![]() |
|||||||
|
Fusion Protein:COX10-INPP5K |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: COX10-INPP5K | FusionPDB ID: 18753 | FusionGDB2.0 ID: 18753 | Hgene | Tgene | Gene symbol | COX10 | INPP5K | Gene ID | 1352 | 51763 |
Gene name | cytochrome c oxidase assembly factor heme A:farnesyltransferase COX10 | inositol polyphosphate-5-phosphatase K | |
Synonyms | - | MDCCAID|PPS|SKIP | |
Cytomap | 17p12 | 17p13.3 | |
Type of gene | protein-coding | protein-coding | |
Description | protoheme IX farnesyltransferase, mitochondrialCOX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferaseCOX10, heme A:farnesyltransferase cytochrome c oxidase assembly factorcytochrome c oxidase assembly homolog 10cytochrome c | inositol polyphosphate 5-phosphatase Kphosphatidylinositol-3,4,5-trisphosphate 5-phosphatasephosphatidylinositol-4,5-bisphosphate 5-phosphataseskeletal muscle and kidney-enriched inositol phosphatase | |
Modification date | 20200313 | 20200327 | |
UniProtAcc | Q12887 Main function of 5'-partner protein: FUNCTION: Converts protoheme IX and farnesyl diphosphate to heme O. {ECO:0000250}. | Q9BT40 Main function of 5'-partner protein: FUNCTION: Inositol 5-phosphatase which acts on inositol 1,4,5-trisphosphate, inositol 1,3,4,5-tetrakisphosphate, phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate (PubMed:10753883, PubMed:16824732). Has 6-fold higher affinity for phosphatidylinositol 4,5-bisphosphate than for inositol 1,4,5-trisphosphate (PubMed:10753883). Negatively regulates assembly of the actin cytoskeleton. Controls insulin-dependent glucose uptake among inositol 3,4,5-trisphosphate phosphatases; therefore, is the specific regulator for insulin signaling in skeletal muscle (By similarity). {ECO:0000250|UniProtKB:Q8C5L6, ECO:0000269|PubMed:10753883, ECO:0000269|PubMed:16824732, ECO:0000269|PubMed:28190456, ECO:0000269|PubMed:28190459}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000261643, ENST00000536205, ENST00000537334, ENST00000429152, | ENST00000320345, ENST00000397335, ENST00000406424, ENST00000421807, ENST00000542125, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 2 X 2 X 2=8 | 4 X 4 X 4=64 |
# samples | 2 | 5 | |
** MAII score | log2(2/8*10)=1.32192809488736 | log2(5/64*10)=-0.356143810225275 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: COX10 [Title/Abstract] AND INPP5K [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: COX10 [Title/Abstract] AND INPP5K [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | COX10(14063264)-INPP5K(1401416), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | COX10-INPP5K seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. COX10-INPP5K seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. COX10-INPP5K seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. COX10-INPP5K seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | INPP5K | GO:0006469 | negative regulation of protein kinase activity | 12556481 |
Tgene | INPP5K | GO:0010801 | negative regulation of peptidyl-threonine phosphorylation | 12556481 |
Tgene | INPP5K | GO:0010829 | negative regulation of glucose transmembrane transport | 12556481 |
Tgene | INPP5K | GO:0016311 | dephosphorylation | 21712384 |
Tgene | INPP5K | GO:0032869 | cellular response to insulin stimulus | 12556481 |
Tgene | INPP5K | GO:0033137 | negative regulation of peptidyl-serine phosphorylation | 12556481 |
Tgene | INPP5K | GO:0043407 | negative regulation of MAP kinase activity | 12556481 |
Tgene | INPP5K | GO:0043922 | negative regulation by host of viral transcription | 18774950 |
Tgene | INPP5K | GO:0045719 | negative regulation of glycogen biosynthetic process | 12556481 |
Tgene | INPP5K | GO:0045869 | negative regulation of single stranded viral RNA replication via double stranded DNA intermediate | 18774950 |
Tgene | INPP5K | GO:0046627 | negative regulation of insulin receptor signaling pathway | 12556481 |
Tgene | INPP5K | GO:0046855 | inositol phosphate dephosphorylation | 12536145 |
Tgene | INPP5K | GO:0046856 | phosphatidylinositol dephosphorylation | 12536145|12556481 |
Tgene | INPP5K | GO:0051497 | negative regulation of stress fiber assembly | 12556481 |
Tgene | INPP5K | GO:0051898 | negative regulation of protein kinase B signaling | 12556481 |
Tgene | INPP5K | GO:0051926 | negative regulation of calcium ion transport | 12556481 |
Tgene | INPP5K | GO:0071356 | cellular response to tumor necrosis factor | 21712384 |
Tgene | INPP5K | GO:0071364 | cellular response to epidermal growth factor stimulus | 21712384 |
Tgene | INPP5K | GO:0090315 | negative regulation of protein targeting to membrane | 12556481 |
Tgene | INPP5K | GO:0097178 | ruffle assembly | 12556481 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:14063264/chr17:1401416) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000261643 | COX10 | chr17 | 14063264 | - | ENST00000421807 | INPP5K | chr17 | 1401416 | - | 2595 | 772 | 77 | 1342 | 421 |
ENST00000261643 | COX10 | chr17 | 14063264 | - | ENST00000406424 | INPP5K | chr17 | 1401416 | - | 2557 | 772 | 77 | 1342 | 421 |
ENST00000261643 | COX10 | chr17 | 14063264 | - | ENST00000320345 | INPP5K | chr17 | 1401416 | - | 2409 | 772 | 77 | 1342 | 421 |
ENST00000261643 | COX10 | chr17 | 14063264 | - | ENST00000397335 | INPP5K | chr17 | 1401416 | - | 1599 | 772 | 77 | 1342 | 421 |
ENST00000261643 | COX10 | chr17 | 14063264 | - | ENST00000542125 | INPP5K | chr17 | 1401416 | - | 1536 | 772 | 77 | 1342 | 421 |
ENST00000536205 | COX10 | chr17 | 14063264 | - | ENST00000421807 | INPP5K | chr17 | 1401416 | - | 2395 | 572 | 453 | 1142 | 229 |
ENST00000536205 | COX10 | chr17 | 14063264 | - | ENST00000406424 | INPP5K | chr17 | 1401416 | - | 2357 | 572 | 453 | 1142 | 229 |
ENST00000536205 | COX10 | chr17 | 14063264 | - | ENST00000320345 | INPP5K | chr17 | 1401416 | - | 2209 | 572 | 453 | 1142 | 229 |
ENST00000536205 | COX10 | chr17 | 14063264 | - | ENST00000397335 | INPP5K | chr17 | 1401416 | - | 1399 | 572 | 453 | 1142 | 229 |
ENST00000536205 | COX10 | chr17 | 14063264 | - | ENST00000542125 | INPP5K | chr17 | 1401416 | - | 1336 | 572 | 453 | 1142 | 229 |
ENST00000537334 | COX10 | chr17 | 14063264 | - | ENST00000421807 | INPP5K | chr17 | 1401416 | - | 2198 | 375 | 181 | 945 | 254 |
ENST00000537334 | COX10 | chr17 | 14063264 | - | ENST00000406424 | INPP5K | chr17 | 1401416 | - | 2160 | 375 | 181 | 945 | 254 |
ENST00000537334 | COX10 | chr17 | 14063264 | - | ENST00000320345 | INPP5K | chr17 | 1401416 | - | 2012 | 375 | 181 | 945 | 254 |
ENST00000537334 | COX10 | chr17 | 14063264 | - | ENST00000397335 | INPP5K | chr17 | 1401416 | - | 1202 | 375 | 181 | 945 | 254 |
ENST00000537334 | COX10 | chr17 | 14063264 | - | ENST00000542125 | INPP5K | chr17 | 1401416 | - | 1139 | 375 | 181 | 945 | 254 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000261643 | ENST00000421807 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.009784981 | 0.99021506 |
ENST00000261643 | ENST00000406424 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.010311798 | 0.9896882 |
ENST00000261643 | ENST00000320345 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.011397108 | 0.9886029 |
ENST00000261643 | ENST00000397335 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.011146069 | 0.98885393 |
ENST00000261643 | ENST00000542125 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.012492747 | 0.9875072 |
ENST00000536205 | ENST00000421807 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.007155264 | 0.99284476 |
ENST00000536205 | ENST00000406424 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.007101742 | 0.9928982 |
ENST00000536205 | ENST00000320345 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.007750912 | 0.99224913 |
ENST00000536205 | ENST00000397335 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.007837331 | 0.99216264 |
ENST00000536205 | ENST00000542125 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.007552322 | 0.9924476 |
ENST00000537334 | ENST00000421807 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.020174382 | 0.9798257 |
ENST00000537334 | ENST00000406424 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.019659827 | 0.9803402 |
ENST00000537334 | ENST00000320345 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.021744087 | 0.9782559 |
ENST00000537334 | ENST00000397335 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.017579496 | 0.98242056 |
ENST00000537334 | ENST00000542125 | COX10 | chr17 | 14063264 | - | INPP5K | chr17 | 1401416 | - | 0.017093968 | 0.9829061 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for COX10-INPP5K |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
COX10 | chr17 | 14063264 | INPP5K | chr17 | 1401416 | 375 | 64 | NRTKNRPLVRGQISEKKRKPAWTDRI |
COX10 | chr17 | 14063264 | INPP5K | chr17 | 1401416 | 572 | 39 | NRTKNRPLVRGQISEKKRKPAWTDRI |
COX10 | chr17 | 14063264 | INPP5K | chr17 | 1401416 | 772 | 231 | NRTKNRPLVRGQISEKKRKPAWTDRI |
Top |
Potential FusionNeoAntigen Information of COX10-INPP5K in HLA I |
![]() |
COX10-INPP5K_14063264_1401416.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | HLA-A30:08 | LVRGQISEK | 0.9952 | 0.7918 | 7 | 16 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | HLA-B57:01 | ISEKKRKPAW | 0.998 | 0.8675 | 12 | 22 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | HLA-A30:08 | RPLVRGQISEK | 0.9852 | 0.6726 | 5 | 16 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | HLA-B27:14 | VRGQISEKK | 0.9796 | 0.5349 | 8 | 17 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | HLA-A30:01 | LVRGQISEK | 0.9946 | 0.8885 | 7 | 16 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | HLA-B57:10 | ISEKKRKPAW | 0.998 | 0.8675 | 12 | 22 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | HLA-B57:04 | ISEKKRKPAW | 0.9899 | 0.6375 | 12 | 22 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | HLA-B58:06 | ISEKKRKPAW | 0.9793 | 0.6808 | 12 | 22 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | HLA-A30:01 | RPLVRGQISEK | 0.985 | 0.8338 | 5 | 16 |
Top |
Potential FusionNeoAntigen Information of COX10-INPP5K in HLA II |
![]() |
COX10-INPP5K_14063264_1401416.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1102 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1103 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1103 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1103 | LVRGQISEKKRKPAW | 7 | 22 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1103 | GQISEKKRKPAWTDR | 10 | 25 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1111 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1111 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1116 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1121 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1136 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1141 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1141 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1148 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1155 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1155 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1155 | LVRGQISEKKRKPAW | 7 | 22 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1155 | GQISEKKRKPAWTDR | 10 | 25 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1159 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1159 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1163 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1163 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1163 | LVRGQISEKKRKPAW | 7 | 22 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1163 | GQISEKKRKPAWTDR | 10 | 25 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1165 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1170 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1170 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1176 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1176 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1176 | LVRGQISEKKRKPAW | 7 | 22 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1176 | GQISEKKRKPAWTDR | 10 | 25 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1185 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1185 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1185 | LVRGQISEKKRKPAW | 7 | 22 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1185 | GQISEKKRKPAWTDR | 10 | 25 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1301 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1308 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1315 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1315 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1317 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1319 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1319 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1320 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1322 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1324 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1324 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1324 | LVRGQISEKKRKPAW | 7 | 22 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1324 | GQISEKKRKPAWTDR | 10 | 25 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1335 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1351 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1352 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1353 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1353 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1357 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1357 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1359 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1363 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1363 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1364 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1368 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1369 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1370 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1372 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1375 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1375 | VRGQISEKKRKPAWT | 8 | 23 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1376 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1378 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1379 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1380 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1383 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1384 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1387 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1391 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1392 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB1-1398 | RGQISEKKRKPAWTD | 9 | 24 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB5-0106 | RPLVRGQISEKKRKP | 5 | 20 |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 | DRB5-0106 | NRPLVRGQISEKKRK | 4 | 19 |
Top |
Fusion breakpoint peptide structures of COX10-INPP5K |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
6806 | PLVRGQISEKKRKP | COX10 | INPP5K | chr17 | 14063264 | chr17 | 1401416 | 772 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of COX10-INPP5K |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 6806 | PLVRGQISEKKRKP | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 6806 | PLVRGQISEKKRKP | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 6806 | PLVRGQISEKKRKP | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 6806 | PLVRGQISEKKRKP | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 6806 | PLVRGQISEKKRKP | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 6806 | PLVRGQISEKKRKP | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 6806 | PLVRGQISEKKRKP | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 6806 | PLVRGQISEKKRKP | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 6806 | PLVRGQISEKKRKP | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 6806 | PLVRGQISEKKRKP | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 6806 | PLVRGQISEKKRKP | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of COX10-INPP5K |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 12 | 22 | ISEKKRKPAW | CAGTGAGAAAAAACGCAAGCCTGCATGGAC |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 5 | 16 | RPLVRGQISEK | ACCGCTGGTTCGTGGACAGATCAGTGAGAAAAA |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 7 | 16 | LVRGQISEK | GGTTCGTGGACAGATCAGTGAGAAAAA |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 8 | 17 | VRGQISEKK | TCGTGGACAGATCAGTGAGAAAAAACG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 10 | 25 | GQISEKKRKPAWTDR | ACAGATCAGTGAGAAAAAACGCAAGCCTGCATGGACCGATCGCAT |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 4 | 19 | NRPLVRGQISEKKRK | CAGACCGCTGGTTCGTGGACAGATCAGTGAGAAAAAACGCAAGCC |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 5 | 20 | RPLVRGQISEKKRKP | ACCGCTGGTTCGTGGACAGATCAGTGAGAAAAAACGCAAGCCTGC |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 7 | 22 | LVRGQISEKKRKPAW | GGTTCGTGGACAGATCAGTGAGAAAAAACGCAAGCCTGCATGGAC |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 8 | 23 | VRGQISEKKRKPAWT | TCGTGGACAGATCAGTGAGAAAAAACGCAAGCCTGCATGGACCGA |
COX10-INPP5K | chr17 | 14063264 | chr17 | 1401416 | 9 | 24 | RGQISEKKRKPAWTD | TGGACAGATCAGTGAGAAAAAACGCAAGCCTGCATGGACCGATCG |
Top |
Information of the samples that have these potential fusion neoantigens of COX10-INPP5K |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
CHOL | COX10-INPP5K | chr17 | 14063264 | ENST00000261643 | chr17 | 1401416 | ENST00000320345 | TCGA-W5-AA31-01A |
Top |
Potential target of CAR-T therapy development for COX10-INPP5K |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Hgene | COX10 | chr17:14063264 | chr17:1401416 | ENST00000261643 | - | 5 | 7 | 174_194 | 231 | 444.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to COX10-INPP5K |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to COX10-INPP5K |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |