![]() |
|||||||
|
Fusion Protein:BRWD1-GNAI3 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: BRWD1-GNAI3 | FusionPDB ID: 10346 | FusionGDB2.0 ID: 10346 | Hgene | Tgene | Gene symbol | BRWD1 | GNAI3 | Gene ID | 54014 | 2773 |
Gene name | bromodomain and WD repeat domain containing 1 | G protein subunit alpha i3 | |
Synonyms | C21orf107|DCAF19|N143|WDR9|WRD9 | 87U6|ARCND1 | |
Cytomap | 21q22.2 | 1p13.3 | |
Type of gene | protein-coding | protein-coding | |
Description | bromodomain and WD repeat-containing protein 1WD repeat protein WDR9-form2WD repeat-containing protein 9transcriptional unit N143 | guanine nucleotide-binding protein G(i) subunit alphag(i) alpha-3guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3guanine nucleotide-binding protein G(k) subunit alpha | |
Modification date | 20200313 | 20200322 | |
UniProtAcc | Q9NSI6 Main function of 5'-partner protein: FUNCTION: May be a transcriptional activator. May be involved in chromatin remodeling (By similarity). Plays a role in the regulation of cell morphology and cytoskeletal organization. Required in the control of cell shape. {ECO:0000250, ECO:0000269|PubMed:21834987}. | P08754 Main function of 5'-partner protein: FUNCTION: Heterotrimeric guanine nucleotide-binding proteins (G proteins) function as transducers downstream of G protein-coupled receptors (GPCRs) in numerous signaling cascades. The alpha chain contains the guanine nucleotide binding site and alternates between an active, GTP-bound state and an inactive, GDP-bound state. Signaling by an activated GPCR promotes GDP release and GTP binding. The alpha subunit has a low GTPase activity that converts bound GTP to GDP, thereby terminating the signal. Both GDP release and GTP hydrolysis are modulated by numerous regulatory proteins (PubMed:8774883, PubMed:18434541, PubMed:19478087). Signaling is mediated via effector proteins, such as adenylate cyclase. Inhibits adenylate cyclase activity, leading to decreased intracellular cAMP levels (PubMed:19478087). Stimulates the activity of receptor-regulated K(+) channels (PubMed:2535845). The active GTP-bound form prevents the association of RGS14 with centrosomes and is required for the translocation of RGS14 from the cytoplasm to the plasma membrane. May play a role in cell division (PubMed:17635935). {ECO:0000269|PubMed:17635935, ECO:0000269|PubMed:18434541, ECO:0000269|PubMed:2535845, ECO:0000269|PubMed:8774883}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000333229, ENST00000342449, ENST00000380800, ENST00000341322, ENST00000470108, | ENST00000369851, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 28 X 28 X 10=7840 | 33 X 8 X 14=3696 |
# samples | 32 | 35 | |
** MAII score | log2(32/7840*10)=-4.61470984411521 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(35/3696*10)=-3.40053792958373 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: BRWD1 [Title/Abstract] AND GNAI3 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: BRWD1 [Title/Abstract] AND GNAI3 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | BRWD1(40670357)-GNAI3(110116358), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | BRWD1-GNAI3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BRWD1-GNAI3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BRWD1-GNAI3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. BRWD1-GNAI3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | GNAI3 | GO:0007193 | adenylate cyclase-inhibiting G protein-coupled receptor signaling pathway | 19478087 |
Tgene | GNAI3 | GO:0007212 | dopamine receptor signaling pathway | 19478087 |
Tgene | GNAI3 | GO:0046039 | GTP metabolic process | 19478087 |
Tgene | GNAI3 | GO:0051301 | cell division | 17635935 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr21:40670357/chr1:110116358) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000333229 | BRWD1 | chr21 | 40670357 | - | ENST00000369851 | GNAI3 | chr1 | 110116358 | + | 3655 | 677 | 235 | 1623 | 462 |
ENST00000342449 | BRWD1 | chr21 | 40670357 | - | ENST00000369851 | GNAI3 | chr1 | 110116358 | + | 3406 | 428 | 79 | 1374 | 431 |
ENST00000380800 | BRWD1 | chr21 | 40670357 | - | ENST00000369851 | GNAI3 | chr1 | 110116358 | + | 3426 | 448 | 6 | 1394 | 462 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000333229 | ENST00000369851 | BRWD1 | chr21 | 40670357 | - | GNAI3 | chr1 | 110116358 | + | 0.000203461 | 0.99979657 |
ENST00000342449 | ENST00000369851 | BRWD1 | chr21 | 40670357 | - | GNAI3 | chr1 | 110116358 | + | 0.000186399 | 0.9998136 |
ENST00000380800 | ENST00000369851 | BRWD1 | chr21 | 40670357 | - | GNAI3 | chr1 | 110116358 | + | 0.000184975 | 0.99981505 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for BRWD1-GNAI3 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
BRWD1 | chr21 | 40670357 | GNAI3 | chr1 | 110116358 | 428 | 116 | LGAGRQSLLRTAKGAGESGKSTIVKQ |
BRWD1 | chr21 | 40670357 | GNAI3 | chr1 | 110116358 | 448 | 147 | LGAGRQSLLRTAKGAGESGKSTIVKQ |
BRWD1 | chr21 | 40670357 | GNAI3 | chr1 | 110116358 | 677 | 147 | LGAGRQSLLRTAKGAGESGKSTIVKQ |
Top |
Potential FusionNeoAntigen Information of BRWD1-GNAI3 in HLA I |
![]() |
BRWD1-GNAI3_40670357_110116358.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | HLA-A11:03 | RTAKGAGESGK | 0.9989 | 0.5059 | 9 | 20 |
Top |
Potential FusionNeoAntigen Information of BRWD1-GNAI3 in HLA II |
![]() |
BRWD1-GNAI3_40670357_110116358.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-0804 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-0804 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-0820 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-0820 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-0828 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-0831 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-0831 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1104 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1104 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1106 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1106 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1125 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1135 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1135 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1137 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1138 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1138 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1141 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1142 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1143 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1143 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1144 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1144 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1146 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1146 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1147 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1147 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1150 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1150 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1154 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1154 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1154 | AGRQSLLRTAKGAGE | 2 | 17 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1156 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1156 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1158 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1158 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1160 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1160 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1167 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1177 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1177 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1178 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1178 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1183 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1183 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1184 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1184 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1188 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1188 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1189 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1193 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1307 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1311 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1311 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1318 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1342 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1342 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1347 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1415 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1415 | GRQSLLRTAKGAGES | 3 | 18 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1473 | RQSLLRTAKGAGESG | 4 | 19 |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 | DRB1-1484 | RQSLLRTAKGAGESG | 4 | 19 |
Top |
Fusion breakpoint peptide structures of BRWD1-GNAI3 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
8762 | SLLRTAKGAGESGK | BRWD1 | GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 677 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of BRWD1-GNAI3 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 8762 | SLLRTAKGAGESGK | -4.62424 | -5.65954 |
HLA-B14:02 | 3BVN | 8762 | SLLRTAKGAGESGK | -4.1114 | -4.2248 |
HLA-B52:01 | 3W39 | 8762 | SLLRTAKGAGESGK | -6.8001 | -6.9135 |
HLA-B52:01 | 3W39 | 8762 | SLLRTAKGAGESGK | -6.46104 | -7.49634 |
HLA-A24:02 | 5HGA | 8762 | SLLRTAKGAGESGK | -9.1447 | -9.2581 |
HLA-A24:02 | 5HGA | 8762 | SLLRTAKGAGESGK | -6.01279 | -7.04809 |
HLA-B44:05 | 3DX8 | 8762 | SLLRTAKGAGESGK | -5.02862 | -5.14202 |
HLA-B44:05 | 3DX8 | 8762 | SLLRTAKGAGESGK | -4.60714 | -5.64244 |
Top |
Vaccine Design for the FusionNeoAntigens of BRWD1-GNAI3 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 9 | 20 | RTAKGAGESGK | GTACAGCAAAAGGTGCTGGAGAATCTGGTAAAA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 2 | 17 | AGRQSLLRTAKGAGE | CAGGAAGGCAGTCTTTGCTACGTACAGCAAAAGGTGCTGGAGAAT |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 3 | 18 | GRQSLLRTAKGAGES | GAAGGCAGTCTTTGCTACGTACAGCAAAAGGTGCTGGAGAATCTG |
BRWD1-GNAI3 | chr21 | 40670357 | chr1 | 110116358 | 4 | 19 | RQSLLRTAKGAGESG | GGCAGTCTTTGCTACGTACAGCAAAAGGTGCTGGAGAATCTGGTA |
Top |
Information of the samples that have these potential fusion neoantigens of BRWD1-GNAI3 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | BRWD1-GNAI3 | chr21 | 40670357 | ENST00000333229 | chr1 | 110116358 | ENST00000369851 | TCGA-D8-A1XT |
Top |
Potential target of CAR-T therapy development for BRWD1-GNAI3 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to BRWD1-GNAI3 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to BRWD1-GNAI3 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |