Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ZNF532-NEDD4L

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ZNF532-NEDD4L
	FusionPDB ID: 102301
	FusionGDB2.0 ID: 102301
		Hgene	Tgene
	Gene symbol	ZNF532	NEDD4L
	Gene ID	55205	23327
	Gene name	zinc finger protein 532	NEDD4 like E3 ubiquitin protein ligase
	Synonyms	-	NEDD4-2\|NEDD4.2\|PVNH7\|RSP5\|hNEDD4-2
	Cytomap	18q21.32	18q21.31
	Type of gene	protein-coding	protein-coding
	Description	zinc finger protein 532	E3 ubiquitin-protein ligase NEDD4-likeHECT-type E3 ubiquitin transferase NED4Lneural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligaseubiquitin-protein ligase Rsp5
	Modification date	20200313	20200329
	UniProtAcc	.	Q96PU5 Main function of 5'-partner protein: FUNCTION: E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. Inhibits TGF-beta signaling by triggering SMAD2 and TGFBR1 ubiquitination and proteasome-dependent degradation. Promotes ubiquitination and internalization of various plasma membrane channels such as ENaC, SCN2A/Nav1.2, SCN3A/Nav1.3, SCN5A/Nav1.5, SCN9A/Nav1.7, SCN10A/Nav1.8, KCNA3/Kv1.3, KCNH2, EAAT1, KCNQ2/Kv7.2, KCNQ3/Kv7.3 or CLC5 (PubMed:26363003, PubMed:27445338). Promotes ubiquitination and degradation of SGK1 and TNK2. Ubiquitinates BRAT1 and this ubiquitination is enhanced in the presence of NDFIP1 (PubMed:25631046). Plays a role in dendrite formation by melanocytes (PubMed:23999003). Involved in the regulation of TOR signaling (PubMed:27694961). Ubiquitinates and regulates protein levels of NTRK1 once this one is activated by NGF (PubMed:27445338). {ECO:0000250\|UniProtKB:Q8CFI0, ECO:0000269\|PubMed:12911626, ECO:0000269\|PubMed:15040001, ECO:0000269\|PubMed:15217910, ECO:0000269\|PubMed:15489223, ECO:0000269\|PubMed:15496141, ECO:0000269\|PubMed:15576372, ECO:0000269\|PubMed:19144635, ECO:0000269\|PubMed:23999003, ECO:0000269\|PubMed:25631046, ECO:0000269\|PubMed:26363003, ECO:0000269\|PubMed:27445338, ECO:0000269\|PubMed:27694961}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000336078, ENST00000589288, ENST00000591083, ENST00000591230, ENST00000591808, ENST00000588956,	ENST00000588516, ENST00000256830, ENST00000256832, ENST00000357895, ENST00000382850, ENST00000435432, ENST00000456986, ENST00000586263, ENST00000431212, ENST00000456173, ENST00000589054, ENST00000356462, ENST00000400345,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	12 X 11 X 10=1320	27 X 28 X 6=4536
	# samples	16	32
	** MAII score	log2(16/1320*10)=-3.04439411935845 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(32/4536*10)=-3.82527683005487 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ZNF532 [Title/Abstract] AND NEDD4L [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ZNF532 [Title/Abstract] AND NEDD4L [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ZNF532(56585954)-NEDD4L(56018223), # samples:2
Anticipated loss of major functional domain due to fusion event.	ZNF532-NEDD4L seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF532-NEDD4L seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF532-NEDD4L seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF532-NEDD4L seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	NEDD4L	GO:0003254	regulation of membrane depolarization	15217910
Tgene	NEDD4L	GO:0006511	ubiquitin-dependent protein catabolic process	21463633
Tgene	NEDD4L	GO:0010038	response to metal ion	11244092
Tgene	NEDD4L	GO:0016567	protein ubiquitination	15217910\|25631046
Tgene	NEDD4L	GO:0034765	regulation of ion transmembrane transport	17289006
Tgene	NEDD4L	GO:0042391	regulation of membrane potential	17289006
Tgene	NEDD4L	GO:0043161	proteasome-mediated ubiquitin-dependent protein catabolic process	21463633
Tgene	NEDD4L	GO:0060306	regulation of membrane repolarization	21463633
Tgene	NEDD4L	GO:0070936	protein K48-linked ubiquitination	21463633
Tgene	NEDD4L	GO:1901016	regulation of potassium ion transmembrane transporter activity	17289006
Tgene	NEDD4L	GO:1901017	negative regulation of potassium ion transmembrane transporter activity	21463633
Tgene	NEDD4L	GO:1901380	negative regulation of potassium ion transmembrane transport	21463633
Tgene	NEDD4L	GO:1902306	negative regulation of sodium ion transmembrane transport	15217910
Tgene	NEDD4L	GO:1903861	positive regulation of dendrite extension	23999003
Tgene	NEDD4L	GO:2000009	negative regulation of protein localization to cell surface	21463633
Tgene	NEDD4L	GO:2000650	negative regulation of sodium ion transmembrane transporter activity	15217910

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr18:56585954/chr18:56018223)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ZNF532 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NEDD4L (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000336078	ZNF532	chr18	56587865	+	ENST00000356462	NEDD4L	chr18	55833020	+	6115	3122	764	5809	1681
ENST00000336078	ZNF532	chr18	56587865	+	ENST00000400345	NEDD4L	chr18	55833020	+	6438	3122	764	6001	1745
ENST00000591083	ZNF532	chr18	56587865	+	ENST00000356462	NEDD4L	chr18	55833020	+	5685	2692	334	5379	1681
ENST00000591083	ZNF532	chr18	56587865	+	ENST00000400345	NEDD4L	chr18	55833020	+	6008	2692	334	5571	1745
ENST00000589288	ZNF532	chr18	56587865	+	ENST00000356462	NEDD4L	chr18	55833020	+	5540	2547	189	5234	1681
ENST00000589288	ZNF532	chr18	56587865	+	ENST00000400345	NEDD4L	chr18	55833020	+	5863	2547	189	5426	1745
ENST00000591230	ZNF532	chr18	56587865	+	ENST00000356462	NEDD4L	chr18	55833020	+	5693	2700	342	5387	1681
ENST00000591230	ZNF532	chr18	56587865	+	ENST00000400345	NEDD4L	chr18	55833020	+	6016	2700	342	5579	1745
ENST00000591808	ZNF532	chr18	56587865	+	ENST00000356462	NEDD4L	chr18	55833020	+	6228	3235	877	5922	1681
ENST00000591808	ZNF532	chr18	56587865	+	ENST00000400345	NEDD4L	chr18	55833020	+	6551	3235	877	6114	1745
ENST00000336078	ZNF532	chr18	56585954	+	ENST00000356462	NEDD4L	chr18	56018223	+	4250	2670	714	3944	1076
ENST00000336078	ZNF532	chr18	56585954	+	ENST00000400345	NEDD4L	chr18	56018223	+	4381	2670	714	3944	1076
ENST00000591083	ZNF532	chr18	56585954	+	ENST00000356462	NEDD4L	chr18	56018223	+	3820	2240	284	3514	1076
ENST00000591083	ZNF532	chr18	56585954	+	ENST00000400345	NEDD4L	chr18	56018223	+	3951	2240	284	3514	1076
ENST00000589288	ZNF532	chr18	56585954	+	ENST00000356462	NEDD4L	chr18	56018223	+	3675	2095	139	3369	1076
ENST00000589288	ZNF532	chr18	56585954	+	ENST00000400345	NEDD4L	chr18	56018223	+	3806	2095	139	3369	1076
ENST00000591230	ZNF532	chr18	56585954	+	ENST00000356462	NEDD4L	chr18	56018223	+	3828	2248	292	3522	1076
ENST00000591230	ZNF532	chr18	56585954	+	ENST00000400345	NEDD4L	chr18	56018223	+	3959	2248	292	3522	1076
ENST00000591808	ZNF532	chr18	56585954	+	ENST00000356462	NEDD4L	chr18	56018223	+	4363	2783	827	4057	1076
ENST00000591808	ZNF532	chr18	56585954	+	ENST00000400345	NEDD4L	chr18	56018223	+	4494	2783	827	4057	1076

