![]() |
|||||||
|
Fusion Protein:CREBBP-SRL |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: CREBBP-SRL | FusionPDB ID: 19383 | FusionGDB2.0 ID: 19383 | Hgene | Tgene | Gene symbol | CREBBP | SRL | Gene ID | 1387 | 6345 |
Gene name | CREB binding protein | sarcalumenin | |
Synonyms | CBP|KAT3A|MKHK1|RSTS|RSTS1 | SAR | |
Cytomap | 16p13.3 | 16p13.3 | |
Type of gene | protein-coding | protein-coding | |
Description | CREB-binding proteinhistone lysine acetyltransferase CREBBPprotein-lysine acetyltransferase CREBBP | sarcalumenin | |
Modification date | 20200329 | 20200313 | |
UniProtAcc | Q92793 Main function of 5'-partner protein: FUNCTION: Acetylates histones, giving a specific tag for transcriptional activation (PubMed:24616510). Also acetylates non-histone proteins, like DDX21, FBL, IRF2, MAFG, NCOA3, POLR1E/PAF53 and FOXO1 (PubMed:10490106, PubMed:11154691, PubMed:12738767, PubMed:12929931, PubMed:9707565, PubMed:24207024, PubMed:28790157, PubMed:30540930). Binds specifically to phosphorylated CREB and enhances its transcriptional activity toward cAMP-responsive genes. Acts as a coactivator of ALX1. Acts as a circadian transcriptional coactivator which enhances the activity of the circadian transcriptional activators: NPAS2-ARNTL/BMAL1 and CLOCK-ARNTL/BMAL1 heterodimers (PubMed:14645221). Acetylates PCNA; acetylation promotes removal of chromatin-bound PCNA and its degradation during nucleotide excision repair (NER) (PubMed:24939902). Acetylates POLR1E/PAF53, leading to decreased association of RNA polymerase I with the rDNA promoter region and coding region (PubMed:24207024). Acetylates DDX21, thereby inhibiting DDX21 helicase activity (PubMed:28790157). Acetylates FBL, preventing methylation of 'Gln-105' of histone H2A (H2AQ104me) (PubMed:30540930). Functions as a transcriptional coactivator for SMAD4 in the TGF-beta signaling pathway (PubMed:25514493). {ECO:0000269|PubMed:10490106, ECO:0000269|PubMed:11154691, ECO:0000269|PubMed:12738767, ECO:0000269|PubMed:12929931, ECO:0000269|PubMed:14645221, ECO:0000269|PubMed:24207024, ECO:0000269|PubMed:24616510, ECO:0000269|PubMed:24939902, ECO:0000269|PubMed:25514493, ECO:0000269|PubMed:28790157, ECO:0000269|PubMed:30540930, ECO:0000269|PubMed:9707565}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000262367, ENST00000382070, | ENST00000537996, ENST00000399609, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 43 X 38 X 17=27778 | 4 X 3 X 3=36 |
# samples | 61 | 6 | |
** MAII score | log2(61/27778*10)=-5.50898967694577 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(6/36*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Fusion gene context | PubMed: CREBBP [Title/Abstract] AND SRL [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: CREBBP [Title/Abstract] AND SRL [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | CREBBP(3794895)-SRL(4254635), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | CREBBP-SRL seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CREBBP-SRL seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CREBBP-SRL seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CREBBP-SRL seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | CREBBP | GO:0000122 | negative regulation of transcription by RNA polymerase II | 21539536 |
Hgene | CREBBP | GO:0006355 | regulation of transcription, DNA-templated | 12169688 |
Hgene | CREBBP | GO:0006473 | protein acetylation | 15273251|24207024|24939902|28790157|30540930 |
Hgene | CREBBP | GO:0016573 | histone acetylation | 11742995 |
Hgene | CREBBP | GO:0018076 | N-terminal peptidyl-lysine acetylation | 12435739 |
Hgene | CREBBP | GO:0034644 | cellular response to UV | 24939902 |
Hgene | CREBBP | GO:0045893 | positive regulation of transcription, DNA-templated | 11742995 |
Hgene | CREBBP | GO:1990258 | histone glutamine methylation | 30540930 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr16:3794895/chr16:4254635) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000262367 | CREBBP | chr16 | 3794895 | - | ENST00000399609 | SRL | chr16 | 4254635 | - | 8932 | 4792 | 606 | 6152 | 1848 |
ENST00000382070 | CREBBP | chr16 | 3794895 | - | ENST00000399609 | SRL | chr16 | 4254635 | - | 8212 | 4072 | 0 | 5432 | 1810 |
ENST00000262367 | CREBBP | chr16 | 3794894 | - | ENST00000399609 | SRL | chr16 | 4254635 | - | 8932 | 4792 | 606 | 6152 | 1848 |
ENST00000382070 | CREBBP | chr16 | 3794894 | - | ENST00000399609 | SRL | chr16 | 4254635 | - | 8212 | 4072 | 0 | 5432 | 1810 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000262367 | ENST00000399609 | CREBBP | chr16 | 3794895 | - | SRL | chr16 | 4254635 | - | 0.004655395 | 0.9953446 |
ENST00000382070 | ENST00000399609 | CREBBP | chr16 | 3794895 | - | SRL | chr16 | 4254635 | - | 0.002378312 | 0.9976217 |
ENST00000262367 | ENST00000399609 | CREBBP | chr16 | 3794894 | - | SRL | chr16 | 4254635 | - | 0.004655395 | 0.9953446 |
ENST00000382070 | ENST00000399609 | CREBBP | chr16 | 3794894 | - | SRL | chr16 | 4254635 | - | 0.002378312 | 0.9976217 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for CREBBP-SRL |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
CREBBP | chr16 | 3794894 | SRL | chr16 | 4254635 | 4072 | 1358 | GRPRKENKFSAKKETEDANEEAPLRD |
CREBBP | chr16 | 3794894 | SRL | chr16 | 4254635 | 4792 | 1396 | GRPRKENKFSAKKETEDANEEAPLRD |
CREBBP | chr16 | 3794895 | SRL | chr16 | 4254635 | 4072 | 1358 | GRPRKENKFSAKKETEDANEEAPLRD |
CREBBP | chr16 | 3794895 | SRL | chr16 | 4254635 | 4792 | 1396 | GRPRKENKFSAKKETEDANEEAPLRD |
Top |
Potential FusionNeoAntigen Information of CREBBP-SRL in HLA I |
![]() |
CREBBP-SRL_3794894_4254635.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | HLA-B45:01 | KETEDANEEA | 0.9589 | 0.9192 | 12 | 22 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | HLA-B50:02 | KETEDANEEA | 0.9466 | 0.756 | 12 | 22 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | HLA-B41:01 | KETEDANEEA | 0.7574 | 0.9002 | 12 | 22 |
Top |
Potential FusionNeoAntigen Information of CREBBP-SRL in HLA II |
![]() |
CREBBP-SRL_3794894_4254635.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0801 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0801 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0801 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0801 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0803 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0803 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0803 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0803 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0805 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0805 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0805 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0807 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0807 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0808 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0808 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0808 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0808 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0811 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0811 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0811 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0811 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0814 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0814 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0814 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0814 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0816 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0816 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0816 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0816 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0818 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0818 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0823 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0823 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0823 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0823 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0826 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0826 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0826 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0826 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0827 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0827 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0827 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0827 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0829 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0829 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0832 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0832 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0833 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0833 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0833 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0833 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0835 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0835 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0835 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0835 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0836 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0836 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0836 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0836 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0837 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0837 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0838 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0838 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0838 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0838 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0839 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0839 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0839 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0839 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-0840 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1313 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1313 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1313 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1313 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1338 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1349 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1355 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1355 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1355 | RKENKFSAKKETEDA | 3 | 18 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1355 | NKFSAKKETEDANEE | 6 | 21 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1365 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1463 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1463 | KENKFSAKKETEDAN | 4 | 19 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1485 | ENKFSAKKETEDANE | 5 | 20 |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 | DRB1-1485 | KENKFSAKKETEDAN | 4 | 19 |
Top |
Fusion breakpoint peptide structures of CREBBP-SRL |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
6225 | NKFSAKKETEDANE | CREBBP | SRL | chr16 | 3794894 | chr16 | 4254635 | 4792 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CREBBP-SRL |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 6225 | NKFSAKKETEDANE | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 6225 | NKFSAKKETEDANE | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 6225 | NKFSAKKETEDANE | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 6225 | NKFSAKKETEDANE | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 6225 | NKFSAKKETEDANE | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 6225 | NKFSAKKETEDANE | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 6225 | NKFSAKKETEDANE | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 6225 | NKFSAKKETEDANE | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 6225 | NKFSAKKETEDANE | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 6225 | NKFSAKKETEDANE | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 6225 | NKFSAKKETEDANE | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of CREBBP-SRL |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 12 | 22 | KETEDANEEA | AGAAAGAGACGGAGGATGCAAATGAAGAAG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 3 | 18 | RKENKFSAKKETEDA | CTCGAAAAGAAAACAAATTCAGTGCTAAGAAAGAGACGGAGGATG |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 4 | 19 | KENKFSAKKETEDAN | GAAAAGAAAACAAATTCAGTGCTAAGAAAGAGACGGAGGATGCAA |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 5 | 20 | ENKFSAKKETEDANE | AAGAAAACAAATTCAGTGCTAAGAAAGAGACGGAGGATGCAAATG |
CREBBP-SRL | chr16 | 3794894 | chr16 | 4254635 | 6 | 21 | NKFSAKKETEDANEE | AAAACAAATTCAGTGCTAAGAAAGAGACGGAGGATGCAAATGAAG |
Top |
Information of the samples that have these potential fusion neoantigens of CREBBP-SRL |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
OV | CREBBP-SRL | chr16 | 3794894 | ENST00000262367 | chr16 | 4254635 | ENST00000399609 | TCGA-24-1562 |
Top |
Potential target of CAR-T therapy development for CREBBP-SRL |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to CREBBP-SRL |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to CREBBP-SRL |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Hgene | CREBBP | C4551859 | RUBINSTEIN-TAYBI SYNDROME 1 | 12 | CLINGEN;GENOMICS_ENGLAND;UNIPROT |
Hgene | CREBBP | C0035934 | Rubinstein-Taybi Syndrome | 6 | CLINGEN;CTD_human |
Hgene | CREBBP | C0033578 | Prostatic Neoplasms | 2 | CTD_human |
Hgene | CREBBP | C0376358 | Malignant neoplasm of prostate | 2 | CTD_human |
Hgene | CREBBP | C4511003 | Acute myeloid leukemia with t(8;16)(p11;p13) translocation | 2 | ORPHANET |
Hgene | CREBBP | C0005684 | Malignant neoplasm of urinary bladder | 1 | CTD_human |
Hgene | CREBBP | C0005695 | Bladder Neoplasm | 1 | CTD_human |
Hgene | CREBBP | C0007137 | Squamous cell carcinoma | 1 | CTD_human |
Hgene | CREBBP | C0007138 | Carcinoma, Transitional Cell | 1 | CTD_human |
Hgene | CREBBP | C0010606 | Adenoid Cystic Carcinoma | 1 | CTD_human |
Hgene | CREBBP | C0011573 | Endogenous depression | 1 | PSYGENET |
Hgene | CREBBP | C0024301 | Lymphoma, Follicular | 1 | CTD_human |
Hgene | CREBBP | C0036920 | Sezary Syndrome | 1 | CTD_human |
Hgene | CREBBP | C0079745 | Lymphoma, Large-Cell, Follicular | 1 | CTD_human |
Hgene | CREBBP | C0079758 | Lymphoma, Mixed-Cell, Follicular | 1 | CTD_human |
Hgene | CREBBP | C0079765 | Lymphoma, Small Cleaved-Cell, Follicular | 1 | CTD_human |
Hgene | CREBBP | C0149925 | Small cell carcinoma of lung | 1 | CTD_human |
Hgene | CREBBP | C0152013 | Adenocarcinoma of lung (disorder) | 1 | CTD_human |
Hgene | CREBBP | C0279626 | Squamous cell carcinoma of esophagus | 1 | CTD_human |
Hgene | CREBBP | C1862939 | AMYOTROPHIC LATERAL SCLEROSIS 1 | 1 | CTD_human |
Hgene | CREBBP | C1862941 | Amyotrophic Lateral Sclerosis, Sporadic | 1 | CTD_human |
Hgene | CREBBP | C1956130 | Lymphoma, Follicular, Grade 1 | 1 | CTD_human |
Hgene | CREBBP | C1956131 | Lymphoma, Follicular, Grade 3 | 1 | CTD_human |
Hgene | CREBBP | C1956132 | Lymphoma, Follicular, Grade 2 | 1 | CTD_human |
Hgene | CREBBP | C4551993 | Amyotrophic Lateral Sclerosis, Familial | 1 | CTD_human |