Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CC2D1A-ZMYND8

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CC2D1A-ZMYND8
	FusionPDB ID: 13504
	FusionGDB2.0 ID: 13504
		Hgene	Tgene
	Gene symbol	CC2D1A	ZMYND8
	Gene ID	54862	23613
	Gene name	coiled-coil and C2 domain containing 1A	zinc finger MYND-type containing 8
	Synonyms	FREUD-1\|Freud-1/Aki1\|MRT3	PRKCBP1\|PRO2893\|RACK7
	Cytomap	19p13.12	20q13.12
	Type of gene	protein-coding	protein-coding
	Description	coiled-coil and C2 domain-containing protein 1AAkt kinase-interacting protein 1FRE under dual repression-binding protein 1five prime repressor element under dual repression-binding protein 1five repressor element under dual repression-binding protein	protein kinase C-binding protein 1CTCL tumor antigen se14-3cutaneous T-cell lymphoma-associated antigen se14-3predicted protein of HQ2893zinc finger MYND domain-containing protein 8
	Modification date	20200313	20200313
	UniProtAcc	Q6P1N0 Main function of 5'-partner protein: FUNCTION: Transcription factor that binds specifically to the DRE (dual repressor element) and represses HTR1A gene transcription in neuronal cells. The combination of calcium and ATP specifically inactivates the binding with FRE. May play a role in the altered regulation of HTR1A associated with anxiety and major depression. Mediates HDAC-independent repression of HTR1A promoter in neuronal cell. Performs essential function in controlling functional maturation of synapses (By similarity). Plays distinct roles depending on its localization. When cytoplasmic, acts as a scaffold protein in the PI3K/PDK1/AKT pathway. Repressor of HTR1A when nuclear. In the centrosome, regulates spindle pole localization of the cohesin subunit SCC1/RAD21, thereby mediating centriole cohesion during mitosis. {ECO:0000250, ECO:0000269\|PubMed:20171170}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000318003, ENST00000589606,	ENST00000468376, ENST00000262975, ENST00000311275, ENST00000352431, ENST00000355972, ENST00000360911, ENST00000372023, ENST00000396281, ENST00000446994, ENST00000458360, ENST00000461685, ENST00000471951, ENST00000536340, ENST00000540497,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	10 X 10 X 7=700	10 X 12 X 6=720
	# samples	12	13
	** MAII score	log2(12/700*10)=-2.54432051622381 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(13/720*10)=-2.46948528330122 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: CC2D1A [Title/Abstract] AND ZMYND8 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CC2D1A [Title/Abstract] AND ZMYND8 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CC2D1A(14030015)-ZMYND8(45938948), # samples:3
Anticipated loss of major functional domain due to fusion event.	CC2D1A-ZMYND8 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CC2D1A-ZMYND8 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CC2D1A-ZMYND8 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CC2D1A-ZMYND8 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:14030015/chr20:45938948)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CC2D1A (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ZMYND8 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000318003	CC2D1A	chr19	14030015	+	ENST00000311275	ZMYND8	chr20	45938948	-	6546	1463	235	4998	1587
ENST00000318003	CC2D1A	chr19	14030015	+	ENST00000360911	ZMYND8	chr20	45938948	-	6333	1463	235	4785	1516
ENST00000318003	CC2D1A	chr19	14030015	+	ENST00000458360	ZMYND8	chr20	45938948	-	5057	1463	235	4542	1435
ENST00000318003	CC2D1A	chr19	14030015	+	ENST00000262975	ZMYND8	chr20	45938948	-	5293	1463	235	4944	1569
ENST00000318003	CC2D1A	chr19	14030015	+	ENST00000471951	ZMYND8	chr20	45938948	-	5404	1463	235	5082	1615
ENST00000318003	CC2D1A	chr19	14030015	+	ENST00000352431	ZMYND8	chr20	45938948	-	5181	1463	235	4860	1541
ENST00000318003	CC2D1A	chr19	14030015	+	ENST00000396281	ZMYND8	chr20	45938948	-	5225	1463	235	4923	1562
ENST00000318003	CC2D1A	chr19	14030015	+	ENST00000446994	ZMYND8	chr20	45938948	-	4812	1463	235	4755	1506
ENST00000318003	CC2D1A	chr19	14030015	+	ENST00000536340	ZMYND8	chr20	45938948	-	5139	1463	235	5082	1615
ENST00000318003	CC2D1A	chr19	14030015	+	ENST00000355972	ZMYND8	chr20	45938948	-	5139	1463	235	5082	1615
ENST00000318003	CC2D1A	chr19	14030015	+	ENST00000540497	ZMYND8	chr20	45938948	-	4783	1463	235	4782	1516
ENST00000318003	CC2D1A	chr19	14030015	+	ENST00000461685	ZMYND8	chr20	45938948	-	4945	1463	235	4944	1570
ENST00000318003	CC2D1A	chr19	14030015	+	ENST00000372023	ZMYND8	chr20	45938948	-	4789	1463	235	4788	1518
ENST00000589606	CC2D1A	chr19	14030015	+	ENST00000311275	ZMYND8	chr20	45938948	-	6305	1222	0	4757	1585
ENST00000589606	CC2D1A	chr19	14030015	+	ENST00000360911	ZMYND8	chr20	45938948	-	6092	1222	0	4544	1514
ENST00000589606	CC2D1A	chr19	14030015	+	ENST00000458360	ZMYND8	chr20	45938948	-	4816	1222	0	4301	1433
ENST00000589606	CC2D1A	chr19	14030015	+	ENST00000262975	ZMYND8	chr20	45938948	-	5052	1222	0	4703	1567
ENST00000589606	CC2D1A	chr19	14030015	+	ENST00000471951	ZMYND8	chr20	45938948	-	5163	1222	0	4841	1613
ENST00000589606	CC2D1A	chr19	14030015	+	ENST00000352431	ZMYND8	chr20	45938948	-	4940	1222	0	4619	1539
ENST00000589606	CC2D1A	chr19	14030015	+	ENST00000396281	ZMYND8	chr20	45938948	-	4984	1222	0	4682	1560
ENST00000589606	CC2D1A	chr19	14030015	+	ENST00000446994	ZMYND8	chr20	45938948	-	4571	1222	0	4514	1504
ENST00000589606	CC2D1A	chr19	14030015	+	ENST00000536340	ZMYND8	chr20	45938948	-	4898	1222	0	4841	1613
ENST00000589606	CC2D1A	chr19	14030015	+	ENST00000355972	ZMYND8	chr20	45938948	-	4898	1222	0	4841	1613
ENST00000589606	CC2D1A	chr19	14030015	+	ENST00000540497	ZMYND8	chr20	45938948	-	4542	1222	0	4541	1513
ENST00000589606	CC2D1A	chr19	14030015	+	ENST00000461685	ZMYND8	chr20	45938948	-	4704	1222	0	4703	1567
ENST00000589606	CC2D1A	chr19	14030015	+	ENST00000372023	ZMYND8	chr20	45938948	-	4548	1222	0	4547	1515

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000318003	ENST00000311275	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.002173052	0.9978269
ENST00000318003	ENST00000360911	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.001520292	0.99847966
ENST00000318003	ENST00000458360	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.003831165	0.9961688
ENST00000318003	ENST00000262975	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.004651177	0.9953489
ENST00000318003	ENST00000471951	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.005139958	0.99486005
ENST00000318003	ENST00000352431	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.003656407	0.99634355
ENST00000318003	ENST00000396281	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.005430188	0.99456984
ENST00000318003	ENST00000446994	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.00669546	0.99330455
ENST00000318003	ENST00000536340	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.006775352	0.9932247
ENST00000318003	ENST00000355972	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.006775352	0.9932247
ENST00000318003	ENST00000540497	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.007141856	0.9928582
ENST00000318003	ENST00000461685	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.007033649	0.9929664
ENST00000318003	ENST00000372023	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.003821933	0.99617803
ENST00000589606	ENST00000311275	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.001609756	0.9983903
ENST00000589606	ENST00000360911	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.001066062	0.998934
ENST00000589606	ENST00000458360	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.00276012	0.9972398
ENST00000589606	ENST00000262975	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.003425253	0.99657476
ENST00000589606	ENST00000471951	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.003872771	0.9961273
ENST00000589606	ENST00000352431	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.002696618	0.99730337
ENST00000589606	ENST00000396281	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.004114837	0.9958852
ENST00000589606	ENST00000446994	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.004912549	0.99508744
ENST00000589606	ENST00000536340	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.005134883	0.9948651
ENST00000589606	ENST00000355972	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.005134883	0.9948651
ENST00000589606	ENST00000540497	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.005393984	0.9946061
ENST00000589606	ENST00000461685	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.005237249	0.9947627
ENST00000589606	ENST00000372023	CC2D1A	chr19	14030015	+	ZMYND8	chr20	45938948	-	0.002836971	0.997163

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CC2D1A-ZMYND8

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CC2D1A	chr19	14030015	ZMYND8	chr20	45938948	1222	407	GRAVDVAELPVPPDPGSAERTAQKRK
CC2D1A	chr19	14030015	ZMYND8	chr20	45938948	1463	409	GRAVDVAELPVPPDPGSAERTAQKRK

Top

Potential FusionNeoAntigen Information of CC2D1A-ZMYND8 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CC2D1A-ZMYND8_14030015_45938948.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B45:01	AELPVPPDP	0.9883	0.9875	6	15
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B50:02	AELPVPPDP	0.9821	0.8059	6	15
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B41:01	AELPVPPDP	0.4211	0.9879	6	15
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B50:01	AELPVPPDP	0.3976	0.9342	6	15
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B56:01	LPVPPDPGSA	0.9726	0.6848	8	18
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B55:01	LPVPPDPGSA	0.9485	0.5791	8	18
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B54:01	LPVPPDPGS	0.9799	0.8163	8	17
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B40:06	AELPVPPDP	0.9711	0.9493	6	15
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B54:01	LPVPPDPGSA	0.9952	0.8924	8	18
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B56:04	LPVPPDPGSA	0.8547	0.8322	8	18
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B78:01	LPVPPDPGSA	0.619	0.7207	8	18
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B55:02	LPVPPDPGS	0.8301	0.5758	8	17
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B50:05	AELPVPPDP	0.3976	0.9342	6	15
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B50:04	AELPVPPDP	0.3976	0.9342	6	15
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B55:02	LPVPPDPGSA	0.9763	0.7613	8	18
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B56:02	LPVPPDPGSA	0.8547	0.8322	8	18
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B56:05	LPVPPDPGSA	0.8405	0.6393	8	18
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	HLA-B78:02	LPVPPDPGSA	0.5939	0.7589	8	18

Top

Potential FusionNeoAntigen Information of CC2D1A-ZMYND8 in HLA II

CC2D1A-ZMYND8_14030015_45938948.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	DRB1-0411	AVDVAELPVPPDPGS	2	17
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	DRB1-0411	RAVDVAELPVPPDPG	1	16
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	DRB1-0467	AVDVAELPVPPDPGS	2	17
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	DRB1-0467	RAVDVAELPVPPDPG	1	16
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	DRB1-0491	AVDVAELPVPPDPGS	2	17
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1463	DRB1-0491	RAVDVAELPVPPDPG	1	16

Top

Fusion breakpoint peptide structures of CC2D1A-ZMYND8

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
162	AELPVPPDPGSAER	CC2D1A	ZMYND8	chr19	14030015	chr20	45938948	1463

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CC2D1A-ZMYND8

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	162	AELPVPPDPGSAER	-4.98419	-5.17619
HLA-B14:02	3BVN	162	AELPVPPDPGSAER	-3.82803	-4.58903
HLA-B52:01	3W39	162	AELPVPPDPGSAER	-7.13483	-7.32683
HLA-B52:01	3W39	162	AELPVPPDPGSAER	-4.52031	-5.28131
HLA-A24:02	5HGA	162	AELPVPPDPGSAER	-8.1238	-8.3158
HLA-A24:02	5HGA	162	AELPVPPDPGSAER	-5.63898	-6.39998
HLA-B44:05	3DX8	162	AELPVPPDPGSAER	-5.10902	-5.87002
HLA-B44:05	3DX8	162	AELPVPPDPGSAER	-3.5494	-3.7414

Top

Vaccine Design for the FusionNeoAntigens of CC2D1A-ZMYND8

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	6	15	AELPVPPDP	CTGAATTGCCCGTGCCCCCAGATCCTG
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	8	17	LPVPPDPGS	TGCCCGTGCCCCCAGATCCTGGCTCTG
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	8	18	LPVPPDPGSA	TGCCCGTGCCCCCAGATCCTGGCTCTGCAG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	1	16	RAVDVAELPVPPDPG	GAGCCGTGGATGTCGCTGAATTGCCCGTGCCCCCAGATCCTGGCT
CC2D1A-ZMYND8	chr19	14030015	chr20	45938948	2	17	AVDVAELPVPPDPGS	CCGTGGATGTCGCTGAATTGCCCGTGCCCCCAGATCCTGGCTCTG

Top

Information of the samples that have these potential fusion neoantigens of CC2D1A-ZMYND8

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
PCPG	CC2D1A-ZMYND8	chr19	14030015	ENST00000318003	chr20	45938948	ENST00000262975	TCGA-WB-A818-01A

Top

Potential target of CAR-T therapy development for CC2D1A-ZMYND8

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CC2D1A-ZMYND8

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CC2D1A-ZMYND8

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)