Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:BSG-NFIX

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: BSG-NFIX
	FusionPDB ID: 10392
	FusionGDB2.0 ID: 10392
		Hgene	Tgene
	Gene symbol	BSG	NFIX
	Gene ID	682	4784
	Gene name	basigin (Ok blood group)	nuclear factor I X
	Synonyms	5F7\|CD147\|EMMPRIN\|EMPRIN\|OK\|SLC7A11\|TCSF	CTF\|MRSHSS\|NF-I/X\|NF1-X\|NF1A\|SOTOS2
	Cytomap	19p13.3	19p13.13
	Type of gene	protein-coding	protein-coding
	Description	basiginOK blood group antigencollagenase stimulatory factorextracellular matrix metalloproteinase inducerleukocyte activation antigen M6tumor cell-derived collagenase stimulatory factor	nuclear factor 1 X-typeCCAAT-box-binding transcription factorTGGCA-binding proteinnuclear factor 1/X
	Modification date	20200315	20200329
	UniProtAcc	P35613 Main function of 5'-partner protein: FUNCTION: [Isoform 1]: Essential for normal retinal maturation and development (By similarity). Acts as a retinal cell surface receptor for NXNL1 and plays an important role in NXNL1-mediated survival of retinal cone photoreceptors (PubMed:25957687). In association with glucose transporter SLC16A1/GLUT1 and NXNL1, promotes retinal cone survival by enhancing aerobic glycolysis and accelerating the entry of glucose into photoreceptors (PubMed:25957687). May act as a potent stimulator of IL6 secretion in multiple cell lines that include monocytes (PubMed:21620857). {ECO:0000250\|UniProtKB:P18572, ECO:0000269\|PubMed:21620857, ECO:0000269\|PubMed:25957687}.; FUNCTION: [Isoform 2]: Signaling receptor for cyclophilins, essential for PPIA/CYPA and PPIB/CYPB-dependent signaling related to chemotaxis and adhesion of immune cells (PubMed:11943775, PubMed:11688976). Plays an important role in targeting monocarboxylate transporters SLC16A1/GLUT1, SLC16A11 and SLC16A12 to the plasma membrane (PubMed:17127621, PubMed:21778275, PubMed:28666119). Acts as a coreceptor for vascular endothelial growth factor receptor 2 (KDR/VEGFR2) in endothelial cells enhancing its VEGFA-mediated activation and downstream signaling (PubMed:25825981). Promotes angiogenesis through EPAS1/HIF2A-mediated up-regulation of VEGFA (isoform VEGF-165 and VEGF-121) and KDR/VEGFR2 in endothelial cells (PubMed:19837976). Plays a key role in regulating tumor growth, invasion, metastasis and neoangiogenesis by stimulating the production and release of extracellular matrix metalloproteinases and KDR/VEGFR2 by both tumor cells and stromal cells (fibroblasts and endothelial cells) (PubMed:12553375, PubMed:11992541, PubMed:15833850). {ECO:0000269\|PubMed:11688976, ECO:0000269\|PubMed:11943775, ECO:0000269\|PubMed:11992541, ECO:0000269\|PubMed:12553375, ECO:0000269\|PubMed:15833850, ECO:0000269\|PubMed:17127621, ECO:0000269\|PubMed:19837976, ECO:0000269\|PubMed:21778275, ECO:0000269\|PubMed:25825981, ECO:0000269\|PubMed:28666119}.; FUNCTION: [Isoform 1]: (Microbial infection) Erythrocyte receptor for P.falciparum RH5 which is essential for erythrocyte invasion by the merozoite stage of P.falciparum isolates 3D7 and Dd2. {ECO:0000269\|PubMed:22080952}.; FUNCTION: [Isoform 2]: (Microbial infection) Erythrocyte receptor for P.falciparum RH5 which is essential for erythrocyte invasion by the merozoite stage of P.falciparum isolates 3D7, Dd2, 7G8 and HB3 (PubMed:22080952, PubMed:26195724). Binding of P.falciparum RH5 results in BSG dimerization which triggers an increase in intracellular Ca(2+) in the erythrocyte (PubMed:28409866). This essential step leads to a rearrangement of the erythrocyte cytoskeleton required for the merozoite invasion (PubMed:28409866). {ECO:0000269\|PubMed:22080952, ECO:0000269\|PubMed:26195724, ECO:0000269\|PubMed:28409866}.; FUNCTION: [Isoform 2]: (Microbial infection) Can facilitate human SARS coronavirus (SARS-CoV-1) infection via its interaction with virus-associated PPIA/CYPA. {ECO:0000269\|PubMed:15688292}.; FUNCTION: [Isoform 2]: (Microbial infection) Can facilitate HIV-1 infection via its interaction with virus-associated PPIA/CYPA. {ECO:0000269\|PubMed:11353871}.; FUNCTION: [Isoform 2]: (Microbial infection) First described as a receptor for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), it is not required for SARS-CoV-2 infection. {ECO:0000269\|PubMed:33432067, ECO:0000303\|PubMed:32307653}.; FUNCTION: [Isoform 2]: (Microbial infection) Acts as a receptor for measles virus. {ECO:0000269\|PubMed:20147391}.; FUNCTION: [Isoform 2]: (Microbial infection) Promotes entry of pentamer-expressing human cytomegalovirus (HCMV) into epithelial and endothelial cells. {ECO:0000269\|PubMed:29739904}.	Q14938 Main function of 5'-partner protein: FUNCTION: Recognizes and binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3' present in viral and cellular promoters and in the origin of replication of adenovirus type 2. These proteins are individually capable of activating transcription and replication.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000333511, ENST00000346916, ENST00000353555, ENST00000545507, ENST00000574970,	ENST00000358552, ENST00000587260, ENST00000588228, ENST00000588680, ENST00000360105, ENST00000397661, ENST00000585575, ENST00000587760, ENST00000592199,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	26 X 17 X 12=5304	22 X 13 X 10=2860
	# samples	29	26
	** MAII score	log2(29/5304*10)=-4.19295597009765 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(26/2860*10)=-3.4594316186373 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: BSG [Title/Abstract] AND NFIX [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: BSG [Title/Abstract] AND NFIX [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	BSG(580787)-NFIX(13135833), # samples:1
Anticipated loss of major functional domain due to fusion event.	BSG-NFIX seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BSG-NFIX seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BSG-NFIX seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. BSG-NFIX seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	NFIX	GO:0000122	negative regulation of transcription by RNA polymerase II	19706729
Tgene	NFIX	GO:0045944	positive regulation of transcription by RNA polymerase II	19706729

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:580787/chr19:13135833)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across BSG (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NFIX (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000346916	BSG	chr19	580787	+	ENST00000397661	NFIX	chr19	13135833	+	3389	503	50	1801	583
ENST00000346916	BSG	chr19	580787	+	ENST00000592199	NFIX	chr19	13135833	+	1985	503	50	1984	645
ENST00000346916	BSG	chr19	580787	+	ENST00000587760	NFIX	chr19	13135833	+	1946	503	50	1801	583
ENST00000346916	BSG	chr19	580787	+	ENST00000585575	NFIX	chr19	13135833	+	1985	503	50	1984	645
ENST00000346916	BSG	chr19	580787	+	ENST00000360105	NFIX	chr19	13135833	+	5861	503	50	1678	542
ENST00000545507	BSG	chr19	580787	+	ENST00000397661	NFIX	chr19	13135833	+	3538	652	334	1950	538
ENST00000545507	BSG	chr19	580787	+	ENST00000592199	NFIX	chr19	13135833	+	2134	652	334	2133	600
ENST00000545507	BSG	chr19	580787	+	ENST00000587760	NFIX	chr19	13135833	+	2095	652	334	1950	538
ENST00000545507	BSG	chr19	580787	+	ENST00000585575	NFIX	chr19	13135833	+	2134	652	334	2133	600
ENST00000545507	BSG	chr19	580787	+	ENST00000360105	NFIX	chr19	13135833	+	6010	652	334	1827	497
ENST00000333511	BSG	chr19	580787	+	ENST00000397661	NFIX	chr19	13135833	+	3748	862	70	2160	696
ENST00000333511	BSG	chr19	580787	+	ENST00000592199	NFIX	chr19	13135833	+	2344	862	70	2343	758
ENST00000333511	BSG	chr19	580787	+	ENST00000587760	NFIX	chr19	13135833	+	2305	862	70	2160	696
ENST00000333511	BSG	chr19	580787	+	ENST00000585575	NFIX	chr19	13135833	+	2344	862	70	2343	758
ENST00000333511	BSG	chr19	580787	+	ENST00000360105	NFIX	chr19	13135833	+	6220	862	70	2037	655
ENST00000353555	BSG	chr19	580787	+	ENST00000397661	NFIX	chr19	13135833	+	3387	501	57	1799	580
ENST00000353555	BSG	chr19	580787	+	ENST00000592199	NFIX	chr19	13135833	+	1983	501	57	1982	641
ENST00000353555	BSG	chr19	580787	+	ENST00000587760	NFIX	chr19	13135833	+	1944	501	57	1799	580
ENST00000353555	BSG	chr19	580787	+	ENST00000585575	NFIX	chr19	13135833	+	1983	501	57	1982	641
ENST00000353555	BSG	chr19	580787	+	ENST00000360105	NFIX	chr19	13135833	+	5859	501	57	1676	539

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000346916	ENST00000397661	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.015468788	0.9845313
ENST00000346916	ENST00000592199	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.021077571	0.9789225
ENST00000346916	ENST00000587760	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.022200113	0.9777999
ENST00000346916	ENST00000585575	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.021077571	0.9789225
ENST00000346916	ENST00000360105	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.00545607	0.9945439
ENST00000545507	ENST00000397661	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.012314101	0.9876859
ENST00000545507	ENST00000592199	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.017637622	0.98236233
ENST00000545507	ENST00000587760	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.017185565	0.98281443
ENST00000545507	ENST00000585575	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.017637622	0.98236233
ENST00000545507	ENST00000360105	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.004527538	0.9954725
ENST00000333511	ENST00000397661	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.010465184	0.9895348
ENST00000333511	ENST00000592199	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.012288552	0.9877115
ENST00000333511	ENST00000587760	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.015352406	0.98464763
ENST00000333511	ENST00000585575	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.012288552	0.9877115
ENST00000333511	ENST00000360105	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.004014109	0.9959859
ENST00000353555	ENST00000397661	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.015106766	0.98489326
ENST00000353555	ENST00000592199	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.019865708	0.9801343
ENST00000353555	ENST00000587760	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.022911772	0.9770882
ENST00000353555	ENST00000585575	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.019865708	0.9801343
ENST00000353555	ENST00000360105	BSG	chr19	580787	+	NFIX	chr19	13135833	+	0.004584484	0.99541545

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for BSG-NFIX

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
BSG	chr19	580787	NFIX	chr19	13135833	501	148	DWAWYKITDSEDKDEFHPFIEALLPH
BSG	chr19	580787	NFIX	chr19	13135833	503	151	DWAWYKITDSEDKDEFHPFIEALLPH
BSG	chr19	580787	NFIX	chr19	13135833	652	106	DWAWYKITDSEDKDEFHPFIEALLPH
BSG	chr19	580787	NFIX	chr19	13135833	862	264	DWAWYKITDSEDKDEFHPFIEALLPH

Top

Potential FusionNeoAntigen Information of BSG-NFIX in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

BSG-NFIX_580787_13135833.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B45:01	SEDKDEFHP	0.9789	0.7146	9	18
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B18:01	EDKDEFHPF	0.8512	0.974	10	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B41:01	SEDKDEFHP	0.2328	0.6791	9	18
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B47:01	SEDKDEFHPF	0.9989	0.6532	9	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B44:03	SEDKDEFHPF	0.9987	0.9415	9	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B18:01	SEDKDEFHPF	0.8684	0.9714	9	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B51:07	DKDEFHPFI	0.2513	0.7363	11	20
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-C05:09	ITDSEDKDEF	0.9999	0.9431	6	16
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B39:08	SEDKDEFHPF	0.9437	0.6467	9	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B18:04	EDKDEFHPF	0.9334	0.9761	10	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B18:06	EDKDEFHPF	0.8919	0.9751	10	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B18:07	EDKDEFHPF	0.8701	0.9599	10	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B18:05	EDKDEFHPF	0.8512	0.974	10	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B18:03	EDKDEFHPF	0.8228	0.9713	10	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B18:11	EDKDEFHPF	0.8195	0.926	10	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B18:08	EDKDEFHPF	0.8178	0.9648	10	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-C05:01	ITDSEDKDEF	0.9999	0.9431	6	16
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B44:07	SEDKDEFHPF	0.9987	0.9415	9	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B44:26	SEDKDEFHPF	0.9987	0.9415	9	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B44:13	SEDKDEFHPF	0.9987	0.9415	9	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B40:04	SEDKDEFHPF	0.9939	0.691	9	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B15:53	SEDKDEFHPF	0.9856	0.9461	9	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B57:02	ITDSEDKDEF	0.9823	0.8186	6	16
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B18:11	SEDKDEFHPF	0.9795	0.9375	9	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B18:08	SEDKDEFHPF	0.8782	0.9612	9	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B18:05	SEDKDEFHPF	0.8684	0.9714	9	19
BSG-NFIX	chr19	580787	chr19	13135833	862	HLA-B18:03	SEDKDEFHPF	0.8395	0.9684	9	19

Top

Potential FusionNeoAntigen Information of BSG-NFIX in HLA II

BSG-NFIX_580787_13135833.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0405	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0405	WAWYKITDSEDKDEF	1	16
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0407	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0409	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0409	WAWYKITDSEDKDEF	1	16
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0411	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0417	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0417	WAWYKITDSEDKDEF	1	16
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0424	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0429	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0429	WAWYKITDSEDKDEF	1	16
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0430	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0430	WAWYKITDSEDKDEF	1	16
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0445	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0445	WAWYKITDSEDKDEF	1	16
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0448	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0448	WAWYKITDSEDKDEF	1	16
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0457	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0457	WAWYKITDSEDKDEF	1	16
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0462	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0477	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0477	WAWYKITDSEDKDEF	1	16
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0480	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0480	WAWYKITDSEDKDEF	1	16
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0482	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0483	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0483	WAWYKITDSEDKDEF	1	16
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0484	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0484	WAWYKITDSEDKDEF	1	16
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0486	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0487	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0487	WAWYKITDSEDKDEF	1	16
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0489	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0489	WAWYKITDSEDKDEF	1	16
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0491	DWAWYKITDSEDKDE	0	15
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-0905	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1502	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1508	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1511	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1514	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1515	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1519	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1526	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1527	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1529	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1529	EDKDEFHPFIEALLP	10	25
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1530	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1531	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1538	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1539	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1544	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1547	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1604	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1605	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1607	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1609	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB1-1610	DKDEFHPFIEALLPH	11	26
BSG-NFIX	chr19	580787	chr19	13135833	862	DRB5-0112	DWAWYKITDSEDKDE	0	15

Top

Fusion breakpoint peptide structures of BSG-NFIX

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4015	ITDSEDKDEFHPFI	BSG	NFIX	chr19	580787	chr19	13135833	862

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of BSG-NFIX

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4015	ITDSEDKDEFHPFI	-7.15543	-7.26883
HLA-B14:02	3BVN	4015	ITDSEDKDEFHPFI	-4.77435	-5.80965
HLA-B52:01	3W39	4015	ITDSEDKDEFHPFI	-6.80875	-6.92215
HLA-B52:01	3W39	4015	ITDSEDKDEFHPFI	-4.20386	-5.23916
HLA-A11:01	4UQ2	4015	ITDSEDKDEFHPFI	-7.5194	-8.5547
HLA-A11:01	4UQ2	4015	ITDSEDKDEFHPFI	-6.9601	-7.0735
HLA-A24:02	5HGA	4015	ITDSEDKDEFHPFI	-7.52403	-7.63743
HLA-A24:02	5HGA	4015	ITDSEDKDEFHPFI	-5.82433	-6.85963
HLA-B27:05	6PYJ	4015	ITDSEDKDEFHPFI	-3.28285	-4.31815
HLA-B44:05	3DX8	4015	ITDSEDKDEFHPFI	-5.91172	-6.94702
HLA-B44:05	3DX8	4015	ITDSEDKDEFHPFI	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of BSG-NFIX

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
BSG-NFIX	chr19	580787	chr19	13135833	10	19	EDKDEFHPF	GAGGACAAGGATGAGTTCCACCCGTTC
BSG-NFIX	chr19	580787	chr19	13135833	11	20	DKDEFHPFI	GACAAGGATGAGTTCCACCCGTTCATC
BSG-NFIX	chr19	580787	chr19	13135833	6	16	ITDSEDKDEF	ATCACTGACTCTGAGGACAAGGATGAGTTC
BSG-NFIX	chr19	580787	chr19	13135833	9	18	SEDKDEFHP	TCTGAGGACAAGGATGAGTTCCACCCG
BSG-NFIX	chr19	580787	chr19	13135833	9	19	SEDKDEFHPF	TCTGAGGACAAGGATGAGTTCCACCCGTTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
BSG-NFIX	chr19	580787	chr19	13135833	0	15	DWAWYKITDSEDKDE	GACTGGGCCTGGTACAAGATCACTGACTCTGAGGACAAGGATGAG
BSG-NFIX	chr19	580787	chr19	13135833	1	16	WAWYKITDSEDKDEF	TGGGCCTGGTACAAGATCACTGACTCTGAGGACAAGGATGAGTTC
BSG-NFIX	chr19	580787	chr19	13135833	10	25	EDKDEFHPFIEALLP	GAGGACAAGGATGAGTTCCACCCGTTCATCGAGGCACTGCTGCCT
BSG-NFIX	chr19	580787	chr19	13135833	11	26	DKDEFHPFIEALLPH	GACAAGGATGAGTTCCACCCGTTCATCGAGGCACTGCTGCCTCAC

Top

Information of the samples that have these potential fusion neoantigens of BSG-NFIX

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
N/A	BSG-NFIX	chr19	580787	ENST00000333511	chr19	13135833	ENST00000360105	XX000018

Top

Potential target of CAR-T therapy development for BSG-NFIX

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to BSG-NFIX

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to BSG-NFIX

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)