Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CHCHD3-CYP51A1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CHCHD3-CYP51A1
	FusionPDB ID: 16235
	FusionGDB2.0 ID: 16235
		Hgene	Tgene
	Gene symbol	CHCHD3	CYP51A1
	Gene ID	54927	1595
	Gene name	coiled-coil-helix-coiled-coil-helix domain containing 3	cytochrome P450 family 51 subfamily A member 1
	Synonyms	MICOS19\|MINOS3\|Mic19\|PPP1R22	CP51\|CYP51\|CYPL1\|LDM\|P450-14DM\|P450L1
	Cytomap	7q32.3-q33	7q21.2
	Type of gene	protein-coding	protein-coding
	Description	MICOS complex subunit MIC19coiled-coil-helix-coiled-coil-helix domain-containing protein 3, mitochondrialmitochondrial contact site and cristae organizing system subunit 19mitochondrial inner membrane organizing system 3protein phosphatase 1, regulato	lanosterol 14-alpha demethylaseCYPLIcytochrome P450 51A1cytochrome P450, 51 (lanosterol 14-alpha-demethylase)cytochrome P450, family 51, subfamily A, polypeptide 1cytochrome P450-14DMcytochrome P45014DMcytochrome P450LIsterol 14-alpha demethylase
	Modification date	20200327	20200313
	UniProtAcc	Q9NX63 Main function of 5'-partner protein: FUNCTION: Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane. Has also been shown to function as a transcription factor which binds to the BAG1 promoter and represses BAG1 transcription. Plays an important role in the maintenance of the MICOS complex stability and the mitochondrial cristae morphology (PubMed:25781180). {ECO:0000269\|PubMed:22567091, ECO:0000269\|PubMed:25781180}.	Q16850 Main function of 5'-partner protein: FUNCTION: A cytochrome P450 monooxygenase involved in sterol biosynthesis. Catalyzes 14-alpha demethylation of lanosterol and 24,25-dihydrolanosterol likely through sequential oxidative conversion of 14-alpha methyl group to hydroxymethyl, then to carboxylaldehyde, followed by the formation of the delta 14,15 double bond in the sterol core and concomitant release of formic acid (PubMed:20149798, PubMed:8619637). Mechanistically, uses molecular oxygen inserting one oxygen atom into a substrate, and reducing the second into a water molecule, with two electrons provided by NADPH via cytochrome P450 reductase (CPR; NADPH-ferrihemoprotein reductase) (PubMed:20149798, PubMed:8619637). {ECO:0000269\|PubMed:20149798, ECO:0000269\|PubMed:8619637}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000262570, ENST00000448878, ENST00000476546, ENST00000542753,	ENST00000450723, ENST00000003100,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	23 X 25 X 10=5750	2 X 2 X 2=8
	# samples	31	2
	** MAII score	log2(31/5750*10)=-4.21322183544486 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(2/8*10)=1.32192809488736
Fusion gene context	PubMed: CHCHD3 [Title/Abstract] AND CYP51A1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CHCHD3 [Title/Abstract] AND CYP51A1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CHCHD3(132570422)-CYP51A1(91761186), # samples:1
Anticipated loss of major functional domain due to fusion event.	CHCHD3-CYP51A1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CHCHD3-CYP51A1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	CHCHD3	GO:0000122	negative regulation of transcription by RNA polymerase II	22567091
Tgene	CYP51A1	GO:0006694	steroid biosynthetic process	20149798

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:132570422/chr7:91761186)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CHCHD3 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CYP51A1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000262570	CHCHD3	chr7	132570422	-	ENST00000003100	CYP51A1	chr7	91761186	-	3450	598	145	1935	596
ENST00000448878	CHCHD3	chr7	132570422	-	ENST00000003100	CYP51A1	chr7	91761186	-	3437	585	117	1922	601

