Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ZNF154-KIR2DL1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ZNF154-KIR2DL1
	FusionPDB ID: 101543
	FusionGDB2.0 ID: 101543
		Hgene	Tgene
	Gene symbol	ZNF154	KIR2DL1
	Gene ID	7710	3802
	Gene name	zinc finger protein 154	killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 1
	Synonyms	pHZ-92	CD158A\|KIR-K64\|KIR221\|KIR2DL3\|NKAT\|NKAT-1\|NKAT1\|p58.1
	Cytomap	19q13.43	19q13.42
	Type of gene	protein-coding	protein-coding
	Description	zinc finger protein 154	killer cell immunoglobulin-like receptor 2DL1CD158 antigen-like family member AKIR2DL proteinKIR2DL1/3DL2MHC class I NK cell receptorkiller cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1killer inhibitory receptor 2-2-1natu
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000426889, ENST00000512439,	ENST00000291633, ENST00000336077,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	2 X 2 X 1=4	3 X 4 X 2=24
	# samples	1	4
	** MAII score	log2(1/4*10)=1.32192809488736	log2(4/24*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0
Fusion gene context	PubMed: ZNF154 [Title/Abstract] AND KIR2DL1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ZNF154 [Title/Abstract] AND KIR2DL1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ZNF154(58216221)-KIR2DL1(55284785), # samples:2
Anticipated loss of major functional domain due to fusion event.	ZNF154-KIR2DL1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF154-KIR2DL1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF154-KIR2DL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF154-KIR2DL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF154-KIR2DL1 seems lost the major protein functional domain in Hgene partner, which is a transcription factor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	KIR2DL1	GO:0002769	natural killer cell inhibitory signaling pathway	18604210

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:58216221/chr19:55284785)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ZNF154 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across KIR2DL1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000426889	ZNF154	chr19	58216221	-	ENST00000336077	KIR2DL1	chr19	55284785	+	1886	400	177	1376	399
ENST00000426889	ZNF154	chr19	58216221	-	ENST00000291633	KIR2DL1	chr19	55284785	+	1507	400	177	1454	425
ENST00000426889	ZNF154	chr19	58216221	-	ENST00000336077	KIR2DL1	chr19	55282301	+	1922	400	177	1412	411
ENST00000426889	ZNF154	chr19	58216221	-	ENST00000291633	KIR2DL1	chr19	55282301	+	1543	400	177	1490	437

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000426889	ENST00000336077	ZNF154	chr19	58216221	-	KIR2DL1	chr19	55284785	+	0.020875435	0.9791246
ENST00000426889	ENST00000291633	ZNF154	chr19	58216221	-	KIR2DL1	chr19	55284785	+	0.04883328	0.95116675
ENST00000426889	ENST00000336077	ZNF154	chr19	58216221	-	KIR2DL1	chr19	55282301	+	0.025600338	0.9743997
ENST00000426889	ENST00000291633	ZNF154	chr19	58216221	-	KIR2DL1	chr19	55282301	+	0.04657053	0.95342946

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ZNF154-KIR2DL1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ZNF154	chr19	58216221	KIR2DL1	chr19	55282301	400	145	LRLIGEHHDGVSKANFSISRMTQDLA
ZNF154	chr19	58216221	KIR2DL1	chr19	55282301	400	157	KANFSISRMTQDLAGTYRCYGSVTHS
ZNF154	chr19	58216221	KIR2DL1	chr19	55282301	400	158	ANFSISRMTQDLAGTYRCYGSVTHSP
ZNF154	chr19	58216221	KIR2DL1	chr19	55282301	400	31	QSLMAAATLRTPTQGTVTFEDVAVHF
ZNF154	chr19	58216221	KIR2DL1	chr19	55282301	400	74	DVMLENLALLTSLGFFLLQGAWPHEG
ZNF154	chr19	58216221	KIR2DL1	chr19	55282301	400	86	LGFFLLQGAWPHEGVHRKPSLLAHPG
ZNF154	chr19	58216221	KIR2DL1	chr19	55284785	400	31	QSLMAAATLRTPTQGTVTFEDVAVHF
ZNF154	chr19	58216221	KIR2DL1	chr19	55284785	400	73	RDVMLENLALLTSLGVHRKPSLLAHP

Top

Potential FusionNeoAntigen Information of ZNF154-KIR2DL1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ZNF154-KIR2DL1_58216221_55282301.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-B15:17	KANFSISRM	0.9978	0.7536	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C15:04	KANFSISRM	0.999	0.7838	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C03:07	KANFSISRM	0.9979	0.9543	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C15:06	KANFSISRM	0.9978	0.8462	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C03:19	KANFSISRM	0.9974	0.9747	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C03:08	KANFSISRM	0.9952	0.8182	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C12:12	KANFSISRM	0.9047	0.926	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C03:14	KANFSISRM	0.9023	0.9441	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C06:03	KANFSISRM	0.8468	0.9875	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C12:04	KANFSISRM	0.8377	0.9819	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C02:06	KANFSISRM	0.7567	0.9135	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C15:09	KANFSISRM	0.999	0.7838	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C15:05	KANFSISRM	0.9966	0.843	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C15:02	KANFSISRM	0.9957	0.7759	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C03:17	KANFSISRM	0.9952	0.9383	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C03:05	KANFSISRM	0.9937	0.9137	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C03:02	KANFSISRM	0.9932	0.941	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C03:04	KANFSISRM	0.9885	0.9773	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C03:03	KANFSISRM	0.9885	0.9773	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C16:02	KANFSISRM	0.9671	0.9755	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C16:01	KANFSISRM	0.9647	0.9541	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C16:04	KANFSISRM	0.9451	0.9705	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C12:03	KANFSISRM	0.8908	0.9541	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C12:02	KANFSISRM	0.8476	0.9359	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C02:10	KANFSISRM	0.7793	0.9351	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-C02:02	KANFSISRM	0.7793	0.9351	12	21
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	HLA-B07:13	KANFSISRM	0.6203	0.6373	12	21

Top

Potential FusionNeoAntigen Information of ZNF154-KIR2DL1 in HLA II

ZNF154-KIR2DL1_58216221_55282301.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB1-1502	LAGTYRCYGSVTHSP	11	26
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB1-1508	LAGTYRCYGSVTHSP	11	26
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB1-1514	LAGTYRCYGSVTHSP	11	26
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB1-1515	LAGTYRCYGSVTHSP	11	26
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB1-1519	LAGTYRCYGSVTHSP	11	26
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB1-1526	LAGTYRCYGSVTHSP	11	26
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB1-1531	LAGTYRCYGSVTHSP	11	26
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB1-1538	LAGTYRCYGSVTHSP	11	26
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB1-1539	LAGTYRCYGSVTHSP	11	26
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB1-1544	LAGTYRCYGSVTHSP	11	26
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB1-1547	LAGTYRCYGSVTHSP	11	26
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB4-0101	NFSISRMTQDLAGTY	1	16
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB4-0101	ANFSISRMTQDLAGT	0	15
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB4-0103	NFSISRMTQDLAGTY	1	16
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB4-0103	ANFSISRMTQDLAGT	0	15
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB4-0104	NFSISRMTQDLAGTY	1	16
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB4-0106	NFSISRMTQDLAGTY	1	16
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB4-0106	ANFSISRMTQDLAGT	0	15
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB4-0107	NFSISRMTQDLAGTY	1	16
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB4-0107	ANFSISRMTQDLAGT	0	15
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB4-0108	NFSISRMTQDLAGTY	1	16
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	400	DRB4-0108	ANFSISRMTQDLAGT	0	15

Top

Fusion breakpoint peptide structures of ZNF154-KIR2DL1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3344	HHDGVSKANFSISR	ZNF154	KIR2DL1	chr19	58216221	chr19	55282301	400

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ZNF154-KIR2DL1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3344	HHDGVSKANFSISR	-7.9962	-8.1096
HLA-B14:02	3BVN	3344	HHDGVSKANFSISR	-5.70842	-6.74372
HLA-B52:01	3W39	3344	HHDGVSKANFSISR	-6.83737	-6.95077
HLA-B52:01	3W39	3344	HHDGVSKANFSISR	-4.4836	-5.5189
HLA-A11:01	4UQ2	3344	HHDGVSKANFSISR	-10.0067	-10.1201
HLA-A11:01	4UQ2	3344	HHDGVSKANFSISR	-9.03915	-10.0745
HLA-A24:02	5HGA	3344	HHDGVSKANFSISR	-6.56204	-6.67544
HLA-A24:02	5HGA	3344	HHDGVSKANFSISR	-5.42271	-6.45801
HLA-B44:05	3DX8	3344	HHDGVSKANFSISR	-7.85648	-8.89178
HLA-B44:05	3DX8	3344	HHDGVSKANFSISR	-5.3978	-5.5112
HLA-A02:01	6TDR	3344	HHDGVSKANFSISR	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ZNF154-KIR2DL1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	12	21	KANFSISRM	TAGGGTTCTTCTTGCTGCAGGGGGCCT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	0	15	ANFSISRMTQDLAGT	ATGTGATGCTGGAGAACTTGGCTCTTTTAACCTCTCTAGGGTTCT
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	1	16	NFSISRMTQDLAGTY	TGATGCTGGAGAACTTGGCTCTTTTAACCTCTCTAGGGTTCTTCT
ZNF154-KIR2DL1	chr19	58216221	chr19	55282301	11	26	LAGTYRCYGSVTHSP	CTCTAGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGAG

Top

Information of the samples that have these potential fusion neoantigens of ZNF154-KIR2DL1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	ZNF154-KIR2DL1	chr19	58216221	ENST00000426889	chr19	55282301	ENST00000336077	TCGA-A1-A0SQ-01A

Top

Potential target of CAR-T therapy development for ZNF154-KIR2DL1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

KIR2DL1

chr19:58216221

chr19:55282301

ENST00000336077

246_264

349.0

Transmembrane

Helical

Tgene

KIR2DL1

chr19:58216221

chr19:55284785

ENST00000336077

246_264

349.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ZNF154-KIR2DL1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ZNF154-KIR2DL1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)