Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ZNF696-MED16

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ZNF696-MED16
	FusionPDB ID: 102731
	FusionGDB2.0 ID: 102731
		Hgene	Tgene
	Gene symbol	ZNF696	MED16
	Gene ID	79943	10025
	Gene name	zinc finger protein 696	mediator complex subunit 16
	Synonyms	-	DRIP92\|THRAP5\|TRAP95
	Cytomap	8q24.3	19p13.3
	Type of gene	protein-coding	protein-coding
	Description	zinc finger protein 696	mediator of RNA polymerase II transcription subunit 16thyroid hormone receptor-associated protein 5thyroid hormone receptor-associated protein complex 95 kDa componentthyroid hormone receptor-associated protein, 95-kD subunitvitamin D3 receptor-intera
	Modification date	20200313	20200313
	UniProtAcc	.	Q9Y2X0 Main function of 5'-partner protein: FUNCTION: Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. {ECO:0000269\|PubMed:10198638, ECO:0000269\|PubMed:10235266}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000330143, ENST00000520333, ENST00000521537,	ENST00000606828, ENST00000269814, ENST00000312090, ENST00000325464, ENST00000395808, ENST00000589119,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	3 X 2 X 2=12	8 X 8 X 6=384
	# samples	3	9
	** MAII score	log2(3/12*10)=1.32192809488736 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(9/384*10)=-2.09310940439148 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ZNF696 [Title/Abstract] AND MED16 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ZNF696 [Title/Abstract] AND MED16 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ZNF696(144375235)-MED16(880148), # samples:2
Anticipated loss of major functional domain due to fusion event.	ZNF696-MED16 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF696-MED16 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF696-MED16 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. ZNF696-MED16 seems lost the major protein functional domain in Hgene partner, which is a transcription factor due to the frame-shifted ORF. ZNF696-MED16 seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF. ZNF696-MED16 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	MED16	GO:0006367	transcription initiation from RNA polymerase II promoter	12218053
Tgene	MED16	GO:0045893	positive regulation of transcription, DNA-templated	10198638

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:144375235/chr19:880148)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ZNF696 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MED16 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000330143	ZNF696	chr8	144375235	+	ENST00000395808	MED16	chr19	880148	-	2269	473	373	1857	494
ENST00000330143	ZNF696	chr8	144375235	+	ENST00000589119	MED16	chr19	880148	-	2104	473	373	1965	530
ENST00000330143	ZNF696	chr8	144375235	+	ENST00000312090	MED16	chr19	880148	-	2325	473	373	1914	513
ENST00000330143	ZNF696	chr8	144375235	+	ENST00000269814	MED16	chr19	880148	-	2074	473	373	1587	404
ENST00000330143	ZNF696	chr8	144375235	+	ENST00000325464	MED16	chr19	880148	-	2103	473	373	1965	530
ENST00000520333	ZNF696	chr8	144375235	+	ENST00000395808	MED16	chr19	880148	-	2236	440	340	1824	494
ENST00000520333	ZNF696	chr8	144375235	+	ENST00000589119	MED16	chr19	880148	-	2071	440	340	1932	530
ENST00000520333	ZNF696	chr8	144375235	+	ENST00000312090	MED16	chr19	880148	-	2292	440	340	1881	513
ENST00000520333	ZNF696	chr8	144375235	+	ENST00000269814	MED16	chr19	880148	-	2041	440	340	1554	404
ENST00000520333	ZNF696	chr8	144375235	+	ENST00000325464	MED16	chr19	880148	-	2070	440	340	1932	530

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000330143	ENST00000395808	ZNF696	chr8	144375235	+	MED16	chr19	880148	-	0.12207676	0.8779233
ENST00000330143	ENST00000589119	ZNF696	chr8	144375235	+	MED16	chr19	880148	-	0.10709551	0.89290446
ENST00000330143	ENST00000312090	ZNF696	chr8	144375235	+	MED16	chr19	880148	-	0.1280149	0.8719851
ENST00000330143	ENST00000269814	ZNF696	chr8	144375235	+	MED16	chr19	880148	-	0.229246	0.77075404
ENST00000330143	ENST00000325464	ZNF696	chr8	144375235	+	MED16	chr19	880148	-	0.10731573	0.8926843
ENST00000520333	ENST00000395808	ZNF696	chr8	144375235	+	MED16	chr19	880148	-	0.12346945	0.8765306
ENST00000520333	ENST00000589119	ZNF696	chr8	144375235	+	MED16	chr19	880148	-	0.10923962	0.8907603
ENST00000520333	ENST00000312090	ZNF696	chr8	144375235	+	MED16	chr19	880148	-	0.1298036	0.8701964
ENST00000520333	ENST00000269814	ZNF696	chr8	144375235	+	MED16	chr19	880148	-	0.23140284	0.7685972
ENST00000520333	ENST00000325464	ZNF696	chr8	144375235	+	MED16	chr19	880148	-	0.10945579	0.89054424

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ZNF696-MED16

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ZNF696	chr8	144375235	MED16	chr19	880148	440	33	GAKESSTLMESLAGLALAFHDGSVHI
ZNF696	chr8	144375235	MED16	chr19	880148	473	33	GAKESSTLMESLAGLALAFHDGSVHI

Top

Potential FusionNeoAntigen Information of ZNF696-MED16 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ZNF696-MED16_144375235_880148.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:01	SLAGLALAF	0.9983	0.9738	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:27	TLMESLAGL	0.9928	0.5595	6	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:13	TLMESLAGL	0.9921	0.6637	6	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:38	TLMESLAGL	0.9884	0.5409	6	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:25	SLAGLALAF	0.9855	0.9818	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:04	TLMESLAGL	0.9836	0.6006	6	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:02	SLAGLALAF	0.9812	0.9863	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B47:01	MESLAGLAL	0.9797	0.5582	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:17	TLMESLAGL	0.978	0.5134	6	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B18:01	MESLAGLAL	0.9339	0.7729	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B46:01	SLAGLALAF	0.9165	0.7632	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A32:13	SLAGLALAF	0.9129	0.9928	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:03	SLAGLALAF	0.8518	0.9446	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B39:13	MESLAGLAL	0.7738	0.9481	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:10	MESLAGLAL	0.7642	0.5523	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B39:01	MESLAGLAL	0.7627	0.9458	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B38:02	MESLAGLAL	0.732	0.9742	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:37	MESLAGLAL	0.6269	0.5478	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B41:01	MESLAGLAL	0.5936	0.9144	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B50:01	MESLAGLAL	0.5256	0.8739	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B13:01	SLAGLALAF	0.0838	0.9922	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A26:02	ESLAGLALAF	0.9891	0.627	9	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B45:01	MESLAGLALA	0.9846	0.9777	8	18
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B50:02	MESLAGLALA	0.9719	0.9133	8	18
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:38	STLMESLAGL	0.9525	0.7349	5	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:04	STLMESLAGL	0.9508	0.5739	5	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:13	STLMESLAGL	0.9431	0.7259	5	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:27	STLMESLAGL	0.941	0.6107	5	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B50:01	MESLAGLALA	0.855	0.9058	8	18
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:19	STLMESLAGL	0.8306	0.5082	5	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:27	TLMESLAGLAL	0.9976	0.5531	6	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:38	TLMESLAGLAL	0.9969	0.5484	6	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B18:01	MESLAGLALAF	0.9956	0.8133	8	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:04	TLMESLAGLAL	0.9939	0.6463	6	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:17	TLMESLAGLAL	0.9924	0.607	6	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:38	SSTLMESLAGL	0.8128	0.6623	4	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:13	SSTLMESLAGL	0.757	0.7098	4	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:27	SSTLMESLAGL	0.7311	0.5667	4	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:20	SSTLMESLAGL	0.7043	0.5206	4	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:35	SSTLMESLAGL	0.6919	0.5481	4	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:04	SSTLMESLAGL	0.6708	0.5812	4	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:29	SSTLMESLAGL	0.6603	0.5106	4	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:60	SSTLMESLAGL	0.6559	0.5049	4	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:67	SSTLMESLAGL	0.6525	0.5092	4	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:30	SSTLMESLAGL	0.6525	0.5092	4	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:24	SSTLMESLAGL	0.6525	0.5092	4	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:11	SSTLMESLAGL	0.6497	0.5419	4	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:19	SSTLMESLAGL	0.5481	0.5526	4	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B40:06	MESLAGLAL	0.9991	0.6813	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:07	SLAGLALAF	0.9949	0.9161	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B44:10	MESLAGLAL	0.9945	0.572	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:21	SLAGLALAF	0.983	0.965	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:04	SLAGLALAF	0.939	0.9836	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:31	SLAGLALAF	0.8821	0.9487	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:05	SLAGLALAF	0.8751	0.9425	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B39:08	MESLAGLAL	0.8334	0.8857	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B39:09	MESLAGLAL	0.7822	0.7568	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B39:05	MESLAGLAL	0.7448	0.9288	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:01	SSTLMESLAGL	0.6525	0.5092	4	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B40:04	MESLAGLAL	0.9992	0.7761	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:34	SLAGLALAF	0.9983	0.9738	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:125	SLAGLALAF	0.9983	0.9738	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:27	SLAGLALAF	0.9983	0.9814	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:33	SLAGLALAF	0.9983	0.9738	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:11	SLAGLALAF	0.998	0.9659	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:135	SLAGLALAF	0.998	0.9755	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:08	SLAGLALAF	0.9978	0.9631	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:50	SLAGLALAF	0.9973	0.9856	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:24	SLAGLALAF	0.9971	0.9903	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:35	SLAGLALAF	0.9965	0.9788	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:12	SLAGLALAF	0.9949	0.986	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:03	TLMESLAGL	0.9942	0.5263	6	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:39	SLAGLALAF	0.9839	0.9635	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A32:01	SLAGLALAF	0.9647	0.9921	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B18:04	MESLAGLAL	0.9613	0.7869	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:13	SLAGLALAF	0.9522	0.9631	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B18:07	MESLAGLAL	0.9517	0.7072	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B18:05	MESLAGLAL	0.9339	0.7729	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B18:08	MESLAGLAL	0.9247	0.7428	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B18:03	MESLAGLAL	0.9204	0.7529	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:73	SLAGLALAF	0.912	0.9864	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B18:06	MESLAGLAL	0.9072	0.7924	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:20	SLAGLALAF	0.8881	0.9675	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B35:20	SLAGLALAF	0.8559	0.9746	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:73	TLMESLAGL	0.8519	0.9522	6	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B35:28	SLAGLALAF	0.8433	0.972	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B39:11	MESLAGLAL	0.8331	0.8804	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B18:11	MESLAGLAL	0.8312	0.8493	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:30	SLAGLALAF	0.8186	0.9817	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:30	TLMESLAGL	0.7781	0.958	6	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B39:02	MESLAGLAL	0.7728	0.9506	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B39:31	MESLAGLAL	0.7725	0.9456	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B41:03	MESLAGLAL	0.755	0.6401	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A69:01	TLMESLAGL	0.7395	0.5425	6	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B48:02	MESLAGLAL	0.5852	0.8878	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B15:09	MESLAGLAL	0.5512	0.8049	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B50:04	MESLAGLAL	0.5256	0.8739	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B50:05	MESLAGLAL	0.5256	0.8739	8	17
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B40:21	SLAGLALAF	0.0688	0.7323	10	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A25:01	ESLAGLALAF	0.9833	0.9534	9	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A02:03	STLMESLAGL	0.971	0.6302	5	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A69:01	STLMESLAGL	0.8747	0.6722	5	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-A68:02	STLMESLAGL	0.8633	0.6049	5	15
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B50:04	MESLAGLALA	0.855	0.9058	8	18
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B50:05	MESLAGLALA	0.855	0.9058	8	18
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B18:11	MESLAGLALAF	0.9984	0.8616	8	19
ZNF696-MED16	chr8	144375235	chr19	880148	473	HLA-B18:05	MESLAGLALAF	0.9956	0.8133	8	19

Top

Potential FusionNeoAntigen Information of ZNF696-MED16 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ZNF696-MED16

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9481	TLMESLAGLALAFH	ZNF696	MED16	chr8	144375235	chr19	880148	473

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ZNF696-MED16

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9481	TLMESLAGLALAFH	-7.15543	-7.26883
HLA-B14:02	3BVN	9481	TLMESLAGLALAFH	-4.77435	-5.80965
HLA-B52:01	3W39	9481	TLMESLAGLALAFH	-6.80875	-6.92215
HLA-B52:01	3W39	9481	TLMESLAGLALAFH	-4.20386	-5.23916
HLA-A11:01	4UQ2	9481	TLMESLAGLALAFH	-7.5194	-8.5547
HLA-A11:01	4UQ2	9481	TLMESLAGLALAFH	-6.9601	-7.0735
HLA-A24:02	5HGA	9481	TLMESLAGLALAFH	-7.52403	-7.63743
HLA-A24:02	5HGA	9481	TLMESLAGLALAFH	-5.82433	-6.85963
HLA-B27:05	6PYJ	9481	TLMESLAGLALAFH	-3.28285	-4.31815
HLA-B44:05	3DX8	9481	TLMESLAGLALAFH	-5.91172	-6.94702
HLA-B44:05	3DX8	9481	TLMESLAGLALAFH	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of ZNF696-MED16

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ZNF696-MED16	chr8	144375235	chr19	880148	10	19	SLAGLALAF	CCCTTGCAGGGCTGGCCCTGGCCTTCC
ZNF696-MED16	chr8	144375235	chr19	880148	4	15	SSTLMESLAGL	GCAGTACCCTGATGGAGTCCCTTGCAGGGCTGG
ZNF696-MED16	chr8	144375235	chr19	880148	5	15	STLMESLAGL	GTACCCTGATGGAGTCCCTTGCAGGGCTGG
ZNF696-MED16	chr8	144375235	chr19	880148	6	15	TLMESLAGL	CCCTGATGGAGTCCCTTGCAGGGCTGG
ZNF696-MED16	chr8	144375235	chr19	880148	6	17	TLMESLAGLAL	CCCTGATGGAGTCCCTTGCAGGGCTGGCCCTGG
ZNF696-MED16	chr8	144375235	chr19	880148	8	17	MESLAGLAL	TGGAGTCCCTTGCAGGGCTGGCCCTGG
ZNF696-MED16	chr8	144375235	chr19	880148	8	18	MESLAGLALA	TGGAGTCCCTTGCAGGGCTGGCCCTGGCCT
ZNF696-MED16	chr8	144375235	chr19	880148	8	19	MESLAGLALAF	TGGAGTCCCTTGCAGGGCTGGCCCTGGCCTTCC
ZNF696-MED16	chr8	144375235	chr19	880148	9	19	ESLAGLALAF	AGTCCCTTGCAGGGCTGGCCCTGGCCTTCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ZNF696-MED16

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
ESCA	ZNF696-MED16	chr8	144375235	ENST00000330143	chr19	880148	ENST00000269814	TCGA-L5-A8NH

Top

Potential target of CAR-T therapy development for ZNF696-MED16

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ZNF696-MED16

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ZNF696-MED16

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)