|
|||||||
|
Fusion Protein:COPS4-NFXL1 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: COPS4-NFXL1 | FusionPDB ID: 18636 | FusionGDB2.0 ID: 18636 | Hgene | Tgene | Gene symbol | COPS4 | NFXL1 | Gene ID | 51138 | 152518 |
| Gene name | COP9 signalosome subunit 4 | nuclear transcription factor, X-box binding like 1 | |
| Synonyms | CSN4|SGN4 | CDZFP|HOZFP|OZFP|URCC5 | |
| Cytomap | 4q21.22 | 4p12 | |
| Type of gene | protein-coding | protein-coding | |
| Description | COP9 signalosome complex subunit 4COP9 constitutive photomorphogenic homolog subunit 4COP9 constitutive photomorphogenic-like protein subunit 4JAB1-containing signalosome subunit 4signalosome subunit 4testis tissue sperm-binding protein Li 42a | NF-X1-type zinc finger protein NFXL1cytoplasm-distribution zinc finger proteinovarian zinc finger proteinup-regulated in colon cancer 5 | |
| Modification date | 20200327 | 20200313 | |
| UniProtAcc | Q9BT78 Main function of 5'-partner protein: FUNCTION: Component of the COP9 signalosome complex (CSN), a complex involved in various cellular and developmental processes. The CSN complex is an essential regulator of the ubiquitin (Ubl) conjugation pathway by mediating the deneddylation of the cullin subunits of SCF-type E3 ligase complexes, leading to decrease the Ubl ligase activity of SCF-type complexes such as SCF, CSA or DDB2. Also involved in the deneddylation of non-cullin subunits such as STON2. The complex is also involved in phosphorylation of p53/TP53, c-jun/JUN, IkappaBalpha/NFKBIA, ITPK1, IRF8/ICSBP and SNAPIN, possibly via its association with CK2 and PKD kinases. CSN-dependent phosphorylation of TP53 and JUN promotes and protects degradation by the Ubl system, respectively. {ECO:0000269|PubMed:11285227, ECO:0000269|PubMed:11337588, ECO:0000269|PubMed:12628923, ECO:0000269|PubMed:12732143, ECO:0000269|PubMed:21102408, ECO:0000269|PubMed:9535219}. | Q6ZNB6 Main function of 5'-partner protein: | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000511708, ENST00000264389, ENST00000503682, ENST00000509093, ENST00000511653, | ENST00000329043, ENST00000381538, ENST00000507489, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 2 X 2 X 2=8 | 3 X 3 X 3=27 |
| # samples | 2 | 3 | |
| ** MAII score | log2(2/8*10)=1.32192809488736 | log2(3/27*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
| Fusion gene context | PubMed: COPS4 [Title/Abstract] AND NFXL1 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: COPS4 [Title/Abstract] AND NFXL1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | COPS4(83966858)-NFXL1(47888016), # samples:1 NFXL1(47892630)-COPS4(83970319), # samples:2 | ||
| Anticipated loss of major functional domain due to fusion event. | COPS4-NFXL1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. COPS4-NFXL1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. COPS4-NFXL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. COPS4-NFXL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NFXL1-COPS4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NFXL1-COPS4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NFXL1-COPS4 seems lost the major protein functional domain in Hgene partner, which is a transcription factor due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | COPS4 | GO:0000338 | protein deneddylation | 19141280 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr4:83966858/chr4:47888016) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across COPS4 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across NFXL1 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000509093 | COPS4 | chr4 | 83966858 | + | ENST00000381538 | NFXL1 | chr4 | 47888016 | - | 3048 | 932 | 778 | 2124 | 448 |
| ENST00000509093 | COPS4 | chr4 | 83966858 | + | ENST00000507489 | NFXL1 | chr4 | 47888016 | - | 3045 | 932 | 778 | 2124 | 448 |
| ENST00000509093 | COPS4 | chr4 | 83966858 | + | ENST00000329043 | NFXL1 | chr4 | 47888016 | - | 1591 | 932 | 778 | 1590 | 271 |
| ENST00000264389 | COPS4 | chr4 | 83966858 | + | ENST00000381538 | NFXL1 | chr4 | 47888016 | - | 2405 | 289 | 135 | 1481 | 448 |
| ENST00000264389 | COPS4 | chr4 | 83966858 | + | ENST00000507489 | NFXL1 | chr4 | 47888016 | - | 2402 | 289 | 135 | 1481 | 448 |
| ENST00000264389 | COPS4 | chr4 | 83966858 | + | ENST00000329043 | NFXL1 | chr4 | 47888016 | - | 948 | 289 | 135 | 947 | 270 |
| ENST00000503682 | COPS4 | chr4 | 83966858 | + | ENST00000381538 | NFXL1 | chr4 | 47888016 | - | 2288 | 172 | 18 | 1364 | 448 |
| ENST00000503682 | COPS4 | chr4 | 83966858 | + | ENST00000507489 | NFXL1 | chr4 | 47888016 | - | 2285 | 172 | 18 | 1364 | 448 |
| ENST00000503682 | COPS4 | chr4 | 83966858 | + | ENST00000329043 | NFXL1 | chr4 | 47888016 | - | 831 | 172 | 18 | 830 | 270 |
| ENST00000511653 | COPS4 | chr4 | 83966858 | + | ENST00000381538 | NFXL1 | chr4 | 47888016 | - | 2270 | 154 | 0 | 1346 | 448 |
| ENST00000511653 | COPS4 | chr4 | 83966858 | + | ENST00000507489 | NFXL1 | chr4 | 47888016 | - | 2267 | 154 | 0 | 1346 | 448 |
| ENST00000511653 | COPS4 | chr4 | 83966858 | + | ENST00000329043 | NFXL1 | chr4 | 47888016 | - | 813 | 154 | 0 | 812 | 270 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000509093 | ENST00000381538 | COPS4 | chr4 | 83966858 | + | NFXL1 | chr4 | 47888016 | - | 0.000340674 | 0.9996593 |
| ENST00000509093 | ENST00000507489 | COPS4 | chr4 | 83966858 | + | NFXL1 | chr4 | 47888016 | - | 0.000339597 | 0.9996604 |
| ENST00000509093 | ENST00000329043 | COPS4 | chr4 | 83966858 | + | NFXL1 | chr4 | 47888016 | - | 0.052829817 | 0.9471702 |
| ENST00000264389 | ENST00000381538 | COPS4 | chr4 | 83966858 | + | NFXL1 | chr4 | 47888016 | - | 0.000266745 | 0.99973327 |
| ENST00000264389 | ENST00000507489 | COPS4 | chr4 | 83966858 | + | NFXL1 | chr4 | 47888016 | - | 0.000266019 | 0.999734 |
| ENST00000264389 | ENST00000329043 | COPS4 | chr4 | 83966858 | + | NFXL1 | chr4 | 47888016 | - | 0.046760757 | 0.9532392 |
| ENST00000503682 | ENST00000381538 | COPS4 | chr4 | 83966858 | + | NFXL1 | chr4 | 47888016 | - | 0.000241122 | 0.9997589 |
| ENST00000503682 | ENST00000507489 | COPS4 | chr4 | 83966858 | + | NFXL1 | chr4 | 47888016 | - | 0.000238828 | 0.99976116 |
| ENST00000503682 | ENST00000329043 | COPS4 | chr4 | 83966858 | + | NFXL1 | chr4 | 47888016 | - | 0.03372894 | 0.9662711 |
| ENST00000511653 | ENST00000381538 | COPS4 | chr4 | 83966858 | + | NFXL1 | chr4 | 47888016 | - | 0.000236241 | 0.9997638 |
| ENST00000511653 | ENST00000507489 | COPS4 | chr4 | 83966858 | + | NFXL1 | chr4 | 47888016 | - | 0.000233789 | 0.9997662 |
| ENST00000511653 | ENST00000329043 | COPS4 | chr4 | 83966858 | + | NFXL1 | chr4 | 47888016 | - | 0.02990647 | 0.9700935 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for COPS4-NFXL1 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| COPS4 | chr4 | 83966858 | NFXL1 | chr4 | 47888016 | 154 | 52 | EQLEALKAFVEASSCYPCPETVDVKC |
| COPS4 | chr4 | 83966858 | NFXL1 | chr4 | 47888016 | 172 | 52 | EQLEALKAFVEASSCYPCPETVDVKC |
| COPS4 | chr4 | 83966858 | NFXL1 | chr4 | 47888016 | 289 | 52 | EQLEALKAFVEASSCYPCPETVDVKC |
| COPS4 | chr4 | 83966858 | NFXL1 | chr4 | 47888016 | 932 | 52 | EQLEALKAFVEASSCYPCPETVDVKC |
Top |
Potential FusionNeoAntigen Information of COPS4-NFXL1 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| COPS4-NFXL1_83966858_47888016.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:02 | AFVEASSCY | 0.8655 | 0.9465 | 7 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:01 | KAFVEASSCY | 0.9995 | 0.9007 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:25 | KAFVEASSCY | 0.9993 | 0.907 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:17 | KAFVEASSCY | 0.9965 | 0.8618 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:16 | KAFVEASSCY | 0.9795 | 0.6634 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:21 | AFVEASSCY | 0.8669 | 0.9371 | 7 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:31 | AFVEASSCY | 0.7787 | 0.8773 | 7 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:07 | KAFVEASSCY | 0.9989 | 0.6367 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:05 | KAFVEASSCY | 0.9931 | 0.879 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B35:20 | AFVEASSCY | 0.7678 | 0.9093 | 7 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-C14:03 | AFVEASSCY | 0.0015 | 0.8701 | 7 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-C14:02 | AFVEASSCY | 0.0015 | 0.8701 | 7 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:27 | KAFVEASSCY | 0.9995 | 0.9113 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:33 | KAFVEASSCY | 0.9995 | 0.9007 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:125 | KAFVEASSCY | 0.9995 | 0.9007 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:34 | KAFVEASSCY | 0.9995 | 0.9007 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:135 | KAFVEASSCY | 0.9995 | 0.9067 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:39 | KAFVEASSCY | 0.9993 | 0.8408 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:50 | KAFVEASSCY | 0.999 | 0.8692 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:35 | KAFVEASSCY | 0.9989 | 0.8792 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B15:20 | KAFVEASSCY | 0.9937 | 0.9062 | 6 | 16 |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 | HLA-B35:28 | KAFVEASSCY | 0.9903 | 0.9078 | 6 | 16 |
Top |
Potential FusionNeoAntigen Information of COPS4-NFXL1 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of COPS4-NFXL1 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 4097 | KAFVEASSCYPCPE | COPS4 | NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 289 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of COPS4-NFXL1 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 4097 | KAFVEASSCYPCPE | -7.11542 | -7.22722 |
| HLA-B14:02 | 3BVN | 4097 | KAFVEASSCYPCPE | -5.65563 | -6.69873 |
| HLA-B52:01 | 3W39 | 4097 | KAFVEASSCYPCPE | -5.96618 | -6.07798 |
| HLA-B52:01 | 3W39 | 4097 | KAFVEASSCYPCPE | -4.02939 | -5.07249 |
| HLA-A24:02 | 5HGA | 4097 | KAFVEASSCYPCPE | -7.80609 | -7.91789 |
| HLA-A24:02 | 5HGA | 4097 | KAFVEASSCYPCPE | -6.2765 | -7.3196 |
| HLA-B27:05 | 6PYJ | 4097 | KAFVEASSCYPCPE | -4.69227 | -5.73537 |
| HLA-B44:05 | 3DX8 | 4097 | KAFVEASSCYPCPE | -8.27492 | -8.38672 |
| HLA-B44:05 | 3DX8 | 4097 | KAFVEASSCYPCPE | -3.80966 | -4.85276 |
| HLA-A02:01 | 6TDR | 4097 | KAFVEASSCYPCPE | -8.48121 | -8.59301 |
Top |
Vaccine Design for the FusionNeoAntigens of COPS4-NFXL1 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 6 | 16 | KAFVEASSCY | TGAAAGCTTTTGTGGAAGCAAGCAGTTGCT |
| COPS4-NFXL1 | chr4 | 83966858 | chr4 | 47888016 | 7 | 16 | AFVEASSCY | AAGCTTTTGTGGAAGCAAGCAGTTGCT |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of COPS4-NFXL1 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| COAD | COPS4-NFXL1 | chr4 | 83966858 | ENST00000264389 | chr4 | 47888016 | ENST00000329043 | TCGA-AZ-6601-01A |
Top |
Potential target of CAR-T therapy development for COPS4-NFXL1 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Tgene | NFXL1 | chr4:83966858 | chr4:47888016 | ENST00000329043 | 11 | 18 | 889_906 | 0 | 734.0 | Transmembrane | Helical | |
| Tgene | NFXL1 | chr4:83966858 | chr4:47888016 | ENST00000381538 | 11 | 23 | 889_906 | 0 | 912.0 | Transmembrane | Helical | |
| Tgene | NFXL1 | chr4:83966858 | chr4:47888016 | ENST00000507489 | 11 | 23 | 889_906 | 0 | 912.0 | Transmembrane | Helical |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to COPS4-NFXL1 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to COPS4-NFXL1 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies