|
|||||||
|
Fusion Protein:CASC3-NFE2L1 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: CASC3-NFE2L1 | FusionPDB ID: 13154 | FusionGDB2.0 ID: 13154 | Hgene | Tgene | Gene symbol | CASC3 | NFE2L1 | Gene ID | 22794 | 4779 |
| Gene name | CASC3 exon junction complex subunit | nuclear factor, erythroid 2 like 1 | |
| Synonyms | BTZ|MLN51 | LCR-F1|NRF1|TCF11 | |
| Cytomap | 17q21.1 | 17q21.32 | |
| Type of gene | protein-coding | protein-coding | |
| Description | protein CASC3MLN 51barentszcancer susceptibility 3cancer susceptibility candidate 3cancer susceptibility candidate gene 3 proteinmetastatic lymph node 51metastatic lymph node gene 51 proteinprotein barentsz | endoplasmic reticulum membrane sensor NFE2L1NF-E2-related factor 1NFE2-related factor 1TCF-11locus control region-factor 1nuclear factor erythroid 2-related factor 1nuclear factor, erythroid derived 2, like 1protein NRF1, p120 formtranscription fa | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | O15234 Main function of 5'-partner protein: FUNCTION: Required for pre-mRNA splicing as component of the spliceosome (PubMed:28502770, PubMed:29301961). Core component of the splicing-dependent multiprotein exon junction complex (EJC) deposited at splice junctions on mRNAs. The EJC is a dynamic structure consisting of core proteins and several peripheral nuclear and cytoplasmic associated factors that join the complex only transiently either during EJC assembly or during subsequent mRNA metabolism. The EJC marks the position of the exon-exon junction in the mature mRNA for the gene expression machinery and the core components remain bound to spliced mRNAs throughout all stages of mRNA metabolism thereby influencing downstream processes including nuclear mRNA export, subcellular mRNA localization, translation efficiency and nonsense-mediated mRNA decay (NMD). Stimulates the ATPase and RNA-helicase activities of EIF4A3. Plays a role in the stress response by participating in cytoplasmic stress granules assembly and by favoring cell recovery following stress. Component of the dendritic ribonucleoprotein particles (RNPs) in hippocampal neurons. May play a role in mRNA transport. Binds spliced mRNA in sequence-independent manner, 20-24 nucleotides upstream of mRNA exon-exon junctions. Binds poly(G) and poly(U) RNA homopolymer. {ECO:0000269|PubMed:17375189, ECO:0000269|PubMed:17652158, ECO:0000269|PubMed:28502770, ECO:0000269|PubMed:29301961}. | Q14494 Main function of 5'-partner protein: FUNCTION: [Endoplasmic reticulum membrane sensor NFE2L1]: Endoplasmic reticulum membrane sensor that translocates into the nucleus in response to various stresses to act as a transcription factor (PubMed:20932482, PubMed:24448410). Constitutes a precursor of the transcription factor NRF1 (By similarity). Able to detect various cellular stresses, such as cholesterol excess, oxidative stress or proteasome inhibition (PubMed:20932482). In response to stress, it is released from the endoplasmic reticulum membrane following cleavage by the protease DDI2 and translocates into the nucleus to form the transcription factor NRF1 (By similarity). Acts as a key sensor of cholesterol excess: in excess cholesterol conditions, the endoplasmic reticulum membrane form of the protein directly binds cholesterol via its CRAC motif, preventing cleavage and release of the transcription factor NRF1, thereby allowing expression of genes promoting cholesterol removal, such as CD36 (By similarity). Involved in proteasome homeostasis: in response to proteasome inhibition, it is released from the endoplasmic reticulum membrane, translocates to the nucleus and activates expression of genes encoding proteasome subunits (PubMed:20932482). {ECO:0000250|UniProtKB:Q61985, ECO:0000269|PubMed:20932482, ECO:0000269|PubMed:24448410}.; FUNCTION: [Transcription factor NRF1]: CNC-type bZIP family transcription factor that translocates to the nucleus and regulates expression of target genes in response to various stresses (PubMed:8932385, PubMed:9421508). Heterodimerizes with small-Maf proteins (MAFF, MAFG or MAFK) and binds DNA motifs including the antioxidant response elements (AREs), which regulate expression of genes involved in oxidative stress response (PubMed:8932385, PubMed:9421508). Activates or represses expression of target genes, depending on the context (PubMed:8932385, PubMed:9421508). Plays a key role in cholesterol homeostasis by acting as a sensor of cholesterol excess: in low cholesterol conditions, translocates into the nucleus and represses expression of genes involved in defense against cholesterol excess, such as CD36 (By similarity). In excess cholesterol conditions, the endoplasmic reticulum membrane form of the protein directly binds cholesterol via its CRAC motif, preventing cleavage and release of the transcription factor NRF1, thereby allowing expression of genes promoting cholesterol removal (By similarity). Critical for redox balance in response to oxidative stress: acts by binding the AREs motifs on promoters and mediating activation of oxidative stress response genes, such as GCLC, GCLM, GSS, MT1 and MT2 (By similarity). Plays an essential role during fetal liver hematopoiesis: probably has a protective function against oxidative stress and is involved in lipid homeostasis in the liver (By similarity). Involved in proteasome homeostasis: in response to proteasome inhibition, mediates the 'bounce-back' of proteasome subunits by translocating into the nucleus and activating expression of genes encoding proteasome subunits (PubMed:20932482). Also involved in regulating glucose flux (By similarity). Together with CEBPB; represses expression of DSPP during odontoblast differentiation (PubMed:15308669). In response to ascorbic acid induction, activates expression of SP7/Osterix in osteoblasts. {ECO:0000250|UniProtKB:Q61985, ECO:0000269|PubMed:15308669, ECO:0000269|PubMed:20932482, ECO:0000269|PubMed:8932385, ECO:0000269|PubMed:9421508}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000264645, | ENST00000361665, ENST00000536222, ENST00000579481, ENST00000582155, ENST00000583378, ENST00000357480, ENST00000362042, ENST00000585291, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 21 X 10 X 10=2100 | 11 X 9 X 5=495 |
| # samples | 28 | 11 | |
| ** MAII score | log2(28/2100*10)=-2.90689059560852 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(11/495*10)=-2.16992500144231 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: CASC3 [Title/Abstract] AND NFE2L1 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: CASC3 [Title/Abstract] AND NFE2L1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | CASC3(38325699)-NFE2L1(46133747), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | CASC3-NFE2L1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CASC3-NFE2L1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CASC3-NFE2L1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CASC3-NFE2L1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | CASC3 | GO:0000398 | mRNA splicing, via spliceosome | 29301961 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:38325699/chr17:46133747) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across CASC3 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across NFE2L1 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000264645 | CASC3 | chr17 | 38325699 | + | ENST00000362042 | NFE2L1 | chr17 | 46133747 | + | 5962 | 2314 | 172 | 4122 | 1316 |
| ENST00000264645 | CASC3 | chr17 | 38325699 | + | ENST00000585291 | NFE2L1 | chr17 | 46133747 | + | 5879 | 2314 | 172 | 4032 | 1286 |
| ENST00000264645 | CASC3 | chr17 | 38325699 | + | ENST00000357480 | NFE2L1 | chr17 | 46133747 | + | 5871 | 2314 | 172 | 4032 | 1286 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000264645 | ENST00000362042 | CASC3 | chr17 | 38325699 | + | NFE2L1 | chr17 | 46133747 | + | 0.001436599 | 0.99856347 |
| ENST00000264645 | ENST00000585291 | CASC3 | chr17 | 38325699 | + | NFE2L1 | chr17 | 46133747 | + | 0.001407767 | 0.9985922 |
| ENST00000264645 | ENST00000357480 | CASC3 | chr17 | 38325699 | + | NFE2L1 | chr17 | 46133747 | + | 0.00142782 | 0.9985721 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for CASC3-NFE2L1 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| CASC3 | chr17 | 38325699 | NFE2L1 | chr17 | 46133747 | 2314 | 1026 | EEEFDSDSGLSLDSSHSPSSLSSSEG |
| CASC3 | chr17 | 38325699 | NFE2L1 | chr17 | 46133747 | 2314 | 714 | TPQPVTIKPPPPEDIDLIDILWRQDI |
| CASC3 | chr17 | 38325699 | NFE2L1 | chr17 | 46133747 | 2314 | 996 | EEEFDSDSGLSLDSSHSPSSLSSSEG |
Top |
Potential FusionNeoAntigen Information of CASC3-NFE2L1 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| CASC3-NFE2L1_38325699_46133747.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | HLA-B14:03 | DSSHSPSSL | 0.9302 | 0.8839 | 12 | 21 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | HLA-C05:09 | SLDSSHSPSSL | 1 | 0.8774 | 10 | 21 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | HLA-C08:15 | SLDSSHSPSSL | 1 | 0.9687 | 10 | 21 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | HLA-A02:07 | SLDSSHSPSSL | 0.9031 | 0.6071 | 10 | 21 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | HLA-C04:03 | SLDSSHSPSSL | 1 | 0.8575 | 10 | 21 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | HLA-C05:01 | SLDSSHSPSSL | 1 | 0.8774 | 10 | 21 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | HLA-C08:02 | SLDSSHSPSSL | 1 | 0.9687 | 10 | 21 |
Top |
Potential FusionNeoAntigen Information of CASC3-NFE2L1 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| CASC3-NFE2L1_38325699_46133747.msa |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB1-0338 | EEEFDSDSGLSLDSS | 0 | 15 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0101 | EEEFDSDSGLSLDSS | 0 | 15 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0101 | EEFDSDSGLSLDSSH | 1 | 16 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0104 | EEEFDSDSGLSLDSS | 0 | 15 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0104 | EEFDSDSGLSLDSSH | 1 | 16 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0105 | EEEFDSDSGLSLDSS | 0 | 15 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0105 | EEFDSDSGLSLDSSH | 1 | 16 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0108 | EEEFDSDSGLSLDSS | 0 | 15 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0108 | EEFDSDSGLSLDSSH | 1 | 16 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0109 | EEEFDSDSGLSLDSS | 0 | 15 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0109 | EEFDSDSGLSLDSSH | 1 | 16 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0111 | EEEFDSDSGLSLDSS | 0 | 15 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0111 | EEFDSDSGLSLDSSH | 1 | 16 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0112 | EEEFDSDSGLSLDSS | 0 | 15 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0112 | EEFDSDSGLSLDSSH | 1 | 16 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0113 | EEEFDSDSGLSLDSS | 0 | 15 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0113 | EEFDSDSGLSLDSSH | 1 | 16 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0114 | EEEFDSDSGLSLDSS | 0 | 15 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0114 | EEFDSDSGLSLDSSH | 1 | 16 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0209 | EEEFDSDSGLSLDSS | 0 | 15 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0221 | EEEFDSDSGLSLDSS | 0 | 15 |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 | DRB3-0303 | EEEFDSDSGLSLDSS | 0 | 15 |
Top |
Fusion breakpoint peptide structures of CASC3-NFE2L1 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 1402 | DSGLSLDSSHSPSS | CASC3 | NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 2314 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CASC3-NFE2L1 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 1402 | DSGLSLDSSHSPSS | -7.93879 | -8.05059 |
| HLA-B14:02 | 3BVN | 1402 | DSGLSLDSSHSPSS | -5.56758 | -6.61068 |
| HLA-B52:01 | 3W39 | 1402 | DSGLSLDSSHSPSS | -6.43169 | -6.54349 |
| HLA-B52:01 | 3W39 | 1402 | DSGLSLDSSHSPSS | -3.1971 | -4.2402 |
| HLA-A11:01 | 4UQ2 | 1402 | DSGLSLDSSHSPSS | -3.71647 | -3.82827 |
| HLA-A24:02 | 5HGA | 1402 | DSGLSLDSSHSPSS | -7.93545 | -8.04725 |
| HLA-A24:02 | 5HGA | 1402 | DSGLSLDSSHSPSS | -5.70699 | -6.75009 |
| HLA-B44:05 | 3DX8 | 1402 | DSGLSLDSSHSPSS | -4.01788 | -4.12968 |
| HLA-B44:05 | 3DX8 | 1402 | DSGLSLDSSHSPSS | -3.8031 | -4.8462 |
Top |
Vaccine Design for the FusionNeoAntigens of CASC3-NFE2L1 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 10 | 21 | SLDSSHSPSSL | CCACCTGAGGACATAGATCTGATTGACATCCTT |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 12 | 21 | DSSHSPSSL | GAGGACATAGATCTGATTGACATCCTT |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 0 | 15 | EEEFDSDSGLSLDSS | ACTCCCCAGCCAGTCACCATCAAGCCCCCTCCACCTGAGGACATA |
| CASC3-NFE2L1 | chr17 | 38325699 | chr17 | 46133747 | 1 | 16 | EEFDSDSGLSLDSSH | CCCCAGCCAGTCACCATCAAGCCCCCTCCACCTGAGGACATAGAT |
Top |
Information of the samples that have these potential fusion neoantigens of CASC3-NFE2L1 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| ESCA | CASC3-NFE2L1 | chr17 | 38325699 | ENST00000264645 | chr17 | 46133747 | ENST00000357480 | TCGA-V5-A7RE |
Top |
Potential target of CAR-T therapy development for CASC3-NFE2L1 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to CASC3-NFE2L1 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to CASC3-NFE2L1 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies