Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:C7orf10-POU6F2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: C7orf10-POU6F2
	FusionPDB ID: 12004
	FusionGDB2.0 ID: 12004
		Hgene	Tgene
	Gene symbol	C7orf10	POU6F2
	Gene ID	79783	11281
	Gene name	succinyl-CoA:glutarate-CoA transferase	POU class 6 homeobox 2
	Synonyms	C7orf10\|DERP13\|GA3\|ORF19	RPF-1\|WT5\|WTSL
	Cytomap	7p14.1	7p14.1
	Type of gene	protein-coding	protein-coding
	Description	succinate--hydroxymethylglutarate CoA-transferaseRussel-Silver syndrome candidatedermal papilla-derived protein 13succinylCoA:glutarate-CoA transferase	POU domain, class 6, transcription factor 2Wilms tumor suppressor locusretina-derived POU-domain factor-1
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000309930, ENST00000335693, ENST00000401647, ENST00000464028, ENST00000540834,	ENST00000464276, ENST00000517348, ENST00000559001, ENST00000403058, ENST00000518318,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	3 X 2 X 3=18	7 X 9 X 9=567
	# samples	3	12
	** MAII score	log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(12/567*10)=-2.24031432933371 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: C7orf10 [Title/Abstract] AND POU6F2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: C7orf10 [Title/Abstract] AND POU6F2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	C7orf10(40535985)-POU6F2(39446199), # samples:1
Anticipated loss of major functional domain due to fusion event.	C7orf10-POU6F2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. C7orf10-POU6F2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. C7orf10-POU6F2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. C7orf10-POU6F2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:40535985/chr7:39446199)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across C7orf10 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across POU6F2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000309930	C7orf10	chr7	40535985	-	ENST00000403058	POU6F2	chr7	39446199	+	2430	1134	24	2324	766
ENST00000309930	C7orf10	chr7	40535985	-	ENST00000518318	POU6F2	chr7	39446199	+	6132	1134	24	2216	730
ENST00000401647	C7orf10	chr7	40535985	-	ENST00000403058	POU6F2	chr7	39446199	+	2285	989	23	2179	718
ENST00000401647	C7orf10	chr7	40535985	-	ENST00000518318	POU6F2	chr7	39446199	+	5987	989	23	2071	682
ENST00000335693	C7orf10	chr7	40535985	-	ENST00000403058	POU6F2	chr7	39446199	+	2429	1133	23	2323	766
ENST00000335693	C7orf10	chr7	40535985	-	ENST00000518318	POU6F2	chr7	39446199	+	6131	1133	23	2215	730

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000309930	ENST00000403058	C7orf10	chr7	40535985	-	POU6F2	chr7	39446199	+	0.003184973	0.996815
ENST00000309930	ENST00000518318	C7orf10	chr7	40535985	-	POU6F2	chr7	39446199	+	0.000203166	0.9997968
ENST00000401647	ENST00000403058	C7orf10	chr7	40535985	-	POU6F2	chr7	39446199	+	0.005825894	0.99417406
ENST00000401647	ENST00000518318	C7orf10	chr7	40535985	-	POU6F2	chr7	39446199	+	0.00031273	0.9996873
ENST00000335693	ENST00000403058	C7orf10	chr7	40535985	-	POU6F2	chr7	39446199	+	0.003200703	0.99679923
ENST00000335693	ENST00000518318	C7orf10	chr7	40535985	-	POU6F2	chr7	39446199	+	0.000202996	0.99979705

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for C7orf10-POU6F2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
C7orf10	chr7	40535985	POU6F2	chr7	39446199	1133	369	GPINNMKNVFAEPQLVNNPLASQAAA
C7orf10	chr7	40535985	POU6F2	chr7	39446199	1134	369	GPINNMKNVFAEPQLVNNPLASQAAA
C7orf10	chr7	40535985	POU6F2	chr7	39446199	989	321	GPINNMKNVFAEPQLVNNPLASQAAA

Top

Potential FusionNeoAntigen Information of C7orf10-POU6F2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

C7orf10-POU6F2_40535985_39446199.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B45:01	AEPQLVNNP	0.9895	0.7893	10	19
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B50:02	AEPQLVNNP	0.9829	0.6454	10	19
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B35:03	EPQLVNNPL	0.932	0.6511	11	20
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-A02:21	NVFAEPQLV	0.9107	0.5623	7	16
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B35:04	EPQLVNNPL	0.8226	0.6931	11	20
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B35:02	EPQLVNNPL	0.8226	0.6931	11	20
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B13:02	NVFAEPQLV	0.6509	0.5765	7	16
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B52:01	NVFAEPQLV	0.6286	0.9421	7	16
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B41:01	AEPQLVNNP	0.4914	0.865	10	19
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B50:01	AEPQLVNNP	0.4858	0.7258	10	19
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-A02:20	KNVFAEPQLV	0.3538	0.5205	6	16
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B40:06	AEPQLVNNP	0.9878	0.6909	10	19
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-C06:03	NVFAEPQLV	0.9116	0.9949	7	16
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B35:12	EPQLVNNPL	0.8226	0.6931	11	20
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B39:10	EPQLVNNPL	0.6901	0.6891	11	20
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B51:07	NVFAEPQLV	0.6606	0.8783	7	16
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-A69:01	NVFAEPQLV	0.9946	0.6375	7	16
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-A02:06	NVFAEPQLV	0.9107	0.5623	7	16
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-A02:03	NVFAEPQLV	0.8553	0.5352	7	16
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B35:09	EPQLVNNPL	0.8226	0.6931	11	20
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B35:24	EPQLVNNPL	0.8098	0.7275	11	20
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B67:01	EPQLVNNPL	0.7194	0.5313	11	20
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B50:04	AEPQLVNNP	0.4858	0.7258	10	19
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B50:05	AEPQLVNNP	0.4858	0.7258	10	19
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	HLA-B67:01	AEPQLVNNPL	0.83	0.5923	10	20

Top

Potential FusionNeoAntigen Information of C7orf10-POU6F2 in HLA II

C7orf10-POU6F2_40535985_39446199.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0303	EPQLVNNPLASQAAA	11	26
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0403	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0413	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0415	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0419	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0427	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0436	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0437	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0439	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0440	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0441	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0442	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0444	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0446	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0449	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0450	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0451	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0452	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0453	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0455	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0456	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0458	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0459	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0460	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0461	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0465	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0468	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0470	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0471	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0473	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0475	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0478	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0479	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0485	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-0488	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-1419	EPQLVNNPLASQAAA	11	26
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-1447	EPQLVNNPLASQAAA	11	26
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-1447	AEPQLVNNPLASQAA	10	25
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB1-1615	GPINNMKNVFAEPQL	0	15
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB3-0201	EPQLVNNPLASQAAA	11	26
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB3-0204	EPQLVNNPLASQAAA	11	26
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB3-0204	AEPQLVNNPLASQAA	10	25
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB3-0214	EPQLVNNPLASQAAA	11	26
C7orf10-POU6F2	chr7	40535985	chr7	39446199	1134	DRB3-0224	EPQLVNNPLASQAAA	11	26

Top

Fusion breakpoint peptide structures of C7orf10-POU6F2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4469	KNVFAEPQLVNNPL	C7orf10	POU6F2	chr7	40535985	chr7	39446199	1134

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of C7orf10-POU6F2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4469	KNVFAEPQLVNNPL	-5.50071	-6.53601
HLA-B14:02	3BVN	4469	KNVFAEPQLVNNPL	-5.44997	-5.56337
HLA-B52:01	3W39	4469	KNVFAEPQLVNNPL	-6.87928	-6.99268
HLA-B52:01	3W39	4469	KNVFAEPQLVNNPL	-3.95744	-4.99274
HLA-A24:02	5HGA	4469	KNVFAEPQLVNNPL	-7.30598	-7.41938
HLA-A24:02	5HGA	4469	KNVFAEPQLVNNPL	-5.09366	-6.12896
HLA-B44:05	3DX8	4469	KNVFAEPQLVNNPL	-5.64505	-5.75845
HLA-B44:05	3DX8	4469	KNVFAEPQLVNNPL	-4.1878	-5.2231
HLA-A02:01	6TDR	4469	KNVFAEPQLVNNPL	-0.0912853	-1.12659

Top

Vaccine Design for the FusionNeoAntigens of C7orf10-POU6F2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
C7orf10-POU6F2	chr7	40535985	chr7	39446199	10	19	AEPQLVNNP	GAACCTCAGCTGGTTAATAATCCACTA
C7orf10-POU6F2	chr7	40535985	chr7	39446199	10	20	AEPQLVNNPL	GAACCTCAGCTGGTTAATAATCCACTAGCA
C7orf10-POU6F2	chr7	40535985	chr7	39446199	11	20	EPQLVNNPL	CCTCAGCTGGTTAATAATCCACTAGCA
C7orf10-POU6F2	chr7	40535985	chr7	39446199	6	16	KNVFAEPQLV	AATGTATTTGCAGAACCTCAGCTGGTTAAT
C7orf10-POU6F2	chr7	40535985	chr7	39446199	7	16	NVFAEPQLV	GTATTTGCAGAACCTCAGCTGGTTAAT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
C7orf10-POU6F2	chr7	40535985	chr7	39446199	0	15	GPINNMKNVFAEPQL	CCAATCAACAACATGAAGAATGTATTTGCAGAACCTCAGCTGGTT
C7orf10-POU6F2	chr7	40535985	chr7	39446199	10	25	AEPQLVNNPLASQAA	GAACCTCAGCTGGTTAATAATCCACTAGCAAGTCAGGCTGCAGCG
C7orf10-POU6F2	chr7	40535985	chr7	39446199	11	26	EPQLVNNPLASQAAA	CCTCAGCTGGTTAATAATCCACTAGCAAGTCAGGCTGCAGCGGCT

Top

Information of the samples that have these potential fusion neoantigens of C7orf10-POU6F2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	C7orf10-POU6F2	chr7	40535985	ENST00000309930	chr7	39446199	ENST00000403058	TCGA-A7-A26G-01A

Top

Potential target of CAR-T therapy development for C7orf10-POU6F2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to C7orf10-POU6F2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to C7orf10-POU6F2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)