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000336078	ENST00000356462	ZNF532	chr18	56587865	+	NEDD4L	chr18	55833020	+	0.001262635	0.9987374
ENST00000336078	ENST00000400345	ZNF532	chr18	56587865	+	NEDD4L	chr18	55833020	+	0.000624994	0.99937505
ENST00000591083	ENST00000356462	ZNF532	chr18	56587865	+	NEDD4L	chr18	55833020	+	0.001043044	0.9989569
ENST00000591083	ENST00000400345	ZNF532	chr18	56587865	+	NEDD4L	chr18	55833020	+	0.000519101	0.9994809
ENST00000589288	ENST00000356462	ZNF532	chr18	56587865	+	NEDD4L	chr18	55833020	+	0.001149568	0.99885046
ENST00000589288	ENST00000400345	ZNF532	chr18	56587865	+	NEDD4L	chr18	55833020	+	0.000564323	0.9994356
ENST00000591230	ENST00000356462	ZNF532	chr18	56587865	+	NEDD4L	chr18	55833020	+	0.001038653	0.9989613
ENST00000591230	ENST00000400345	ZNF532	chr18	56587865	+	NEDD4L	chr18	55833020	+	0.000506686	0.99949324
ENST00000591808	ENST00000356462	ZNF532	chr18	56587865	+	NEDD4L	chr18	55833020	+	0.001762206	0.9982377
ENST00000591808	ENST00000400345	ZNF532	chr18	56587865	+	NEDD4L	chr18	55833020	+	0.000850032	0.9991499
ENST00000336078	ENST00000356462	ZNF532	chr18	56585954	+	NEDD4L	chr18	56018223	+	0.00099493	0.99900514
ENST00000336078	ENST00000400345	ZNF532	chr18	56585954	+	NEDD4L	chr18	56018223	+	0.000873406	0.9991266
ENST00000591083	ENST00000356462	ZNF532	chr18	56585954	+	NEDD4L	chr18	56018223	+	0.000841571	0.9991584
ENST00000591083	ENST00000400345	ZNF532	chr18	56585954	+	NEDD4L	chr18	56018223	+	0.000718187	0.9992818
ENST00000589288	ENST00000356462	ZNF532	chr18	56585954	+	NEDD4L	chr18	56018223	+	0.001014194	0.9989858
ENST00000589288	ENST00000400345	ZNF532	chr18	56585954	+	NEDD4L	chr18	56018223	+	0.000839452	0.9991605
ENST00000591230	ENST00000356462	ZNF532	chr18	56585954	+	NEDD4L	chr18	56018223	+	0.000827163	0.99917287
ENST00000591230	ENST00000400345	ZNF532	chr18	56585954	+	NEDD4L	chr18	56018223	+	0.000696915	0.9993031
ENST00000591808	ENST00000356462	ZNF532	chr18	56585954	+	NEDD4L	chr18	56018223	+	0.00144869	0.9985513
ENST00000591808	ENST00000400345	ZNF532	chr18	56585954	+	NEDD4L	chr18	56018223	+	0.001256793	0.99874324

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ZNF532-NEDD4L

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ZNF532	chr18	56585954	NEDD4L	chr18	56018223	2095	652	ATHFQQAADTSGQPGWEERIHLDGRT
ZNF532	chr18	56585954	NEDD4L	chr18	56018223	2240	652	ATHFQQAADTSGQPGWEERIHLDGRT
ZNF532	chr18	56585954	NEDD4L	chr18	56018223	2248	652	ATHFQQAADTSGQPGWEERIHLDGRT
ZNF532	chr18	56585954	NEDD4L	chr18	56018223	2670	652	ATHFQQAADTSGQPGWEERIHLDGRT
ZNF532	chr18	56585954	NEDD4L	chr18	56018223	2783	652	ATHFQQAADTSGQPGWEERIHLDGRT
ZNF532	chr18	56587865	NEDD4L	chr18	55833020	2547	785	LATHFQQAADTSGQGESRILRVKVVS
ZNF532	chr18	56587865	NEDD4L	chr18	55833020	2692	785	LATHFQQAADTSGQGESRILRVKVVS
ZNF532	chr18	56587865	NEDD4L	chr18	55833020	2700	785	LATHFQQAADTSGQGESRILRVKVVS
ZNF532	chr18	56587865	NEDD4L	chr18	55833020	3122	785	LATHFQQAADTSGQGESRILRVKVVS
ZNF532	chr18	56587865	NEDD4L	chr18	55833020	3235	785	LATHFQQAADTSGQGESRILRVKVVS

Top

Potential FusionNeoAntigen Information of ZNF532-NEDD4L in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ZNF532-NEDD4L_56585954_56018223.msa
ZNF532-NEDD4L_56587865_55833020.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B44:02	ADTSGQPGW	0.8195	0.8945	7	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B44:03	ADTSGQPGW	0.8133	0.9783	7	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B13:02	GQPGWEERI	0.8009	0.9514	11	20
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B44:05	ADTSGQPGW	0.7104	0.9465	7	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B58:01	AADTSGQPGW	0.978	0.9876	6	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B58:02	AADTSGQPGW	0.9707	0.9888	6	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B35:03	QPGWEERIHL	0.5042	0.9466	12	22
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B82:01	QPGWEERIHL	0.4758	0.5017	12	22
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B57:01	QAADTSGQPGW	0.9997	0.9831	5	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-A68:24	DTSGQPGWEER	0.9994	0.8618	8	19
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-A68:03	DTSGQPGWEER	0.9993	0.8545	8	19
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B58:02	QAADTSGQPGW	0.9988	0.9903	5	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B58:01	QAADTSGQPGW	0.9979	0.984	5	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-A68:05	DTSGQPGWEER	0.9979	0.8583	8	19
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B48:01	GQPGWEERIHL	0.9956	0.6752	11	22
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B57:03	QAADTSGQPGW	0.9902	0.9976	5	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B44:08	ADTSGQPGW	0.8415	0.9471	7	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B44:04	ADTSGQPGW	0.8291	0.835	7	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B42:02	QPGWEERIHL	0.699	0.8176	12	22
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B42:01	QPGWEERIHL	0.6552	0.8109	12	22
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B39:10	QPGWEERIHL	0.4084	0.9197	12	22
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-A68:01	DTSGQPGWEER	0.9994	0.8618	8	19
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B44:06	QAADTSGQPGW	0.9848	0.6119	5	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B44:22	ADTSGQPGW	0.8195	0.8945	7	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B44:07	ADTSGQPGW	0.8133	0.9783	7	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B44:26	ADTSGQPGW	0.8133	0.9783	7	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B44:13	ADTSGQPGW	0.8133	0.9783	7	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B44:21	ADTSGQPGW	0.64	0.7969	7	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B57:04	AADTSGQPGW	0.9931	0.9164	6	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B57:02	AADTSGQPGW	0.9349	0.9855	6	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B82:02	QPGWEERIHL	0.4758	0.5017	12	22
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B67:01	QPGWEERIHL	0.3582	0.885	12	22
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B57:10	QAADTSGQPGW	0.9997	0.9831	5	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B57:04	QAADTSGQPGW	0.9994	0.9093	5	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B57:02	QAADTSGQPGW	0.9957	0.9865	5	16
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	HLA-B40:21	GQPGWEERIHL	0.9457	0.625	11	22
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-A66:01	DTSGQGESR	0.9949	0.6353	9	18
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-A68:24	DTSGQGESR	0.9873	0.599	9	18
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-A68:03	DTSGQGESR	0.9865	0.5878	9	18
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-A26:03	DTSGQGESR	0.9857	0.6628	9	18
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-A68:06	DTSGQGESR	0.9236	0.5647	9	18
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-A68:05	DTSGQGESR	0.9176	0.5921	9	18
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-A31:02	GQGESRILR	0.8723	0.667	12	21
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-A31:06	GQGESRILR	0.8239	0.5138	12	21
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-A34:01	DTSGQGESR	0.7297	0.62	9	18
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-A34:05	DTSGQGESR	0.7297	0.62	9	18
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-A68:08	DTSGQGESR	0.6666	0.7091	9	18
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-A66:03	DTSGQGESR	0.4781	0.7009	9	18
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-B13:02	GQGESRILRV	0.7969	0.9564	12	22
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-A68:01	DTSGQGESR	0.9873	0.599	9	18
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	HLA-A66:02	DTSGQGESR	0.5204	0.6828	9	18

Top

Potential FusionNeoAntigen Information of ZNF532-NEDD4L in HLA II

ZNF532-NEDD4L_56585954_56018223.msa
ZNF532-NEDD4L_56587865_55833020.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	DRB1-0401	ATHFQQAADTSGQPG	0	15
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	DRB1-0407	ATHFQQAADTSGQPG	0	15
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	DRB1-0419	ATHFQQAADTSGQPG	0	15
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	DRB1-0431	ATHFQQAADTSGQPG	0	15
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	DRB1-0433	ATHFQQAADTSGQPG	0	15
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	DRB1-0438	ATHFQQAADTSGQPG	0	15
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	DRB1-0461	ATHFQQAADTSGQPG	0	15
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	DRB1-0463	ATHFQQAADTSGQPG	0	15
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	DRB1-0464	ATHFQQAADTSGQPG	0	15
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	DRB1-0474	ATHFQQAADTSGQPG	0	15
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	DRB1-0475	ATHFQQAADTSGQPG	0	15
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	2670	DRB1-0476	ATHFQQAADTSGQPG	0	15
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	DRB1-0401	ATHFQQAADTSGQGE	1	16
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	DRB1-0407	ATHFQQAADTSGQGE	1	16
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	DRB1-0407	LATHFQQAADTSGQG	0	15
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	DRB1-0419	ATHFQQAADTSGQGE	1	16
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	DRB1-0431	ATHFQQAADTSGQGE	1	16
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	DRB1-0433	ATHFQQAADTSGQGE	1	16
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	DRB1-0438	ATHFQQAADTSGQGE	1	16
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	DRB1-0461	ATHFQQAADTSGQGE	1	16
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	DRB1-0463	ATHFQQAADTSGQGE	1	16
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	DRB1-0464	ATHFQQAADTSGQGE	1	16
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	DRB1-0474	ATHFQQAADTSGQGE	1	16
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	DRB1-0475	ATHFQQAADTSGQGE	1	16
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	3122	DRB1-0476	ATHFQQAADTSGQGE	1	16

Top

Fusion breakpoint peptide structures of ZNF532-NEDD4L

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
23	AADTSGQPGWEERI	ZNF532	NEDD4L	chr18	56585954	chr18	56018223	2670

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7123	QAADTSGQGESRIL	ZNF532	NEDD4L	chr18	56587865	chr18	55833020	3122

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ZNF532-NEDD4L

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	23	AADTSGQPGWEERI	-7.17232	-7.28572
HLA-B14:02	3BVN	23	AADTSGQPGWEERI	-4.95948	-5.99478
HLA-B52:01	3W39	23	AADTSGQPGWEERI	-6.80683	-6.92023
HLA-B52:01	3W39	23	AADTSGQPGWEERI	-3.90062	-4.93592
HLA-A11:01	4UQ2	23	AADTSGQPGWEERI	10001	10000
HLA-A24:02	5HGA	23	AADTSGQPGWEERI	-8.77961	-8.89301
HLA-A24:02	5HGA	23	AADTSGQPGWEERI	-5.66496	-6.70026
HLA-B44:05	3DX8	23	AADTSGQPGWEERI	-5.65551	-5.76891
HLA-B44:05	3DX8	23	AADTSGQPGWEERI	-3.88952	-4.92482
HLA-A02:01	6TDR	23	AADTSGQPGWEERI	-4.65662	-5.69192
HLA-B14:02	3BVN	7123	QAADTSGQGESRIL	-7.9962	-8.1096
HLA-B14:02	3BVN	7123	QAADTSGQGESRIL	-5.70842	-6.74372
HLA-B52:01	3W39	7123	QAADTSGQGESRIL	-6.83737	-6.95077
HLA-B52:01	3W39	7123	QAADTSGQGESRIL	-4.4836	-5.5189
HLA-A11:01	4UQ2	7123	QAADTSGQGESRIL	-10.0067	-10.1201
HLA-A11:01	4UQ2	7123	QAADTSGQGESRIL	-9.03915	-10.0745
HLA-A24:02	5HGA	7123	QAADTSGQGESRIL	-6.56204	-6.67544
HLA-A24:02	5HGA	7123	QAADTSGQGESRIL	-5.42271	-6.45801
HLA-B44:05	3DX8	7123	QAADTSGQGESRIL	-7.85648	-8.89178
HLA-B44:05	3DX8	7123	QAADTSGQGESRIL	-5.3978	-5.5112
HLA-A02:01	6TDR	7123	QAADTSGQGESRIL	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ZNF532-NEDD4L

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	11	20	GQPGWEERI	GGACAACCTGGCTGGGAAGAAAGAATT
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	11	22	GQPGWEERIHL	GGACAACCTGGCTGGGAAGAAAGAATTCACTTG
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	12	22	QPGWEERIHL	CAACCTGGCTGGGAAGAAAGAATTCACTTG
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	5	16	QAADTSGQPGW	CAGGCTGCAGATACGAGTGGACAACCTGGCTGG
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	6	16	AADTSGQPGW	GCTGCAGATACGAGTGGACAACCTGGCTGG
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	7	16	ADTSGQPGW	GCAGATACGAGTGGACAACCTGGCTGG
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	8	19	DTSGQPGWEER	GATACGAGTGGACAACCTGGCTGGGAAGAAAGA
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	12	21	GQGESRILR	CAAGGAGAGTCCCGTATTCTCAGAGTA
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	12	22	GQGESRILRV	CAAGGAGAGTCCCGTATTCTCAGAGTAAAA
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	9	18	DTSGQGESR	ACGAGTGGACAAGGAGAGTCCCGTATT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ZNF532-NEDD4L	chr18	56585954	chr18	56018223	0	15	ATHFQQAADTSGQPG	GCTACACATTTCCAGCAGGCTGCAGATACGAGTGGACAACCTGGC
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	0	15	LATHFQQAADTSGQG	GCTACACATTTCCAGCAGGCTGCAGATACGAGTGGACAAGGAGAG
ZNF532-NEDD4L	chr18	56587865	chr18	55833020	1	16	ATHFQQAADTSGQGE	ACACATTTCCAGCAGGCTGCAGATACGAGTGGACAAGGAGAGTCC

Top

Information of the samples that have these potential fusion neoantigens of ZNF532-NEDD4L

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
PRAD	ZNF532-NEDD4L	chr18	56587865	ENST00000336078	chr18	55833020	ENST00000356462	TCGA-KK-A8ID-01A
UCEC	ZNF532-NEDD4L	chr18	56585954	ENST00000336078	chr18	56018223	ENST00000356462	TCGA-AJ-A3BF-01A

Top

Potential target of CAR-T therapy development for ZNF532-NEDD4L

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ZNF532-NEDD4L

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ZNF532-NEDD4L

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)