|
|||||||
|
Fusion Protein:BSG-PMEL |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: BSG-PMEL | FusionPDB ID: 10394 | FusionGDB2.0 ID: 10394 | Hgene | Tgene | Gene symbol | BSG | PMEL | Gene ID | 682 | 6490 |
| Gene name | basigin (Ok blood group) | premelanosome protein | |
| Synonyms | 5F7|CD147|EMMPRIN|EMPRIN|OK|SLC7A11|TCSF | D12S53E|ME20|ME20-M|ME20M|P1|P100|PMEL17|SI|SIL|SILV|gp100 | |
| Cytomap | 19p13.3 | 12q13.2 | |
| Type of gene | protein-coding | protein-coding | |
| Description | basiginOK blood group antigencollagenase stimulatory factorextracellular matrix metalloproteinase inducerleukocyte activation antigen M6tumor cell-derived collagenase stimulatory factor | melanocyte protein PMELmelanocyte protein Pmel 17melanocyte protein mel 17melanocytes lineage-specific antigen GP100melanoma-associated ME20 antigenmelanosomal matrix protein17silver locus protein homologsilver, mouse, homolog of | |
| Modification date | 20200315 | 20200313 | |
| UniProtAcc | P35613 Main function of 5'-partner protein: FUNCTION: [Isoform 1]: Essential for normal retinal maturation and development (By similarity). Acts as a retinal cell surface receptor for NXNL1 and plays an important role in NXNL1-mediated survival of retinal cone photoreceptors (PubMed:25957687). In association with glucose transporter SLC16A1/GLUT1 and NXNL1, promotes retinal cone survival by enhancing aerobic glycolysis and accelerating the entry of glucose into photoreceptors (PubMed:25957687). May act as a potent stimulator of IL6 secretion in multiple cell lines that include monocytes (PubMed:21620857). {ECO:0000250|UniProtKB:P18572, ECO:0000269|PubMed:21620857, ECO:0000269|PubMed:25957687}.; FUNCTION: [Isoform 2]: Signaling receptor for cyclophilins, essential for PPIA/CYPA and PPIB/CYPB-dependent signaling related to chemotaxis and adhesion of immune cells (PubMed:11943775, PubMed:11688976). Plays an important role in targeting monocarboxylate transporters SLC16A1/GLUT1, SLC16A11 and SLC16A12 to the plasma membrane (PubMed:17127621, PubMed:21778275, PubMed:28666119). Acts as a coreceptor for vascular endothelial growth factor receptor 2 (KDR/VEGFR2) in endothelial cells enhancing its VEGFA-mediated activation and downstream signaling (PubMed:25825981). Promotes angiogenesis through EPAS1/HIF2A-mediated up-regulation of VEGFA (isoform VEGF-165 and VEGF-121) and KDR/VEGFR2 in endothelial cells (PubMed:19837976). Plays a key role in regulating tumor growth, invasion, metastasis and neoangiogenesis by stimulating the production and release of extracellular matrix metalloproteinases and KDR/VEGFR2 by both tumor cells and stromal cells (fibroblasts and endothelial cells) (PubMed:12553375, PubMed:11992541, PubMed:15833850). {ECO:0000269|PubMed:11688976, ECO:0000269|PubMed:11943775, ECO:0000269|PubMed:11992541, ECO:0000269|PubMed:12553375, ECO:0000269|PubMed:15833850, ECO:0000269|PubMed:17127621, ECO:0000269|PubMed:19837976, ECO:0000269|PubMed:21778275, ECO:0000269|PubMed:25825981, ECO:0000269|PubMed:28666119}.; FUNCTION: [Isoform 1]: (Microbial infection) Erythrocyte receptor for P.falciparum RH5 which is essential for erythrocyte invasion by the merozoite stage of P.falciparum isolates 3D7 and Dd2. {ECO:0000269|PubMed:22080952}.; FUNCTION: [Isoform 2]: (Microbial infection) Erythrocyte receptor for P.falciparum RH5 which is essential for erythrocyte invasion by the merozoite stage of P.falciparum isolates 3D7, Dd2, 7G8 and HB3 (PubMed:22080952, PubMed:26195724). Binding of P.falciparum RH5 results in BSG dimerization which triggers an increase in intracellular Ca(2+) in the erythrocyte (PubMed:28409866). This essential step leads to a rearrangement of the erythrocyte cytoskeleton required for the merozoite invasion (PubMed:28409866). {ECO:0000269|PubMed:22080952, ECO:0000269|PubMed:26195724, ECO:0000269|PubMed:28409866}.; FUNCTION: [Isoform 2]: (Microbial infection) Can facilitate human SARS coronavirus (SARS-CoV-1) infection via its interaction with virus-associated PPIA/CYPA. {ECO:0000269|PubMed:15688292}.; FUNCTION: [Isoform 2]: (Microbial infection) Can facilitate HIV-1 infection via its interaction with virus-associated PPIA/CYPA. {ECO:0000269|PubMed:11353871}.; FUNCTION: [Isoform 2]: (Microbial infection) First described as a receptor for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), it is not required for SARS-CoV-2 infection. {ECO:0000269|PubMed:33432067, ECO:0000303|PubMed:32307653}.; FUNCTION: [Isoform 2]: (Microbial infection) Acts as a receptor for measles virus. {ECO:0000269|PubMed:20147391}.; FUNCTION: [Isoform 2]: (Microbial infection) Promotes entry of pentamer-expressing human cytomegalovirus (HCMV) into epithelial and endothelial cells. {ECO:0000269|PubMed:29739904}. | . | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000333511, ENST00000353555, ENST00000346916, ENST00000545507, ENST00000574970, | ENST00000548689, ENST00000360714, ENST00000449260, ENST00000536427, ENST00000539511, ENST00000548493, ENST00000548747, ENST00000550447, ENST00000550464, ENST00000552882, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 26 X 17 X 12=5304 | 4 X 3 X 1=12 |
| # samples | 29 | 4 | |
| ** MAII score | log2(29/5304*10)=-4.19295597009765 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(4/12*10)=1.73696559416621 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
| Fusion gene context | PubMed: BSG [Title/Abstract] AND PMEL [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: BSG [Title/Abstract] AND PMEL [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | BSG(572701)-PMEL(56349647), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | BSG-PMEL seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BSG-PMEL seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Tgene | PMEL | GO:0032438 | melanosome organization | 11694580 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:572701/chr12:56349647) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across BSG (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across PMEL (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000333511 | BSG | chr19 | 572701 | + | ENST00000449260 | PMEL | chr12 | 56349647 | - | 782 | 137 | 70 | 672 | 200 |
| ENST00000333511 | BSG | chr19 | 572701 | + | ENST00000552882 | PMEL | chr12 | 56349647 | - | 761 | 137 | 70 | 651 | 193 |
| ENST00000333511 | BSG | chr19 | 572701 | + | ENST00000550464 | PMEL | chr12 | 56349647 | - | 760 | 137 | 70 | 651 | 193 |
| ENST00000333511 | BSG | chr19 | 572701 | + | ENST00000548747 | PMEL | chr12 | 56349647 | - | 760 | 137 | 70 | 651 | 193 |
| ENST00000333511 | BSG | chr19 | 572701 | + | ENST00000536427 | PMEL | chr12 | 56349647 | - | 781 | 137 | 70 | 672 | 200 |
| ENST00000333511 | BSG | chr19 | 572701 | + | ENST00000539511 | PMEL | chr12 | 56349647 | - | 760 | 137 | 70 | 651 | 193 |
| ENST00000333511 | BSG | chr19 | 572701 | + | ENST00000360714 | PMEL | chr12 | 56349647 | - | 781 | 137 | 70 | 672 | 200 |
| ENST00000333511 | BSG | chr19 | 572701 | + | ENST00000548493 | PMEL | chr12 | 56349647 | - | 760 | 137 | 70 | 651 | 193 |
