGCCATTCCGGAGGAGGTA
BRAF-C7orf10	chr7	140624366	chr7	40789033	6	15	DPAIPEEVL	GACCCTGCCATTCCGGAGGAGGTATTA
BRAF-C7orf10	chr7	140624366	chr7	40789033	8	19	AIPEEVLHNGL	GCCATTCCGGAGGAGGTATTACACAATGGCCTC
BRAF-C7orf10	chr7	140624366	chr7	40789033	9	19	IPEEVLHNGL	ATTCCGGAGGAGGTATTACACAATGGCCTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of BRAF-C7orf10

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
THCA	BRAF-C7orf10	chr7	140624366	ENST00000288602	chr7	40789033	ENST00000309930	TCGA-FY-A40N-01A

Top

Potential target of CAR-T therapy development for BRAF-C7orf10

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to BRAF-C7orf10

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to BRAF-C7orf10

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Hgene	BRAF	C0025202	melanoma	24	CGI;CTD_human;UNIPROT
Hgene	BRAF	C1275081	Cardio-facio-cutaneous syndrome	14	CLINGEN;CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT
Hgene	BRAF	C0009402	Colorectal Carcinoma	8	CTD_human;UNIPROT
Hgene	BRAF	C0028326	Noonan Syndrome	8	CLINGEN;CTD_human;GENOMICS_ENGLAND;ORPHANET
Hgene	BRAF	C0238463	Papillary thyroid carcinoma	8	CTD_human;ORPHANET
Hgene	BRAF	C0040136	Thyroid Neoplasm	6	CGI;CTD_human
Hgene	BRAF	C0151468	Thyroid Gland Follicular Adenoma	6	CTD_human
Hgene	BRAF	C0175704	LEOPARD Syndrome	6	CLINGEN;GENOMICS_ENGLAND
Hgene	BRAF	C0549473	Thyroid carcinoma	6	CGI;CTD_human
Hgene	BRAF	C3150970	NOONAN SYNDROME 7	5	CTD_human;GENOMICS_ENGLAND;UNIPROT
Hgene	BRAF	C0009404	Colorectal Neoplasms	4	CTD_human
Hgene	BRAF	C3150971	LEOPARD SYNDROME 3	4	CTD_human;GENOMICS_ENGLAND;UNIPROT
Hgene	BRAF	C1519086	Pilomyxoid astrocytoma	3	ORPHANET
Hgene	BRAF	C0004565	Melanoma, B16	2	CTD_human
Hgene	BRAF	C0009075	Melanoma, Cloudman S91	2	CTD_human
Hgene	BRAF	C0018598	Melanoma, Harding-Passey	2	CTD_human
Hgene	BRAF	C0023443	Hairy Cell Leukemia	2	CGI;ORPHANET
Hgene	BRAF	C0025205	Melanoma, Experimental	2	CTD_human
Hgene	BRAF	C0033578	Prostatic Neoplasms	2	CTD_human
Hgene	BRAF	C0152013	Adenocarcinoma of lung (disorder)	2	CGI;CTD_human
Hgene	BRAF	C0376358	Malignant neoplasm of prostate	2	CTD_human
Hgene	BRAF	C0587248	Costello syndrome (disorder)	2	CLINGEN;CTD_human
Hgene	BRAF	C3501843	Nonmedullary Thyroid Carcinoma	2	CTD_human
Hgene	BRAF	C3501844	Familial Nonmedullary Thyroid Cancer	2	CTD_human
Hgene	BRAF	C0002448	Ameloblastoma	1	CTD_human
Hgene	BRAF	C0004114	Astrocytoma	1	CTD_human
Hgene	BRAF	C0010276	Craniopharyngioma	1	CTD_human;ORPHANET
Hgene	BRAF	C0011860	Diabetes Mellitus, Non-Insulin-Dependent	1	CTD_human
Hgene	BRAF	C0017638	Glioma	1	CGI;CTD_human
Hgene	BRAF	C0019621	Histiocytosis, Langerhans-Cell	1	CGI;ORPHANET
Hgene	BRAF	C0022665	Kidney Neoplasm	1	CTD_human
Hgene	BRAF	C0023903	Liver neoplasms	1	CTD_human
Hgene	BRAF	C0024232	Lymphatic Metastasis	1	CTD_human
Hgene	BRAF	C0024694	Mandibular Neoplasms	1	CTD_human
Hgene	BRAF	C0027659	Neoplasms, Experimental	1	CTD_human
Hgene	BRAF	C0027962	Melanocytic nevus	1	GENOMICS_ENGLAND
Hgene	BRAF	C0036920	Sezary Syndrome	1	CTD_human
Hgene	BRAF	C0041409	Turner Syndrome, Male	1	CTD_human
Hgene	BRAF	C0079773	Lymphoma, T-Cell, Cutaneous	1	CTD_human
Hgene	BRAF	C0205768	Subependymal Giant Cell Astrocytoma	1	CTD_human
Hgene	BRAF	C0206686	Adrenocortical carcinoma	1	CTD_human
Hgene	BRAF	C0206754	Neuroendocrine Tumors	1	CTD_human
Hgene	BRAF	C0259783	mixed gliomas	1	CTD_human
Hgene	BRAF	C0278875	Adult Craniopharyngioma	1	CTD_human
Hgene	BRAF	C0280783	Juvenile Pilocytic Astrocytoma	1	CTD_human
Hgene	BRAF	C0280785	Diffuse Astrocytoma	1	CTD_human
Hgene	BRAF	C0334579	Anaplastic astrocytoma	1	CGI;CTD_human
Hgene	BRAF	C0334580	Protoplasmic astrocytoma	1	CTD_human
Hgene	BRAF	C0334581	Gemistocytic astrocytoma	1	CTD_human
Hgene	BRAF	C0334582	Fibrillary Astrocytoma	1	CTD_human
Hgene	BRAF	C0334583	Pilocytic Astrocytoma	1	CGI;CTD_human
Hgene	BRAF	C0338070	Childhood Cerebral Astrocytoma	1	CTD_human
Hgene	BRAF	C0345904	Malignant neoplasm of liver	1	CTD_human
Hgene	BRAF	C0376407	Granulomatous Slack Skin	1	CTD_human
Hgene	BRAF	C0406803	Syringocystadenoma Papilliferum	1	GENOMICS_ENGLAND
Hgene	BRAF	C0431128	Papillary craniopharyngioma	1	CTD_human
Hgene	BRAF	C0431129	Adamantinous Craniopharyngioma	1	CTD_human
Hgene	BRAF	C0547065	Mixed oligoastrocytoma	1	CTD_human
Hgene	BRAF	C0555198	Malignant Glioma	1	CTD_human
Hgene	BRAF	C0596263	Carcinogenesis	1	CTD_human
Hgene	BRAF	C0684249	Carcinoma of lung	1	CGI;UNIPROT
Hgene	BRAF	C0740457	Malignant neoplasm of kidney	1	CTD_human
Hgene	BRAF	C0750935	Cerebral Astrocytoma	1	CTD_human
Hgene	BRAF	C0750936	Intracranial Astrocytoma	1	CTD_human
Hgene	BRAF	C0751061	Craniopharyngioma, Child	1	CTD_human
Hgene	BRAF	C0920269	Microsatellite Instability	1	CTD_human
Hgene	BRAF	C1527404	Female Pseudo-Turner Syndrome	1	CTD_human
Hgene	BRAF	C1704230	Grade I Astrocytoma	1	CTD_human
Hgene	BRAF	C1721098	Replication Error Phenotype	1	CTD_human
Hgene	BRAF	C2239176	Liver carcinoma	1	CTD_human
Hgene	BRAF	C4551484	Leopard Syndrome 1	1	GENOMICS_ENGLAND
Hgene	BRAF	C4551602	Noonan Syndrome 1	1	CTD_human
Hgene	BRAF	C4721532	Lymphoma, Non-Hodgkin, Familial	1	UNIPROT
Hgene	BRAF	C4733333	familial non-medullary thyroid cancer	1	GENOMICS_ENGLAND

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)