Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ACACA-LGALS9

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ACACA-LGALS9
	FusionPDB ID: 1159
	FusionGDB2.0 ID: 1159
		Hgene	Tgene
	Gene symbol	ACACA	LGALS9
	Gene ID	31	3965
	Gene name	acetyl-CoA carboxylase alpha	galectin 9
	Synonyms	ACAC\|ACACAD\|ACC\|ACC1\|ACCA	HUAT\|LGALS9A
	Cytomap	17q12	17q11.2
	Type of gene	protein-coding	protein-coding
	Description	acetyl-CoA carboxylase 1ACC-alphaacetyl-Coenzyme A carboxylase alpha	galectin-9ecalectingal-9lectin, galactoside-binding, soluble, 9tumor antigen HOM-HD-21urate transporter/channel protein
	Modification date	20200313	20200315
	UniProtAcc	Q13085 Main function of 5'-partner protein: FUNCTION: Cytosolic enzyme that catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the first and rate-limiting step of de novo fatty acid biosynthesis (PubMed:20952656, PubMed:20457939, PubMed:29899443). This is a 2 steps reaction starting with the ATP-dependent carboxylation of the biotin carried by the biotin carboxyl carrier (BCC) domain followed by the transfer of the carboxyl group from carboxylated biotin to acetyl-CoA (PubMed:20952656, PubMed:20457939, PubMed:29899443). {ECO:0000269\|PubMed:20457939, ECO:0000269\|PubMed:20952656, ECO:0000269\|PubMed:29899443}.	Q3B8N2 Main function of 5'-partner protein: FUNCTION: Binds galactosides. {ECO:0000250}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000335166, ENST00000353139, ENST00000360679, ENST00000394406, ENST00000361253, ENST00000416895, ENST00000588142, ENST00000589665,	ENST00000448970, ENST00000413914, ENST00000302228, ENST00000310394, ENST00000313648, ENST00000395473,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	44 X 35 X 17=26180	8 X 8 X 5=320
	# samples	51	9
	** MAII score	log2(51/26180*10)=-5.68182403997375 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(9/320*10)=-1.83007499855769 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ACACA [Title/Abstract] AND LGALS9 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ACACA [Title/Abstract] AND LGALS9 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ACACA(35627642)-LGALS9(25965289), # samples:2
Anticipated loss of major functional domain due to fusion event.	ACACA-LGALS9 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ACACA-LGALS9 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ACACA-LGALS9 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ACACA-LGALS9 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ACACA-LGALS9 seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. ACACA-LGALS9 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	LGALS9	GO:0006954	inflammatory response	23817958
Tgene	LGALS9	GO:0007565	female pregnancy	23242525
Tgene	LGALS9	GO:0010628	positive regulation of gene expression	16116184
Tgene	LGALS9	GO:0010629	negative regulation of gene expression	23408620
Tgene	LGALS9	GO:0032673	regulation of interleukin-4 production	16116184
Tgene	LGALS9	GO:0032674	regulation of interleukin-5 production	16116184
Tgene	LGALS9	GO:0032689	negative regulation of interferon-gamma production	23408620
Tgene	LGALS9	GO:0032753	positive regulation of interleukin-4 production	20209097
Tgene	LGALS9	GO:0032834	positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation involved in immune response	20209097
Tgene	LGALS9	GO:0034134	toll-like receptor 2 signaling pathway	16116184
Tgene	LGALS9	GO:0034142	toll-like receptor 4 signaling pathway	16116184
Tgene	LGALS9	GO:0038066	p38MAPK cascade	16116184
Tgene	LGALS9	GO:0045953	negative regulation of natural killer cell mediated cytotoxicity	23408620
Tgene	LGALS9	GO:0046598	positive regulation of viral entry into host cell	21670307
Tgene	LGALS9	GO:0050718	positive regulation of interleukin-1 beta secretion	20209097
Tgene	LGALS9	GO:0060135	maternal process involved in female pregnancy	25578313
Tgene	LGALS9	GO:0070241	positive regulation of activated T cell autonomous cell death	20209097
Tgene	LGALS9	GO:0070371	ERK1 and ERK2 cascade	16116184
Tgene	LGALS9	GO:0070555	response to interleukin-1	23817958
Tgene	LGALS9	GO:0071346	cellular response to interferon-gamma	23817958
Tgene	LGALS9	GO:0071636	positive regulation of transforming growth factor beta production	20209097
Tgene	LGALS9	GO:1902715	positive regulation of interferon-gamma secretion	20209097
Tgene	LGALS9	GO:1904469	positive regulation of tumor necrosis factor secretion	20209097
Tgene	LGALS9	GO:2000562	negative regulation of CD4-positive, alpha-beta T cell proliferation	20209097
Tgene	LGALS9	GO:2000563	positive regulation of CD4-positive, alpha-beta T cell proliferation	16116184
Tgene	LGALS9	GO:2000667	positive regulation of interleukin-13 secretion	20209097
Tgene	LGALS9	GO:2000670	positive regulation of dendritic cell apoptotic process	16116184
Tgene	LGALS9	GO:2001181	positive regulation of interleukin-10 secretion	16116184\|20209097
Tgene	LGALS9	GO:2001190	positive regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	16116184

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:35627642/chr17:25965289)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ACACA (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across LGALS9 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000353139	ACACA	chr17	35627642	-	ENST00000310394	LGALS9	chr17	25965289	+	3069	1601	461	2497	678
ENST00000353139	ACACA	chr17	35627642	-	ENST00000395473	LGALS9	chr17	25965289	+	3208	1601	461	2629	722
ENST00000353139	ACACA	chr17	35627642	-	ENST00000302228	LGALS9	chr17	25965289	+	3112	1601	461	2533	690
ENST00000353139	ACACA	chr17	35627642	-	ENST00000313648	LGALS9	chr17	25965289	+	2822	1601	461	2302	613
ENST00000360679	ACACA	chr17	35627642	-	ENST00000310394	LGALS9	chr17	25965289	+	2737	1269	297	2165	622
ENST00000360679	ACACA	chr17	35627642	-	ENST00000395473	LGALS9	chr17	25965289	+	2876	1269	297	2297	666
ENST00000360679	ACACA	chr17	35627642	-	ENST00000302228	LGALS9	chr17	25965289	+	2780	1269	297	2201	634
ENST00000360679	ACACA	chr17	35627642	-	ENST00000313648	LGALS9	chr17	25965289	+	2490	1269	297	1970	557
ENST00000353139	ACACA	chr17	35627641	-	ENST00000310394	LGALS9	chr17	25965288	+	3069	1601	461	2497	678
ENST00000353139	ACACA	chr17	35627641	-	ENST00000395473	LGALS9	chr17	25965288	+	3208	1601	461	2629	722
ENST00000353139	ACACA	chr17	35627641	-	ENST00000302228	LGALS9	chr17	25965288	+	3112	1601	461	2533	690
ENST00000353139	ACACA	chr17	35627641	-	ENST00000313648	LGALS9	chr17	25965288	+	2822	1601	461	2302	613
ENST00000360679	ACACA	chr17	35627641	-	ENST00000310394	LGALS9	chr17	25965288	+	2737	1269	297	2165	622
ENST00000360679	ACACA	chr17	35627641	-	ENST00000395473	LGALS9	chr17	25965288	+	2876	1269	297	2297	666
ENST00000360679	ACACA	chr17	35627641	-	ENST00000302228	LGALS9	chr17	25965288	+	2780	1269	297	2201	634
ENST00000360679	ACACA	chr17	35627641	-	ENST00000313648	LGALS9	chr17	25965288	+	2490	1269	297	1970	557

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000353139	ENST00000310394	ACACA	chr17	35627642	-	LGALS9	chr17	25965289	+	0.00207311	0.99792683
ENST00000353139	ENST00000395473	ACACA	chr17	35627642	-	LGALS9	chr17	25965289	+	0.001456204	0.99854386
ENST00000353139	ENST00000302228	ACACA	chr17	35627642	-	LGALS9	chr17	25965289	+	0.001806271	0.9981937
ENST00000353139	ENST00000313648	ACACA	chr17	35627642	-	LGALS9	chr17	25965289	+	0.002182446	0.9978175
ENST00000360679	ENST00000310394	ACACA	chr17	35627642	-	LGALS9	chr17	25965289	+	0.001448209	0.9985518
ENST00000360679	ENST00000395473	ACACA	chr17	35627642	-	LGALS9	chr17	25965289	+	0.001362181	0.99863786
ENST00000360679	ENST00000302228	ACACA	chr17	35627642	-	LGALS9	chr17	25965289	+	0.001512211	0.9984877
ENST00000360679	ENST00000313648	ACACA	chr17	35627642	-	LGALS9	chr17	25965289	+	0.001336692	0.9986633
ENST00000353139	ENST00000310394	ACACA	chr17	35627641	-	LGALS9	chr17	25965288	+	0.00207311	0.99792683
ENST00000353139	ENST00000395473	ACACA	chr17	35627641	-	LGALS9	chr17	25965288	+	0.001456204	0.99854386
ENST00000353139	ENST00000302228	ACACA	chr17	35627641	-	LGALS9	chr17	25965288	+	0.001806271	0.9981937
ENST00000353139	ENST00000313648	ACACA	chr17	35627641	-	LGALS9	chr17	25965288	+	0.002182446	0.9978175
ENST00000360679	ENST00000310394	ACACA	chr17	35627641	-	LGALS9	chr17	25965288	+	0.001448209	0.9985518
ENST00000360679	ENST00000395473	ACACA	chr17	35627641	-	LGALS9	chr17	25965288	+	0.001362181	0.99863786
ENST00000360679	ENST00000302228	ACACA	chr17	35627641	-	LGALS9	chr17	25965288	+	0.001512211	0.9984877
ENST00000360679	ENST00000313648	ACACA	chr17	35627641	-	LGALS9	chr17	25965288	+	0.001336692	0.9986633

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ACACA-LGALS9

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ACACA	chr17	35627641	LGALS9	chr17	25965288	1269	323	KVNNADDFPNLFRQAVPFSGTIQGGL
ACACA	chr17	35627641	LGALS9	chr17	25965288	1601	379	KVNNADDFPNLFRQAVPFSGTIQGGL
ACACA	chr17	35627642	LGALS9	chr17	25965289	1269	323	KVNNADDFPNLFRQAVPFSGTIQGGL
ACACA	chr17	35627642	LGALS9	chr17	25965289	1601	379	KVNNADDFPNLFRQAVPFSGTIQGGL

Top

Potential FusionNeoAntigen Information of ACACA-LGALS9 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ACACA-LGALS9_35627641_25965288.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B08:09	FPNLFRQA	0.992	0.8183	7	15
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:03	FPNLFRQAV	0.9934	0.8385	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:02	FPNLFRQAV	0.9928	0.9646	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:04	FPNLFRQAV	0.9928	0.9646	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B08:01	FPNLFRQAV	0.9896	0.8214	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B08:09	FPNLFRQAV	0.9879	0.9109	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:01	FPNLFRQAV	0.9767	0.868	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B15:02	NLFRQAVPF	0.9707	0.8901	9	18
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:05	FPNLFRQAV	0.9694	0.6716	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:08	FPNLFRQAV	0.9406	0.8414	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B13:02	RQAVPFSGTI	0.7906	0.6062	12	22
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B52:01	RQAVPFSGTI	0.1153	0.9599	12	22
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:01	FPNLFRQAVPF	0.9989	0.7699	7	18
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B54:01	FPNLFRQAV	0.9995	0.7241	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B42:02	FPNLFRQAV	0.9945	0.8299	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B51:07	FPNLFRQAV	0.9934	0.7764	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:12	FPNLFRQAV	0.9928	0.9646	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B42:01	FPNLFRQAV	0.9927	0.8238	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B07:12	FPNLFRQAV	0.973	0.5682	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B15:21	NLFRQAVPF	0.9689	0.8818	9	18
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B73:01	FRQAVPFSG	0.9524	0.665	11	20
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B39:10	FPNLFRQAV	0.9229	0.9876	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B15:31	NLFRQAVPF	0.8331	0.8397	9	18
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B78:02	FPNLFRQAV	0.9967	0.6444	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B55:04	FPNLFRQAV	0.995	0.5496	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:09	FPNLFRQAV	0.9928	0.9646	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B59:01	FPNLFRQAV	0.9919	0.5019	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B08:18	FPNLFRQAV	0.9896	0.8214	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:23	FPNLFRQAV	0.9782	0.889	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:77	FPNLFRQAV	0.9767	0.868	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:30	FPNLFRQAV	0.9647	0.7657	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:17	FPNLFRQAV	0.9647	0.7657	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B67:01	FPNLFRQAV	0.9562	0.9082	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B08:12	FPNLFRQAV	0.928	0.9067	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:24	FPNLFRQAV	0.9076	0.8841	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:11	FPNLFRQAV	0.8743	0.8802	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B18:07	FPNLFRQAV	0.235	0.8766	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:43	FPNLFRQAV	0.0165	0.8743	7	16
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:77	FPNLFRQAVPF	0.9989	0.7699	7	18
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:23	FPNLFRQAVPF	0.9989	0.764	7	18
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:17	FPNLFRQAVPF	0.9986	0.5994	7	18
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:30	FPNLFRQAVPF	0.9986	0.5994	7	18
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:24	FPNLFRQAVPF	0.9982	0.7255	7	18
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	HLA-B35:11	FPNLFRQAVPF	0.997	0.8147	7	18

Top

Potential FusionNeoAntigen Information of ACACA-LGALS9 in HLA II

ACACA-LGALS9_35627641_25965288.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	DRB1-0901	PNLFRQAVPFSGTIQ	8	23
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	DRB1-0902	PNLFRQAVPFSGTIQ	8	23
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	DRB1-0902	FPNLFRQAVPFSGTI	7	22
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	DRB1-0902	DFPNLFRQAVPFSGT	6	21
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	DRB1-0903	PNLFRQAVPFSGTIQ	8	23
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	DRB1-0903	FPNLFRQAVPFSGTI	7	22
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	DRB1-0908	PNLFRQAVPFSGTIQ	8	23
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	DRB1-0908	FPNLFRQAVPFSGTI	7	22
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	DRB1-0909	PNLFRQAVPFSGTIQ	8	23
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	DRB1-1001	PNLFRQAVPFSGTIQ	8	23
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	DRB1-1003	PNLFRQAVPFSGTIQ	8	23
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	DRB5-0112	PNLFRQAVPFSGTIQ	8	23
ACACA-LGALS9	chr17	35627641	chr17	25965288	1601	DRB5-0112	FPNLFRQAVPFSGTI	7	22

Top

Fusion breakpoint peptide structures of ACACA-LGALS9

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1095	DFPNLFRQAVPFSG	ACACA	LGALS9	chr17	35627641	chr17	25965288	1601

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ACACA-LGALS9

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1095	DFPNLFRQAVPFSG	-7.47338	-7.58678
HLA-B14:02	3BVN	1095	DFPNLFRQAVPFSG	-4.02131	-5.05661
HLA-B52:01	3W39	1095	DFPNLFRQAVPFSG	-6.09305	-6.20645
HLA-B52:01	3W39	1095	DFPNLFRQAVPFSG	-5.89116	-6.92646
HLA-B18:01	4JQV	1095	DFPNLFRQAVPFSG	-2.29971	-3.33501
HLA-A11:01	4UQ2	1095	DFPNLFRQAVPFSG	-9.02997	-9.14337
HLA-A24:02	5HGA	1095	DFPNLFRQAVPFSG	-7.5857	-7.6991
HLA-A24:02	5HGA	1095	DFPNLFRQAVPFSG	-7.19093	-8.22623
HLA-B27:05	6PYJ	1095	DFPNLFRQAVPFSG	-6.48577	-7.52107
HLA-B27:05	6PYJ	1095	DFPNLFRQAVPFSG	-3.80826	-3.92166
HLA-B44:05	3DX8	1095	DFPNLFRQAVPFSG	-4.50666	-4.62006
HLA-B44:05	3DX8	1095	DFPNLFRQAVPFSG	-3.72245	-4.75775

Top

Vaccine Design for the FusionNeoAntigens of ACACA-LGALS9

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ACACA-LGALS9	chr17	35627641	chr17	25965288	11	20	FRQAVPFSG	AGACAGGCTGTCCCCTTTTCTGGGACT
ACACA-LGALS9	chr17	35627641	chr17	25965288	12	22	RQAVPFSGTI	CAGGCTGTCCCCTTTTCTGGGACTATTCAA
ACACA-LGALS9	chr17	35627641	chr17	25965288	7	15	FPNLFRQA	CCTAATCTCTTCAGACAGGCTGTC
ACACA-LGALS9	chr17	35627641	chr17	25965288	7	16	FPNLFRQAV	CCTAATCTCTTCAGACAGGCTGTCCCC
ACACA-LGALS9	chr17	35627641	chr17	25965288	7	18	FPNLFRQAVPF	CCTAATCTCTTCAGACAGGCTGTCCCCTTTTCT
ACACA-LGALS9	chr17	35627641	chr17	25965288	9	18	NLFRQAVPF	CTCTTCAGACAGGCTGTCCCCTTTTCT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ACACA-LGALS9	chr17	35627641	chr17	25965288	6	21	DFPNLFRQAVPFSGT	TTCCCTAATCTCTTCAGACAGGCTGTCCCCTTTTCTGGGACTATT
ACACA-LGALS9	chr17	35627641	chr17	25965288	7	22	FPNLFRQAVPFSGTI	CCTAATCTCTTCAGACAGGCTGTCCCCTTTTCTGGGACTATTCAA
ACACA-LGALS9	chr17	35627641	chr17	25965288	8	23	PNLFRQAVPFSGTIQ	AATCTCTTCAGACAGGCTGTCCCCTTTTCTGGGACTATTCAAGGA

Top

Information of the samples that have these potential fusion neoantigens of ACACA-LGALS9

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	ACACA-LGALS9	chr17	35627641	ENST00000353139	chr17	25965288	ENST00000302228	TCGA-CD-5799

Top

Potential target of CAR-T therapy development for ACACA-LGALS9

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ACACA-LGALS9

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ACACA-LGALS9

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)