| ENST00000333511 | BSG | chr19 | 572701 | + | ENST00000550447 | PMEL | chr12 | 56349647 | - | 666 | 137 | 70 | 651 | 193 |
| ENST00000353555 | BSG | chr19 | 572701 | + | ENST00000449260 | PMEL | chr12 | 56349647 | - | 769 | 124 | 57 | 659 | 200 |
| ENST00000353555 | BSG | chr19 | 572701 | + | ENST00000552882 | PMEL | chr12 | 56349647 | - | 748 | 124 | 57 | 638 | 193 |
| ENST00000353555 | BSG | chr19 | 572701 | + | ENST00000550464 | PMEL | chr12 | 56349647 | - | 747 | 124 | 57 | 638 | 193 |
| ENST00000353555 | BSG | chr19 | 572701 | + | ENST00000548747 | PMEL | chr12 | 56349647 | - | 747 | 124 | 57 | 638 | 193 |
| ENST00000353555 | BSG | chr19 | 572701 | + | ENST00000536427 | PMEL | chr12 | 56349647 | - | 768 | 124 | 57 | 659 | 200 |
| ENST00000353555 | BSG | chr19 | 572701 | + | ENST00000539511 | PMEL | chr12 | 56349647 | - | 747 | 124 | 57 | 638 | 193 |
| ENST00000353555 | BSG | chr19 | 572701 | + | ENST00000360714 | PMEL | chr12 | 56349647 | - | 768 | 124 | 57 | 659 | 200 |
| ENST00000353555 | BSG | chr19 | 572701 | + | ENST00000548493 | PMEL | chr12 | 56349647 | - | 747 | 124 | 57 | 638 | 193 |
| ENST00000353555 | BSG | chr19 | 572701 | + | ENST00000550447 | PMEL | chr12 | 56349647 | - | 653 | 124 | 57 | 638 | 193 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000333511 | ENST00000449260 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.09189389 | 0.9081061 |
| ENST00000333511 | ENST00000552882 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.059735842 | 0.94026417 |
| ENST00000333511 | ENST00000550464 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.060827866 | 0.9391722 |
| ENST00000333511 | ENST00000548747 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.060827866 | 0.9391722 |
| ENST00000333511 | ENST00000536427 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.09353006 | 0.90646994 |
| ENST00000333511 | ENST00000539511 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.060827866 | 0.9391722 |
| ENST00000333511 | ENST00000360714 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.09353006 | 0.90646994 |
| ENST00000333511 | ENST00000548493 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.060827866 | 0.9391722 |
| ENST00000333511 | ENST00000550447 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.036419585 | 0.96358037 |
| ENST00000353555 | ENST00000449260 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.09771264 | 0.90228736 |
| ENST00000353555 | ENST00000552882 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.06362704 | 0.936373 |
| ENST00000353555 | ENST00000550464 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.06479412 | 0.9352059 |
| ENST00000353555 | ENST00000548747 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.06479412 | 0.9352059 |
| ENST00000353555 | ENST00000536427 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.09928337 | 0.9007166 |
| ENST00000353555 | ENST00000539511 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.06479412 | 0.9352059 |
| ENST00000353555 | ENST00000360714 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.09928337 | 0.9007166 |
| ENST00000353555 | ENST00000548493 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.06479412 | 0.9352059 |
| ENST00000353555 | ENST00000550447 | BSG | chr19 | 572701 | + | PMEL | chr12 | 56349647 | - | 0.035244927 | 0.96475506 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for BSG-PMEL |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| BSG | chr19 | 572701 | PMEL | chr12 | 56349647 | 124 | 21 | LGFALLGTHGASGAEGIESAEILQAV |
| BSG | chr19 | 572701 | PMEL | chr12 | 56349647 | 137 | 21 | LGFALLGTHGASGAEGIESAEILQAV |
Top |
Potential FusionNeoAntigen Information of BSG-PMEL in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| BSG-PMEL_572701_56349647.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| BSG-PMEL | chr19 | 572701 | chr12 | 56349647 | 137 | HLA-B38:01 | THGASGAEGI | 0.9673 | 0.9647 | 7 | 17 |
| BSG-PMEL | chr19 | 572701 | chr12 | 56349647 | 137 | HLA-B38:05 | THGASGAEGI | 0.9673 | 0.9647 | 7 | 17 |
Top |
Potential FusionNeoAntigen Information of BSG-PMEL in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| BSG-PMEL_572701_56349647.msa |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| BSG-PMEL | chr19 | 572701 | chr12 | 56349647 | 137 | DRB1-0454 | LGFALLGTHGASGAE | 0 | 15 |
Top |
Fusion breakpoint peptide structures of BSG-PMEL |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 3170 | GTHGASGAEGIESA | BSG | PMEL | chr19 | 572701 | chr12 | 56349647 | 137 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of BSG-PMEL |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 3170 | GTHGASGAEGIESA | -7.15543 | -7.26883 |
| HLA-B14:02 | 3BVN | 3170 | GTHGASGAEGIESA | -4.77435 | -5.80965 |
| HLA-B52:01 | 3W39 | 3170 | GTHGASGAEGIESA | -6.80875 | -6.92215 |
| HLA-B52:01 | 3W39 | 3170 | GTHGASGAEGIESA | -4.20386 | -5.23916 |
| HLA-A11:01 | 4UQ2 | 3170 | GTHGASGAEGIESA | -7.5194 | -8.5547 |
| HLA-A11:01 | 4UQ2 | 3170 | GTHGASGAEGIESA | -6.9601 | -7.0735 |
| HLA-A24:02 | 5HGA | 3170 | GTHGASGAEGIESA | -7.52403 | -7.63743 |
| HLA-A24:02 | 5HGA | 3170 | GTHGASGAEGIESA | -5.82433 | -6.85963 |
| HLA-B27:05 | 6PYJ | 3170 | GTHGASGAEGIESA | -3.28285 | -4.31815 |
| HLA-B44:05 | 3DX8 | 3170 | GTHGASGAEGIESA | -5.91172 | -6.94702 |
| HLA-B44:05 | 3DX8 | 3170 | GTHGASGAEGIESA | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of BSG-PMEL |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| BSG-PMEL | chr19 | 572701 | chr12 | 56349647 | 7 | 17 | THGASGAEGI | ACGGAGCCTCCGGGGCTGAGGGTATTGAAA |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
| BSG-PMEL | chr19 | 572701 | chr12 | 56349647 | 0 | 15 | LGFALLGTHGASGAE | GATTCGCGCTGCTGGGCACCCACGGAGCCTCCGGGGCTGAGGGTA |
Top |
Information of the samples that have these potential fusion neoantigens of BSG-PMEL |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| SKCM | BSG-PMEL | chr19 | 572701 | ENST00000333511 | chr12 | 56349647 | ENST00000360714 | TCGA-D3-A1Q9-06A |
Top |
Potential target of CAR-T therapy development for BSG-PMEL |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Tgene | PMEL | chr19:572701 | chr12:56349647 | ENST00000449260 | 6 | 11 | 596_616 | 0 | 669.0 | Transmembrane | Helical | |
| Tgene | PMEL | chr19:572701 | chr12:56349647 | ENST00000539511 | 5 | 10 | 596_616 | 0 | 576.0 | Transmembrane | Helical | |
| Tgene | PMEL | chr19:572701 | chr12:56349647 | ENST00000548493 | 7 | 12 | 596_616 | 0 | 662.0 | Transmembrane | Helical | |
| Tgene | PMEL | chr19:572701 | chr12:56349647 | ENST00000548747 | 6 | 11 | 596_616 | 0 | 662.0 | Transmembrane | Helical | |
| Tgene | PMEL | chr19:572701 | chr12:56349647 | ENST00000550464 | 4 | 9 | 596_616 | 0 | 576.0 | Transmembrane | Helical | |
| Tgene | PMEL | chr19:572701 | chr12:56349647 | ENST00000552882 | 7 | 12 | 596_616 | 0 | 662.0 | Transmembrane | Helical |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to BSG-PMEL |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to BSG-PMEL |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies