![]() |
|||||||
|
Fusion Protein:ZMYND8-TFE3 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ZMYND8-TFE3 | FusionPDB ID: 101420 | FusionGDB2.0 ID: 101420 | Hgene | Tgene | Gene symbol | ZMYND8 | TFE3 | Gene ID | 23613 | 7030 |
Gene name | zinc finger MYND-type containing 8 | transcription factor binding to IGHM enhancer 3 | |
Synonyms | PRKCBP1|PRO2893|RACK7 | RCCP2|RCCX1|TFEA|bHLHe33 | |
Cytomap | 20q13.12 | Xp11.23 | |
Type of gene | protein-coding | protein-coding | |
Description | protein kinase C-binding protein 1CTCL tumor antigen se14-3cutaneous T-cell lymphoma-associated antigen se14-3predicted protein of HQ2893zinc finger MYND domain-containing protein 8 | transcription factor E3class E basic helix-loop-helix protein 33transcription factor E family, member Atranscription factor for IgH enhancertranscription factor for immunoglobulin heavy-chain enhancer 3 | |
Modification date | 20200313 | 20200327 | |
UniProtAcc | . | P19532 Main function of 5'-partner protein: FUNCTION: Transcription factor that acts as a master regulator of lysosomal biogenesis and immune response (PubMed:2338243, PubMed:29146937, PubMed:30733432, PubMed:31672913). Specifically recognizes and binds E-box sequences (5'-CANNTG-3'); efficient DNA-binding requires dimerization with itself or with another MiT/TFE family member such as TFEB or MITF (By similarity). Involved in the cellular response to amino acid availability by acting downstream of MTOR: in the presence of nutrients, TFE3 phosphorylation by MTOR promotes its cytosolic retention and subsequent inactivation (PubMed:31672913). Upon starvation or lysosomal stress, inhibition of MTOR induces TFE3 dephosphorylation, resulting in nuclear localization and transcription factor activity (PubMed:31672913). In association with TFEB, activates the expression of CD40L in T-cells, thereby playing a role in T-cell-dependent antibody responses in activated CD4(+) T-cells and thymus-dependent humoral immunity (By similarity). Specifically recognizes the MUE3 box, a subset of E-boxes, present in the immunoglobulin enhancer (PubMed:2338243). It also binds very well to a USF/MLTF site (PubMed:2338243). May regulate lysosomal positioning in response to nutrient deprivation by promoting the expression of PIP4P1 (PubMed:29146937). Acts as a positive regulator of browning of adipose tissue by promoting expression of target genes; mTOR-dependent phosphorylation promotes cytoplasmic retention of TFE3 and inhibits browning of adipose tissue (By similarity). Maintains the pluripotent state of embryonic stem cells by promoting the expression of genes such as ESRRB; mTOR-dependent nuclear exclusion promotes exit from pluripotency (By similarity). Required to maintain the naive pluripotent state of hematopoietic stem cell; mTOR-dependent cytoplasmic retention of TFE3 promotes the exit of hematopoietic stem cell from pluripotency (PubMed:30733432). {ECO:0000250|UniProtKB:Q64092, ECO:0000269|PubMed:2338243, ECO:0000269|PubMed:29146937, ECO:0000269|PubMed:30733432, ECO:0000269|PubMed:31672913}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000262975, ENST00000311275, ENST00000352431, ENST00000355972, ENST00000360911, ENST00000372023, ENST00000396281, ENST00000446994, ENST00000458360, ENST00000461685, ENST00000471951, ENST00000536340, ENST00000540497, ENST00000468376, | ENST00000487451, ENST00000315869, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 25 X 23 X 10=5750 | 14 X 15 X 6=1260 |
# samples | 34 | 15 | |
** MAII score | log2(34/5750*10)=-4.0799553045814 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(15/1260*10)=-3.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: ZMYND8 [Title/Abstract] AND TFE3 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ZMYND8 [Title/Abstract] AND TFE3 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ZMYND8(45849965)-TFE3(48896935), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | ZMYND8-TFE3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZMYND8-TFE3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZMYND8-TFE3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZMYND8-TFE3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZMYND8-TFE3 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. ZMYND8-TFE3 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. ZMYND8-TFE3 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. ZMYND8-TFE3 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. ZMYND8-TFE3 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. ZMYND8-TFE3 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr20:45849965/chrX:48896935) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000262975 | ZMYND8 | chr20 | 45849965 | - | ENST00000315869 | TFE3 | chrX | 48896935 | - | 6428 | 3503 | 239 | 3667 | 1142 |
ENST00000446994 | ZMYND8 | chr20 | 45849965 | - | ENST00000315869 | TFE3 | chrX | 48896935 | - | 6044 | 3119 | 44 | 3283 | 1079 |
ENST00000355972 | ZMYND8 | chr20 | 45849965 | - | ENST00000315869 | TFE3 | chrX | 48896935 | - | 6442 | 3517 | 115 | 3681 | 1188 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000262975 | ENST00000315869 | ZMYND8 | chr20 | 45849965 | - | TFE3 | chrX | 48896935 | - | 0.003532143 | 0.9964678 |
ENST00000446994 | ENST00000315869 | ZMYND8 | chr20 | 45849965 | - | TFE3 | chrX | 48896935 | - | 0.002977521 | 0.99702245 |
ENST00000355972 | ENST00000315869 | ZMYND8 | chr20 | 45849965 | - | TFE3 | chrX | 48896935 | - | 0.004038085 | 0.99596196 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ZMYND8-TFE3 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ZMYND8 | chr20 | 45849965 | TFE3 | chrX | 48896935 | 3119 | 1025 | KETSAEKSKESGSPPNITAGHTSHPS |
ZMYND8 | chr20 | 45849965 | TFE3 | chrX | 48896935 | 3503 | 1088 | KETSAEKSKESGSPPNITAGHTSHPS |
ZMYND8 | chr20 | 45849965 | TFE3 | chrX | 48896935 | 3517 | 1134 | KETSAEKSKESGSPPNITAGHTSHPS |
Top |
Potential FusionNeoAntigen Information of ZMYND8-TFE3 in HLA I |
![]() |
ZMYND8-TFE3_45849965_48896935.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B13:01 | KESGSPPNI | 0.9895 | 0.7759 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B45:01 | KESGSPPNI | 0.965 | 0.6521 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-A30:08 | KSKESGSPP | 0.9648 | 0.5942 | 6 | 15 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B44:03 | KESGSPPNI | 0.9559 | 0.9158 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B41:01 | KESGSPPNI | 0.3045 | 0.7193 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B39:13 | KESGSPPNI | 0.2293 | 0.6884 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B50:01 | KESGSPPNI | 0.1943 | 0.5974 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B52:01 | KESGSPPNI | 0.006 | 0.8701 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B45:01 | AEKSKESGSP | 0.891 | 0.7059 | 4 | 14 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B45:01 | KESGSPPNITA | 0.9997 | 0.8235 | 8 | 19 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B50:02 | KESGSPPNITA | 0.9994 | 0.5073 | 8 | 19 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B45:01 | AEKSKESGSPP | 0.9979 | 0.6905 | 4 | 15 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B50:01 | KESGSPPNITA | 0.9973 | 0.6977 | 8 | 19 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B41:01 | KESGSPPNITA | 0.9958 | 0.8096 | 8 | 19 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B40:06 | KESGSPPNI | 0.9996 | 0.539 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B39:08 | KESGSPPNI | 0.343 | 0.602 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B40:06 | KESGSPPNITA | 0.9998 | 0.585 | 8 | 19 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B40:04 | KESGSPPNI | 0.9982 | 0.6124 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B44:07 | KESGSPPNI | 0.9559 | 0.9158 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B44:26 | KESGSPPNI | 0.9559 | 0.9158 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B44:13 | KESGSPPNI | 0.9559 | 0.9158 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B50:04 | KESGSPPNI | 0.1943 | 0.5974 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B50:05 | KESGSPPNI | 0.1943 | 0.5974 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B39:02 | KESGSPPNI | 0.1556 | 0.706 | 8 | 17 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B50:05 | KESGSPPNITA | 0.9973 | 0.6977 | 8 | 19 |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 | HLA-B50:04 | KESGSPPNITA | 0.9973 | 0.6977 | 8 | 19 |
Top |
Potential FusionNeoAntigen Information of ZMYND8-TFE3 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of ZMYND8-TFE3 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
4601 | KSKESGSPPNITAG | ZMYND8 | TFE3 | chr20 | 45849965 | chrX | 48896935 | 3503 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ZMYND8-TFE3 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 4601 | KSKESGSPPNITAG | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 4601 | KSKESGSPPNITAG | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 4601 | KSKESGSPPNITAG | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 4601 | KSKESGSPPNITAG | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 4601 | KSKESGSPPNITAG | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 4601 | KSKESGSPPNITAG | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 4601 | KSKESGSPPNITAG | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 4601 | KSKESGSPPNITAG | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 4601 | KSKESGSPPNITAG | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 4601 | KSKESGSPPNITAG | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 4601 | KSKESGSPPNITAG | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of ZMYND8-TFE3 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 4 | 14 | AEKSKESGSP | GCTGAGAAAAGCAAGGAGAGTGGCTCGCCT |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 4 | 15 | AEKSKESGSPP | GCTGAGAAAAGCAAGGAGAGTGGCTCGCCTCCC |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 6 | 15 | KSKESGSPP | AAAAGCAAGGAGAGTGGCTCGCCTCCC |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 8 | 17 | KESGSPPNI | AAGGAGAGTGGCTCGCCTCCCAATATC |
ZMYND8-TFE3 | chr20 | 45849965 | chrX | 48896935 | 8 | 19 | KESGSPPNITA | AAGGAGAGTGGCTCGCCTCCCAATATCACTGCA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of ZMYND8-TFE3 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
UCEC | ZMYND8-TFE3 | chr20 | 45849965 | ENST00000262975 | chrX | 48896935 | ENST00000315869 | TCGA-B5-A3FB-01A |
Top |
Potential target of CAR-T therapy development for ZMYND8-TFE3 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ZMYND8-TFE3 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ZMYND8-TFE3 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Tgene | TFE3 | C4518356 | MiT family translocation renal cell carcinoma | 2 | ORPHANET |
Tgene | TFE3 | C0206657 | Alveolar Soft Part Sarcoma | 1 | ORPHANET |
Tgene | TFE3 | C0206732 | Epithelioid hemangioendothelioma | 1 | ORPHANET |