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000262570	ENST00000003100	CHCHD3	chr7	132570422	-	CYP51A1	chr7	91761186	-	0.00028134	0.9997186
ENST00000448878	ENST00000003100	CHCHD3	chr7	132570422	-	CYP51A1	chr7	91761186	-	0.000241879	0.99975806

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CHCHD3-CYP51A1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CHCHD3	chr7	132570422	CYP51A1	chr7	91761186	585	156	AFYKEQLARLEERKSPPYIFSPIPFL
CHCHD3	chr7	132570422	CYP51A1	chr7	91761186	598	151	AFYKEQLARLEERKSPPYIFSPIPFL

Top

Potential FusionNeoAntigen Information of CHCHD3-CYP51A1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CHCHD3-CYP51A1_132570422_91761186.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:01	EERKSPPY	0.9961	0.901	10	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B15:03	RKSPPYIF	0.9773	0.6741	12	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B27:04	ERKSPPYIF	0.9972	0.5962	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B27:05	ERKSPPYIF	0.9968	0.738	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:01	LEERKSPPY	0.9869	0.896	9	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B45:01	EERKSPPYI	0.965	0.5618	10	19
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B44:03	EERKSPPYI	0.9017	0.8728	10	19
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B38:02	ERKSPPYIF	0.6274	0.6953	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B15:18	ERKSPPYIF	0.4196	0.543	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B44:03	EERKSPPYIF	0.9862	0.7994	10	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:01	EERKSPPYIF	0.7902	0.8821	10	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B27:04	ARLEERKSPPY	0.9999	0.72	7	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B27:05	ARLEERKSPPY	0.9999	0.7572	7	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C07:27	ERKSPPYIF	0.9743	0.8993	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C07:95	ERKSPPYIF	0.9708	0.526	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C07:05	ERKSPPYIF	0.9705	0.9136	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B73:01	ARLEERKSP	0.9133	0.7465	7	16
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B27:03	ERKSPPYIF	0.8845	0.7806	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C07:29	ERKSPPYIF	0.8779	0.8265	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C07:46	ERKSPPYIF	0.8317	0.711	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C07:10	ERKSPPYIF	0.7931	0.9147	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C07:67	ERKSPPYIF	0.7894	0.8689	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C07:80	ERKSPPYIF	0.7894	0.8689	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B39:12	ERKSPPYIF	0.7859	0.6741	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B14:03	ERKSPPYIF	0.0799	0.563	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C12:16	ERKSPPYIF	0.068	0.9342	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B51:07	EERKSPPYI	0.0383	0.5823	10	19
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B27:03	ARLEERKSPPY	0.9974	0.7798	7	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:04	EERKSPPY	0.9975	0.9177	10	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:06	EERKSPPY	0.997	0.9026	10	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:07	EERKSPPY	0.9962	0.8603	10	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:05	EERKSPPY	0.9961	0.901	10	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:08	EERKSPPY	0.9951	0.8358	10	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:03	EERKSPPY	0.9918	0.894	10	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:11	EERKSPPY	0.9899	0.8025	10	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B15:68	RKSPPYIF	0.9514	0.5362	12	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B27:06	ERKSPPYIF	0.9971	0.6	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B27:10	ERKSPPYIF	0.9971	0.759	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B27:08	ERKSPPYIF	0.9968	0.541	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:04	LEERKSPPY	0.9895	0.9126	9	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:08	LEERKSPPY	0.9884	0.8313	9	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:05	LEERKSPPY	0.9869	0.896	9	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:06	LEERKSPPY	0.9859	0.9039	9	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B27:09	ERKSPPYIF	0.9814	0.6012	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:03	LEERKSPPY	0.9804	0.8886	9	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B44:07	EERKSPPYI	0.9017	0.8728	10	19
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B44:13	EERKSPPYI	0.9017	0.8728	10	19
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B44:26	EERKSPPYI	0.9017	0.8728	10	19
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C07:17	ERKSPPYIF	0.8858	0.9362	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C07:02	ERKSPPYIF	0.7894	0.8689	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:11	LEERKSPPY	0.7771	0.8657	9	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B39:31	ERKSPPYIF	0.7747	0.6639	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C07:22	ERKSPPYIF	0.6599	0.5097	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C06:08	ERKSPPYIF	0.5139	0.9734	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B15:53	LEERKSPPY	0.2943	0.7902	9	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C06:17	ERKSPPYIF	0.0796	0.9887	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-C06:02	ERKSPPYIF	0.0796	0.9887	11	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B44:26	EERKSPPYIF	0.9862	0.7994	10	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B44:07	EERKSPPYIF	0.9862	0.7994	10	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B44:13	EERKSPPYIF	0.9862	0.7994	10	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:11	EERKSPPYIF	0.8003	0.7713	10	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:05	EERKSPPYIF	0.7902	0.8821	10	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:08	EERKSPPYIF	0.7706	0.7781	10	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B18:03	EERKSPPYIF	0.7685	0.8755	10	20
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B27:10	ARLEERKSPPY	0.9999	0.8346	7	18
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	598	HLA-B27:08	ARLEERKSPPY	0.9999	0.641	7	18

Top

Potential FusionNeoAntigen Information of CHCHD3-CYP51A1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of CHCHD3-CYP51A1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4787	LARLEERKSPPYIF	CHCHD3	CYP51A1	chr7	132570422	chr7	91761186	598

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CHCHD3-CYP51A1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4787	LARLEERKSPPYIF	-8.79968	-8.91308
HLA-B14:02	3BVN	4787	LARLEERKSPPYIF	-2.93446	-3.96976
HLA-B52:01	3W39	4787	LARLEERKSPPYIF	-5.96997	-6.08337
HLA-B52:01	3W39	4787	LARLEERKSPPYIF	-4.23042	-5.26572
HLA-A11:01	4UQ2	4787	LARLEERKSPPYIF	-8.20522	-8.31862
HLA-A11:01	4UQ2	4787	LARLEERKSPPYIF	-4.67476	-5.71006
HLA-A24:02	5HGA	4787	LARLEERKSPPYIF	-9.05525	-9.16865
HLA-A24:02	5HGA	4787	LARLEERKSPPYIF	-6.47443	-7.50973
HLA-B44:05	3DX8	4787	LARLEERKSPPYIF	-6.9286	-7.042
HLA-B44:05	3DX8	4787	LARLEERKSPPYIF	-2.31135	-3.34665
HLA-A02:01	6TDR	4787	LARLEERKSPPYIF	-4.18158	-5.21688

Top

Vaccine Design for the FusionNeoAntigens of CHCHD3-CYP51A1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	10	18	EERKSPPY	GAGGAGAGGAAAAGTCCTCCATAC
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	10	19	EERKSPPYI	GAGGAGAGGAAAAGTCCTCCATACATT
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	10	20	EERKSPPYIF	GAGGAGAGGAAAAGTCCTCCATACATTTTC
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	11	20	ERKSPPYIF	GAGAGGAAAAGTCCTCCATACATTTTC
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	12	20	RKSPPYIF	AGGAAAAGTCCTCCATACATTTTC
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	7	16	ARLEERKSP	GCTAGACTGGAGGAGAGGAAAAGTCCT
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	7	18	ARLEERKSPPY	GCTAGACTGGAGGAGAGGAAAAGTCCTCCATAC
CHCHD3-CYP51A1	chr7	132570422	chr7	91761186	9	18	LEERKSPPY	CTGGAGGAGAGGAAAAGTCCTCCATAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of CHCHD3-CYP51A1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	CHCHD3-CYP51A1	chr7	132570422	ENST00000262570	chr7	91761186	ENST00000003100	TCGA-HU-A4GH-01A

Top

Potential target of CAR-T therapy development for CHCHD3-CYP51A1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

CYP51A1

chr7:132570422

chr7:91761186

ENST00000450723

24_44

405.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CHCHD3-CYP51A1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CHCHD3-CYP51A1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)