![]() |
|||||||
|
Fusion Protein:CD55-MPC2 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: CD55-MPC2 | FusionPDB ID: 14554 | FusionGDB2.0 ID: 14554 | Hgene | Tgene | Gene symbol | CD55 | MPC2 | Gene ID | 1604 | 25874 |
Gene name | CD55 molecule (Cromer blood group) | mitochondrial pyruvate carrier 2 | |
Synonyms | CHAPLE|CR|CROM|DAF|TC | BRP44|SLC54A2 | |
Cytomap | 1q32.2 | 1q24.2 | |
Type of gene | protein-coding | protein-coding | |
Description | complement decay-accelerating factorCD55 antigenCD55 molecule, decay accelerating factor for complement (Cromer blood group)Cromer blood group antigen | mitochondrial pyruvate carrier 2brain protein 44 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | P08174 Main function of 5'-partner protein: FUNCTION: This protein recognizes C4b and C3b fragments that condense with cell-surface hydroxyl or amino groups when nascent C4b and C3b are locally generated during C4 and c3 activation. Interaction of daf with cell-associated C4b and C3b polypeptides interferes with their ability to catalyze the conversion of C2 and factor B to enzymatically active C2a and Bb and thereby prevents the formation of C4b2a and C3bBb, the amplification convertases of the complement cascade (PubMed:7525274). Inhibits complement activation by destabilizing and preventing the formation of C3 and C5 convertases, which prevents complement damage (PubMed:28657829). {ECO:0000269|PubMed:7525274, ECO:0000305|PubMed:28657829}.; FUNCTION: (Microbial infection) Acts as a receptor for Coxsackievirus A21, coxsackieviruses B1, B3 and B5. {ECO:0000269|PubMed:9151867}.; FUNCTION: (Microbial infection) Acts as a receptor for Human enterovirus 70 and D68 (Probable). {ECO:0000269|PubMed:8764022}.; FUNCTION: (Microbial infection) Acts as a receptor for Human echoviruses 6, 7, 11, 12, 20 and 21. {ECO:0000269|PubMed:7525274, ECO:0000305|PubMed:12409401}. | O95563 Main function of 5'-partner protein: FUNCTION: Mediates the uptake of pyruvate into mitochondria. {ECO:0000269|PubMed:22628558}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000367067, ENST00000465534, ENST00000314754, ENST00000367062, ENST00000367063, ENST00000367064, ENST00000367065, ENST00000391920, ENST00000391921, | ENST00000271373, ENST00000367846, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 8 X 5 X 7=280 | 7 X 5 X 6=210 |
# samples | 9 | 7 | |
** MAII score | log2(9/280*10)=-1.63742992061529 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(7/210*10)=-1.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: CD55 [Title/Abstract] AND MPC2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: CD55 [Title/Abstract] AND MPC2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | CD55(207500182)-MPC2(167889328), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | CD55-MPC2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CD55-MPC2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CD55-MPC2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CD55-MPC2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | CD55 | GO:0007204 | positive regulation of cytosolic calcium ion concentration | 8223854 |
Hgene | CD55 | GO:0030449 | regulation of complement activation | 25284781 |
Hgene | CD55 | GO:0031664 | regulation of lipopolysaccharide-mediated signaling pathway | 12731067 |
Hgene | CD55 | GO:0035743 | CD4-positive, alpha-beta T cell cytokine production | 16818763 |
Hgene | CD55 | GO:0045916 | negative regulation of complement activation | 6211481 |
Hgene | CD55 | GO:1903659 | regulation of complement-dependent cytotoxicity | 25284781 |
Hgene | CD55 | GO:2000516 | positive regulation of CD4-positive, alpha-beta T cell activation | 16818763 |
Hgene | CD55 | GO:2000563 | positive regulation of CD4-positive, alpha-beta T cell proliferation | 16818763 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:207500182/chr1:167889328) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000367064 | CD55 | chr1 | 207500182 | + | ENST00000367846 | MPC2 | chr1 | 167889328 | - | 2665 | 922 | 81 | 1070 | 329 |
ENST00000367064 | CD55 | chr1 | 207500182 | + | ENST00000271373 | MPC2 | chr1 | 167889328 | - | 1326 | 922 | 81 | 1070 | 329 |
ENST00000367063 | CD55 | chr1 | 207500182 | + | ENST00000367846 | MPC2 | chr1 | 167889328 | - | 2641 | 898 | 57 | 1046 | 329 |
ENST00000367063 | CD55 | chr1 | 207500182 | + | ENST00000271373 | MPC2 | chr1 | 167889328 | - | 1302 | 898 | 57 | 1046 | 329 |
ENST00000391921 | CD55 | chr1 | 207500182 | + | ENST00000367846 | MPC2 | chr1 | 167889328 | - | 2338 | 595 | 42 | 743 | 233 |
ENST00000391921 | CD55 | chr1 | 207500182 | + | ENST00000271373 | MPC2 | chr1 | 167889328 | - | 999 | 595 | 42 | 743 | 233 |
ENST00000314754 | CD55 | chr1 | 207500182 | + | ENST00000367846 | MPC2 | chr1 | 167889328 | - | 2472 | 729 | 65 | 877 | 270 |
ENST00000314754 | CD55 | chr1 | 207500182 | + | ENST00000271373 | MPC2 | chr1 | 167889328 | - | 1133 | 729 | 65 | 877 | 270 |
ENST00000391920 | CD55 | chr1 | 207500182 | + | ENST00000367846 | MPC2 | chr1 | 167889328 | - | 2425 | 682 | 18 | 830 | 270 |
ENST00000391920 | CD55 | chr1 | 207500182 | + | ENST00000271373 | MPC2 | chr1 | 167889328 | - | 1086 | 682 | 18 | 830 | 270 |
ENST00000367062 | CD55 | chr1 | 207500182 | + | ENST00000367846 | MPC2 | chr1 | 167889328 | - | 2425 | 682 | 18 | 830 | 270 |
ENST00000367062 | CD55 | chr1 | 207500182 | + | ENST00000271373 | MPC2 | chr1 | 167889328 | - | 1086 | 682 | 18 | 830 | 270 |
ENST00000367065 | CD55 | chr1 | 207500182 | + | ENST00000367846 | MPC2 | chr1 | 167889328 | - | 2425 | 682 | 18 | 830 | 270 |
ENST00000367065 | CD55 | chr1 | 207500182 | + | ENST00000271373 | MPC2 | chr1 | 167889328 | - | 1086 | 682 | 18 | 830 | 270 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000367064 | ENST00000367846 | CD55 | chr1 | 207500182 | + | MPC2 | chr1 | 167889328 | - | 0.003323711 | 0.9966763 |
ENST00000367064 | ENST00000271373 | CD55 | chr1 | 207500182 | + | MPC2 | chr1 | 167889328 | - | 0.004987376 | 0.9950126 |
ENST00000367063 | ENST00000367846 | CD55 | chr1 | 207500182 | + | MPC2 | chr1 | 167889328 | - | 0.003318719 | 0.9966813 |
ENST00000367063 | ENST00000271373 | CD55 | chr1 | 207500182 | + | MPC2 | chr1 | 167889328 | - | 0.005525873 | 0.9944741 |
ENST00000391921 | ENST00000367846 | CD55 | chr1 | 207500182 | + | MPC2 | chr1 | 167889328 | - | 0.01472357 | 0.9852764 |
ENST00000391921 | ENST00000271373 | CD55 | chr1 | 207500182 | + | MPC2 | chr1 | 167889328 | - | 0.021463605 | 0.9785364 |
ENST00000314754 | ENST00000367846 | CD55 | chr1 | 207500182 | + | MPC2 | chr1 | 167889328 | - | 0.002886269 | 0.9971137 |
ENST00000314754 | ENST00000271373 | CD55 | chr1 | 207500182 | + | MPC2 | chr1 | 167889328 | - | 0.003508338 | 0.9964916 |
ENST00000391920 | ENST00000367846 | CD55 | chr1 | 207500182 | + | MPC2 | chr1 | 167889328 | - | 0.002786429 | 0.99721354 |
ENST00000391920 | ENST00000271373 | CD55 | chr1 | 207500182 | + | MPC2 | chr1 | 167889328 | - | 0.003619621 | 0.9963804 |
ENST00000367062 | ENST00000367846 | CD55 | chr1 | 207500182 | + | MPC2 | chr1 | 167889328 | - | 0.002786429 | 0.99721354 |
ENST00000367062 | ENST00000271373 | CD55 | chr1 | 207500182 | + | MPC2 | chr1 | 167889328 | - | 0.003619621 | 0.9963804 |
ENST00000367065 | ENST00000367846 | CD55 | chr1 | 207500182 | + | MPC2 | chr1 | 167889328 | - | 0.002786429 | 0.99721354 |
ENST00000367065 | ENST00000271373 | CD55 | chr1 | 207500182 | + | MPC2 | chr1 | 167889328 | - | 0.003619621 | 0.9963804 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for CD55-MPC2 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
CD55 | chr1 | 207500182 | MPC2 | chr1 | 167889328 | 595 | 184 | SSVQWSDPLPECRGFIWSRYSLVIIP |
CD55 | chr1 | 207500182 | MPC2 | chr1 | 167889328 | 682 | 221 | SSVQWSDPLPECRGFIWSRYSLVIIP |
CD55 | chr1 | 207500182 | MPC2 | chr1 | 167889328 | 729 | 221 | SSVQWSDPLPECRGFIWSRYSLVIIP |
CD55 | chr1 | 207500182 | MPC2 | chr1 | 167889328 | 898 | 280 | SSVQWSDPLPECRGFIWSRYSLVIIP |
CD55 | chr1 | 207500182 | MPC2 | chr1 | 167889328 | 922 | 280 | SSVQWSDPLPECRGFIWSRYSLVIIP |
Top |
Potential FusionNeoAntigen Information of CD55-MPC2 in HLA I |
![]() |
CD55-MPC2_207500182_167889328.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
CD55-MPC2 | chr1 | 207500182 | chr1 | 167889328 | 729 | HLA-B35:24 | DPLPECRGF | 0.9802 | 0.8516 | 6 | 15 |
CD55-MPC2 | chr1 | 207500182 | chr1 | 167889328 | 729 | HLA-B35:23 | DPLPECRGF | 0.9696 | 0.7985 | 6 | 15 |
CD55-MPC2 | chr1 | 207500182 | chr1 | 167889328 | 729 | HLA-B18:07 | DPLPECRGF | 0.4361 | 0.8133 | 6 | 15 |
Top |
Potential FusionNeoAntigen Information of CD55-MPC2 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of CD55-MPC2 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
1312 | DPLPECRGFIWSRY | CD55 | MPC2 | chr1 | 207500182 | chr1 | 167889328 | 729 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CD55-MPC2 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 1312 | DPLPECRGFIWSRY | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 1312 | DPLPECRGFIWSRY | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 1312 | DPLPECRGFIWSRY | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 1312 | DPLPECRGFIWSRY | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 1312 | DPLPECRGFIWSRY | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 1312 | DPLPECRGFIWSRY | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 1312 | DPLPECRGFIWSRY | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 1312 | DPLPECRGFIWSRY | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 1312 | DPLPECRGFIWSRY | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 1312 | DPLPECRGFIWSRY | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 1312 | DPLPECRGFIWSRY | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of CD55-MPC2 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
CD55-MPC2 | chr1 | 207500182 | chr1 | 167889328 | 6 | 15 | DPLPECRGF | ACCCGTTGCCAGAGTGCAGAGGGTTTA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of CD55-MPC2 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
STAD | CD55-MPC2 | chr1 | 207500182 | ENST00000314754 | chr1 | 167889328 | ENST00000271373 | TCGA-HU-A4GH-01A |
Top |
Potential target of CAR-T therapy development for CD55-MPC2 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | MPC2 | chr1:207500182 | chr1:167889328 | ENST00000271373 | 3 | 6 | 96_115 | 0 | 128.0 | Transmembrane | Helical | |
Tgene | MPC2 | chr1:207500182 | chr1:167889328 | ENST00000367846 | 2 | 5 | 96_115 | 0 | 128.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to CD55-MPC2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to CD55-MPC2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |