Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CACNA2D3-DAP3

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CACNA2D3-DAP3
	FusionPDB ID: 12362
	FusionGDB2.0 ID: 12362
		Hgene	Tgene
	Gene symbol	CACNA2D3	DAP3
	Gene ID	55799	58512
	Gene name	calcium voltage-gated channel auxiliary subunit alpha2delta 3	DLG associated protein 3
	Synonyms	HSA272268	DAP3\|SAPAP3
	Cytomap	3p21.1-p14.3	1p34.3
	Type of gene	protein-coding	protein-coding
	Description	voltage-dependent calcium channel subunit alpha-2/delta-3calcium channel alpha2-delta3 subunitcalcium channel, voltage-dependent, alpha 2/delta 3 subunitcalcium channel, voltage-dependent, alpha 2/delta subunit 3voltage-gated calcium channel subunit a	disks large-associated protein 3DAP-3PSD-95/SAP90-binding protein 3SAP90/PSD-95-associated protein 3discs large homolog associated protein 3
	Modification date	20200313	20200313
	UniProtAcc	Q8IZS8 Main function of 5'-partner protein: FUNCTION: The alpha-2/delta subunit of voltage-dependent calcium channels regulates calcium current density and activation/inactivation kinetics of the calcium channel. Acts as a regulatory subunit for P/Q-type calcium channel (CACNA1A), N-type (CACNA1B), L-type (CACNA1C OR CACNA1D) but not T-type (CACNA1G) (By similarity). {ECO:0000250}.	P51398 Main function of 5'-partner protein: FUNCTION: Involved in mediating interferon-gamma-induced cell death.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000288197, ENST00000415676, ENST00000474759, ENST00000490478, ENST00000478261,	ENST00000421487, ENST00000465375, ENST00000496863, ENST00000535183, ENST00000343043, ENST00000471642, ENST00000368336,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	14 X 12 X 6=1008	16 X 12 X 6=1152
	# samples	15	18
	** MAII score	log2(15/1008*10)=-2.74846123300404 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(18/1152*10)=-2.67807190511264 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: CACNA2D3 [Title/Abstract] AND DAP3 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CACNA2D3 [Title/Abstract] AND DAP3 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CACNA2D3(54676268)-DAP3(155707948), # samples:2
Anticipated loss of major functional domain due to fusion event.	CACNA2D3-DAP3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CACNA2D3-DAP3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CACNA2D3-DAP3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CACNA2D3-DAP3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CACNA2D3-DAP3 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. CACNA2D3-DAP3 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. CACNA2D3-DAP3 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr3:54676268/chr1:155707948)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CACNA2D3 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across DAP3 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000415676	CACNA2D3	chr3	54676268	+	ENST00000368336	DAP3	chr1	155707948	+	2139	1285	118	1323	401
ENST00000288197	CACNA2D3	chr3	54676268	+	ENST00000368336	DAP3	chr1	155707948	+	2069	1215	48	1253	401
ENST00000474759	CACNA2D3	chr3	54676268	+	ENST00000368336	DAP3	chr1	155707948	+	2069	1215	48	1253	401
ENST00000490478	CACNA2D3	chr3	54676268	+	ENST00000368336	DAP3	chr1	155707948	+	1951	1097	125	1135	336
ENST00000415676	CACNA2D3	chr3	54676268	+	ENST00000368336	DAP3	chr1	155707947	+	2139	1285	118	1323	401
ENST00000288197	CACNA2D3	chr3	54676268	+	ENST00000368336	DAP3	chr1	155707947	+	2069	1215	48	1253	401
ENST00000474759	CACNA2D3	chr3	54676268	+	ENST00000368336	DAP3	chr1	155707947	+	2069	1215	48	1253	401
ENST00000490478	CACNA2D3	chr3	54676268	+	ENST00000368336	DAP3	chr1	155707947	+	1951	1097	125	1135	336
ENST00000415676	CACNA2D3	chr3	54676268	+	ENST00000471642	DAP3	chr1	155706737	+	1773	1285	118	1488	456
ENST00000415676	CACNA2D3	chr3	54676268	+	ENST00000368336	DAP3	chr1	155706737	+	2257	1285	118	1488	456
ENST00000415676	CACNA2D3	chr3	54676268	+	ENST00000343043	DAP3	chr1	155706737	+	1773	1285	118	1488	456
ENST00000288197	CACNA2D3	chr3	54676268	+	ENST00000471642	DAP3	chr1	155706737	+	1703	1215	48	1418	456
ENST00000288197	CACNA2D3	chr3	54676268	+	ENST00000368336	DAP3	chr1	155706737	+	2187	1215	48	1418	456
ENST00000288197	CACNA2D3	chr3	54676268	+	ENST00000343043	DAP3	chr1	155706737	+	1703	1215	48	1418	456
ENST00000474759	CACNA2D3	chr3	54676268	+	ENST00000471642	DAP3	chr1	155706737	+	1703	1215	48	1418	456
ENST00000474759	CACNA2D3	chr3	54676268	+	ENST00000368336	DAP3	chr1	155706737	+	2187	1215	48	1418	456
ENST00000474759	CACNA2D3	chr3	54676268	+	ENST00000343043	DAP3	chr1	155706737	+	1703	1215	48	1418	456
ENST00000490478	CACNA2D3	chr3	54676268	+	ENST00000471642	DAP3	chr1	155706737	+	1585	1097	125	1300	391
ENST00000490478	CACNA2D3	chr3	54676268	+	ENST00000368336	DAP3	chr1	155706737	+	2069	1097	125	1300	391
ENST00000490478	CACNA2D3	chr3	54676268	+	ENST00000343043	DAP3	chr1	155706737	+	1585	1097	125	1300	391

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000415676	ENST00000368336	CACNA2D3	chr3	54676268	+	DAP3	chr1	155707948	+	0.00104183	0.9989581
ENST00000288197	ENST00000368336	CACNA2D3	chr3	54676268	+	DAP3	chr1	155707948	+	0.000851891	0.99914813
ENST00000474759	ENST00000368336	CACNA2D3	chr3	54676268	+	DAP3	chr1	155707948	+	0.000851891	0.99914813
ENST00000490478	ENST00000368336	CACNA2D3	chr3	54676268	+	DAP3	chr1	155707948	+	0.000837163	0.9991628
ENST00000415676	ENST00000368336	CACNA2D3	chr3	54676268	+	DAP3	chr1	155707947	+	0.00104183	0.9989581
ENST00000288197	ENST00000368336	CACNA2D3	chr3	54676268	+	DAP3	chr1	155707947	+	0.000851891	0.99914813
ENST00000474759	ENST00000368336	CACNA2D3	chr3	54676268	+	DAP3	chr1	155707947	+	0.000851891	0.99914813
ENST00000490478	ENST00000368336	CACNA2D3	chr3	54676268	+	DAP3	chr1	155707947	+	0.000837163	0.9991628
ENST00000415676	ENST00000471642	CACNA2D3	chr3	54676268	+	DAP3	chr1	155706737	+	0.000887646	0.9991123
ENST00000415676	ENST00000368336	CACNA2D3	chr3	54676268	+	DAP3	chr1	155706737	+	0.000920179	0.9990798
ENST00000415676	ENST00000343043	CACNA2D3	chr3	54676268	+	DAP3	chr1	155706737	+	0.000887646	0.9991123
ENST00000288197	ENST00000471642	CACNA2D3	chr3	54676268	+	DAP3	chr1	155706737	+	0.000661522	0.99933845
ENST00000288197	ENST00000368336	CACNA2D3	chr3	54676268	+	DAP3	chr1	155706737	+	0.000758313	0.9992417
ENST00000288197	ENST00000343043	CACNA2D3	chr3	54676268	+	DAP3	chr1	155706737	+	0.000661522	0.99933845
ENST00000474759	ENST00000471642	CACNA2D3	chr3	54676268	+	DAP3	chr1	155706737	+	0.000661522	0.99933845
ENST00000474759	ENST00000368336	CACNA2D3	chr3	54676268	+	DAP3	chr1	155706737	+	0.000758313	0.9992417
ENST00000474759	ENST00000343043	CACNA2D3	chr3	54676268	+	DAP3	chr1	155706737	+	0.000661522	0.99933845
ENST00000490478	ENST00000471642	CACNA2D3	chr3	54676268	+	DAP3	chr1	155706737	+	0.000433828	0.99956614
ENST00000490478	ENST00000368336	CACNA2D3	chr3	54676268	+	DAP3	chr1	155706737	+	0.000554225	0.99944574
ENST00000490478	ENST00000343043	CACNA2D3	chr3	54676268	+	DAP3	chr1	155706737	+	0.000433828	0.99956614

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CACNA2D3-DAP3

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CACNA2D3	chr3	54676268	DAP3	chr1	155706737	1097	324	DTIFAKYNWPDRKEGFDALDPFIPIL
CACNA2D3	chr3	54676268	DAP3	chr1	155706737	1215	389	DTIFAKYNWPDRKEGFDALDPFIPIL
CACNA2D3	chr3	54676268	DAP3	chr1	155706737	1285	389	DTIFAKYNWPDRKEGFDALDPFIPIL

Top

Potential FusionNeoAntigen Information of CACNA2D3-DAP3 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CACNA2D3-DAP3_54676268_155706737.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B14:02	DRKEGFDAL	0.9983	0.8656	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B14:01	DRKEGFDAL	0.9983	0.8656	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B39:24	DRKEGFDAL	0.9971	0.5695	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B39:01	DRKEGFDAL	0.9961	0.9068	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B39:06	DRKEGFDAL	0.9941	0.9109	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B38:02	DRKEGFDAL	0.9903	0.9544	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B15:10	DRKEGFDAL	0.931	0.5826	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B15:37	DRKEGFDAL	0.9043	0.5659	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-A24:31	NWPDRKEGF	0.8552	0.5909	7	16
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B15:18	DRKEGFDAL	0.6008	0.738	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B08:09	DRKEGFDAL	0.3187	0.7721	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B07:10	DRKEGFDAL	0.0074	0.5677	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-A24:25	KYNWPDRKEGF	0.9981	0.5773	5	16
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-A24:10	KYNWPDRKEGF	0.9979	0.5679	5	16
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-A24:20	KYNWPDRKEGF	0.9978	0.5764	5	16
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-A24:15	KYNWPDRKEGF	0.9975	0.5811	5	16
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-A24:31	KYNWPDRKEGF	0.9967	0.5335	5	16
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-A31:08	KYNWPDRKEGF	0.9962	0.5267	5	16
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B35:03	WPDRKEGFDAL	0.9954	0.809	8	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B35:02	WPDRKEGFDAL	0.9855	0.914	8	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B35:04	WPDRKEGFDAL	0.9855	0.914	8	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-A24:14	KYNWPDRKEGF	0.9836	0.5806	5	16
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B81:01	WPDRKEGFDAL	0.9711	0.606	8	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B82:01	WPDRKEGFDAL	0.9526	0.6597	8	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B39:09	DRKEGFDAL	0.9958	0.7403	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B39:12	DRKEGFDAL	0.9949	0.9132	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B39:05	DRKEGFDAL	0.991	0.8903	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B73:01	DRKEGFDAL	0.8148	0.7882	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B14:03	DRKEGFDAL	0.7463	0.8545	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-C12:16	DRKEGFDAL	0.1095	0.9738	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B42:02	WPDRKEGFDAL	0.9983	0.6656	8	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B42:01	WPDRKEGFDAL	0.9979	0.6595	8	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-A24:02	KYNWPDRKEGF	0.9978	0.5764	5	16
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B39:10	WPDRKEGFDAL	0.988	0.932	8	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B35:12	WPDRKEGFDAL	0.9855	0.914	8	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B39:31	DRKEGFDAL	0.9964	0.9105	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B39:11	DRKEGFDAL	0.8956	0.8046	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B15:09	DRKEGFDAL	0.8759	0.6332	10	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B67:01	WPDRKEGFDAL	0.9902	0.8759	8	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B35:09	WPDRKEGFDAL	0.9855	0.914	8	19
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	HLA-B82:02	WPDRKEGFDAL	0.9526	0.6597	8	19

Top

Potential FusionNeoAntigen Information of CACNA2D3-DAP3 in HLA II

CACNA2D3-DAP3_54676268_155706737.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	1215	DRB1-1457	DTIFAKYNWPDRKEG	0	15

Top

Fusion breakpoint peptide structures of CACNA2D3-DAP3

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10756	YNWPDRKEGFDALD	CACNA2D3	DAP3	chr3	54676268	chr1	155706737	1215

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CACNA2D3-DAP3

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10756	YNWPDRKEGFDALD	-7.99449	-8.10789
HLA-B14:02	3BVN	10756	YNWPDRKEGFDALD	-4.19364	-5.22894
HLA-B52:01	3W39	10756	YNWPDRKEGFDALD	-5.8571	-6.8924
HLA-B52:01	3W39	10756	YNWPDRKEGFDALD	-5.03914	-5.15254
HLA-A24:02	5HGA	10756	YNWPDRKEGFDALD	-5.78302	-5.89642
HLA-A24:02	5HGA	10756	YNWPDRKEGFDALD	-5.66991	-6.70521
HLA-B44:05	3DX8	10756	YNWPDRKEGFDALD	-5.96708	-6.08048
HLA-B44:05	3DX8	10756	YNWPDRKEGFDALD	-3.40973	-4.44503
HLA-A02:01	6TDR	10756	YNWPDRKEGFDALD	-6.12518	-7.16048

Top

Vaccine Design for the FusionNeoAntigens of CACNA2D3-DAP3

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	10	19	DRKEGFDAL	GATCGAAAGGAAGGATTTGATGCCCTG
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	5	16	KYNWPDRKEGF	AAATACAATTGGCCAGATCGAAAGGAAGGATTT
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	7	16	NWPDRKEGF	AATTGGCCAGATCGAAAGGAAGGATTT
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	8	19	WPDRKEGFDAL	TGGCCAGATCGAAAGGAAGGATTTGATGCCCTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
CACNA2D3-DAP3	chr3	54676268	chr1	155706737	0	15	DTIFAKYNWPDRKEG	GATACAATCTTTGCAAAATACAATTGGCCAGATCGAAAGGAAGGA

Top

Information of the samples that have these potential fusion neoantigens of CACNA2D3-DAP3

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	CACNA2D3-DAP3	chr3	54676268	ENST00000288197	chr1	155706737	ENST00000343043	TCGA-20-1684-01A

Top

Potential target of CAR-T therapy development for CACNA2D3-DAP3

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CACNA2D3-DAP3

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CACNA2D3-DAP3

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)