Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ADAM22-RUNDC3B

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ADAM22-RUNDC3B
	FusionPDB ID: 1993
	FusionGDB2.0 ID: 1993
		Hgene	Tgene
	Gene symbol	ADAM22	RUNDC3B
	Gene ID	53616	154661
	Gene name	ADAM metallopeptidase domain 22	RUN domain containing 3B
	Synonyms	ADAM 22\|EIEE61\|MDC2	RPIB9\|RPIP9
	Cytomap	7q21.12	7q21.12
	Type of gene	protein-coding	protein-coding
	Description	disintegrin and metalloproteinase domain-containing protein 22a disintegrin and metalloproteinase domain 22metalloproteinase-disintegrin ADAM22-3metalloproteinase-like, disintegrin-like, and cysteine-rich protein 2	RUN domain-containing protein 3BRPIP-9Rap2 binding protein 9Rap2-interacting protein 9rap2-binding protein 9
	Modification date	20200313	20200320
	UniProtAcc	Q9P0K1 Main function of 5'-partner protein: FUNCTION: Probable ligand for integrin in the brain. This is a non catalytic metalloprotease-like protein (PubMed:19692335). Involved in regulation of cell adhesion and spreading and in inhibition of cell proliferation. Neuronal receptor for LGI1. {ECO:0000269\|PubMed:12589811, ECO:0000269\|PubMed:15882968, ECO:0000269\|PubMed:16385342, ECO:0000269\|PubMed:19692335}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000265727, ENST00000315984, ENST00000398201, ENST00000398204, ENST00000398209, ENST00000439864, ENST00000476330,	ENST00000496000, ENST00000338056, ENST00000394654, ENST00000493037,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	3 X 3 X 3=27	6 X 6 X 4=144
	# samples	3	6
	** MAII score	log2(3/27*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(6/144*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ADAM22 [Title/Abstract] AND RUNDC3B [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ADAM22 [Title/Abstract] AND RUNDC3B [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ADAM22(87607727)-RUNDC3B(87445456), # samples:2
Anticipated loss of major functional domain due to fusion event.	ADAM22-RUNDC3B seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ADAM22-RUNDC3B seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:87607727/chr7:87445456)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ADAM22 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RUNDC3B (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000398204	ADAM22	chr7	87607727	+	ENST00000338056	RUNDC3B	chr7	87445456	+	3180	646	323	913	196
ENST00000398204	ADAM22	chr7	87607727	+	ENST00000493037	RUNDC3B	chr7	87445456	+	1340	646	323	913	196
ENST00000398204	ADAM22	chr7	87607727	+	ENST00000394654	RUNDC3B	chr7	87445456	+	1398	646	323	913	196
ENST00000439864	ADAM22	chr7	87607727	+	ENST00000338056	RUNDC3B	chr7	87445456	+	3072	538	215	805	196
ENST00000439864	ADAM22	chr7	87607727	+	ENST00000493037	RUNDC3B	chr7	87445456	+	1232	538	215	805	196
ENST00000439864	ADAM22	chr7	87607727	+	ENST00000394654	RUNDC3B	chr7	87445456	+	1290	538	215	805	196
ENST00000398201	ADAM22	chr7	87607727	+	ENST00000338056	RUNDC3B	chr7	87445456	+	2976	442	119	709	196
ENST00000398201	ADAM22	chr7	87607727	+	ENST00000493037	RUNDC3B	chr7	87445456	+	1136	442	119	709	196
ENST00000398201	ADAM22	chr7	87607727	+	ENST00000394654	RUNDC3B	chr7	87445456	+	1194	442	119	709	196
ENST00000265727	ADAM22	chr7	87607727	+	ENST00000338056	RUNDC3B	chr7	87445456	+	2936	402	79	669	196
ENST00000265727	ADAM22	chr7	87607727	+	ENST00000493037	RUNDC3B	chr7	87445456	+	1096	402	79	669	196
ENST00000265727	ADAM22	chr7	87607727	+	ENST00000394654	RUNDC3B	chr7	87445456	+	1154	402	79	669	196
ENST00000315984	ADAM22	chr7	87607727	+	ENST00000338056	RUNDC3B	chr7	87445456	+	2936	402	79	669	196
ENST00000315984	ADAM22	chr7	87607727	+	ENST00000493037	RUNDC3B	chr7	87445456	+	1096	402	79	669	196
ENST00000315984	ADAM22	chr7	87607727	+	ENST00000394654	RUNDC3B	chr7	87445456	+	1154	402	79	669	196
ENST00000398209	ADAM22	chr7	87607727	+	ENST00000338056	RUNDC3B	chr7	87445456	+	2903	369	46	636	196
ENST00000398209	ADAM22	chr7	87607727	+	ENST00000493037	RUNDC3B	chr7	87445456	+	1063	369	46	636	196
ENST00000398209	ADAM22	chr7	87607727	+	ENST00000394654	RUNDC3B	chr7	87445456	+	1121	369	46	636	196

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000398204	ENST00000338056	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000253044	0.999747
ENST00000398204	ENST00000493037	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.001772832	0.9982272
ENST00000398204	ENST00000394654	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.001451234	0.9985487
ENST00000439864	ENST00000338056	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000217384	0.9997826
ENST00000439864	ENST00000493037	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000891526	0.9991085
ENST00000439864	ENST00000394654	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000770495	0.99922955
ENST00000398201	ENST00000338056	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000250308	0.9997497
ENST00000398201	ENST00000493037	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.00078583	0.9992142
ENST00000398201	ENST00000394654	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000644874	0.99935514
ENST00000265727	ENST00000338056	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000197611	0.9998024
ENST00000265727	ENST00000493037	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000663473	0.99933654
ENST00000265727	ENST00000394654	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000524039	0.999476
ENST00000315984	ENST00000338056	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000197611	0.9998024
ENST00000315984	ENST00000493037	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000663473	0.99933654
ENST00000315984	ENST00000394654	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000524039	0.999476
ENST00000398209	ENST00000338056	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000177536	0.99982244
ENST00000398209	ENST00000493037	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000580484	0.99941957
ENST00000398209	ENST00000394654	ADAM22	chr7	87607727	+	RUNDC3B	chr7	87445456	+	0.000466066	0.999534

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ADAM22-RUNDC3B

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ADAM22	chr7	87607727	RUNDC3B	chr7	87445456	369	108	FGTSFILDVVLNQKSYQSLDQLSAEV
ADAM22	chr7	87607727	RUNDC3B	chr7	87445456	402	108	FGTSFILDVVLNQKSYQSLDQLSAEV
ADAM22	chr7	87607727	RUNDC3B	chr7	87445456	442	108	FGTSFILDVVLNQKSYQSLDQLSAEV
ADAM22	chr7	87607727	RUNDC3B	chr7	87445456	538	108	FGTSFILDVVLNQKSYQSLDQLSAEV
ADAM22	chr7	87607727	RUNDC3B	chr7	87445456	646	108	FGTSFILDVVLNQKSYQSLDQLSAEV

Top

Potential FusionNeoAntigen Information of ADAM22-RUNDC3B in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ADAM22-RUNDC3B_87607727_87445456.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B14:02	NQKSYQSL	0.9995	0.5361	11	19
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B14:01	NQKSYQSL	0.9995	0.5361	11	19
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B35:08	DVVLNQKSY	0.9303	0.6729	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B35:01	DVVLNQKSY	0.9001	0.6741	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B15:02	DVVLNQKSY	0.84	0.7024	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B08:01	VLNQKSYQSL	0.9929	0.5624	9	19
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B14:03	NQKSYQSL	0.9667	0.6136	11	19
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B15:31	DVVLNQKSY	0.904	0.5866	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B15:21	DVVLNQKSY	0.8532	0.6757	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-A25:01	DVVLNQKSY	0.9968	0.5178	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B35:24	DVVLNQKSY	0.945	0.7491	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B35:77	DVVLNQKSY	0.9001	0.6741	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B35:20	DVVLNQKSY	0.898	0.7187	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B35:23	DVVLNQKSY	0.8969	0.6132	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B35:11	DVVLNQKSY	0.8445	0.647	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B18:04	DVVLNQKSY	0.7719	0.7649	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B18:07	DVVLNQKSY	0.4613	0.6672	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B15:11	DVVLNQKSY	0.3701	0.5693	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B15:08	DVVLNQKSY	0.3595	0.5742	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B35:43	DVVLNQKSY	0.2895	0.5755	7	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B08:18	VLNQKSYQSL	0.9929	0.5624	9	19
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	HLA-B08:12	VLNQKSYQSL	0.8816	0.7394	9	19

Top

Potential FusionNeoAntigen Information of ADAM22-RUNDC3B in HLA II

ADAM22-RUNDC3B_87607727_87445456.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	DRB1-0434	GTSFILDVVLNQKSY	1	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	DRB1-0434	FGTSFILDVVLNQKS	0	15
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	DRB1-0435	GTSFILDVVLNQKSY	1	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	DRB1-0435	FGTSFILDVVLNQKS	0	15
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	DRB1-0438	FGTSFILDVVLNQKS	0	15
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	DRB1-0438	GTSFILDVVLNQKSY	1	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	DRB1-0472	GTSFILDVVLNQKSY	1	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	DRB1-0472	FGTSFILDVVLNQKS	0	15
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	DRB1-0474	GTSFILDVVLNQKSY	1	16
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	DRB1-0474	FGTSFILDVVLNQKS	0	15
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	DRB1-1216	NQKSYQSLDQLSAEV	11	26
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	402	DRB1-1216	LNQKSYQSLDQLSAE	10	25

Top

Fusion breakpoint peptide structures of ADAM22-RUNDC3B

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4870	LDVVLNQKSYQSLD	ADAM22	RUNDC3B	chr7	87607727	chr7	87445456	402

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ADAM22-RUNDC3B

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4870	LDVVLNQKSYQSLD	-7.9962	-8.1096
HLA-B14:02	3BVN	4870	LDVVLNQKSYQSLD	-5.70842	-6.74372
HLA-B52:01	3W39	4870	LDVVLNQKSYQSLD	-6.83737	-6.95077
HLA-B52:01	3W39	4870	LDVVLNQKSYQSLD	-4.4836	-5.5189
HLA-A11:01	4UQ2	4870	LDVVLNQKSYQSLD	-10.0067	-10.1201
HLA-A11:01	4UQ2	4870	LDVVLNQKSYQSLD	-9.03915	-10.0745
HLA-A24:02	5HGA	4870	LDVVLNQKSYQSLD	-6.56204	-6.67544
HLA-A24:02	5HGA	4870	LDVVLNQKSYQSLD	-5.42271	-6.45801
HLA-B44:05	3DX8	4870	LDVVLNQKSYQSLD	-7.85648	-8.89178
HLA-B44:05	3DX8	4870	LDVVLNQKSYQSLD	-5.3978	-5.5112
HLA-A02:01	6TDR	4870	LDVVLNQKSYQSLD	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of ADAM22-RUNDC3B

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	11	19	NQKSYQSL	AAATCAGAAAAGTTATCAAAGTCT
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	7	16	DVVLNQKSY	CGATGTCGTGCTAAATCAGAAAAGTTA
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	9	19	VLNQKSYQSL	CGTGCTAAATCAGAAAAGTTATCAAAGTCT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	0	15	FGTSFILDVVLNQKS	CTTTGGAACGTCATTCATTCTCGATGTCGTGCTAAATCAGAAAAG
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	1	16	GTSFILDVVLNQKSY	TGGAACGTCATTCATTCTCGATGTCGTGCTAAATCAGAAAAGTTA
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	10	25	LNQKSYQSLDQLSAE	GCTAAATCAGAAAAGTTATCAAAGTCTTGACCAGTTATCAGCAGA
ADAM22-RUNDC3B	chr7	87607727	chr7	87445456	11	26	NQKSYQSLDQLSAEV	AAATCAGAAAAGTTATCAAAGTCTTGACCAGTTATCAGCAGAAGT

Top

Information of the samples that have these potential fusion neoantigens of ADAM22-RUNDC3B

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
UCEC	ADAM22-RUNDC3B	chr7	87607727	ENST00000265727	chr7	87445456	ENST00000338056	TCGA-AJ-A3QS-01A

Top

Potential target of CAR-T therapy development for ADAM22-RUNDC3B

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ADAM22-RUNDC3B

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ADAM22-RUNDC3B

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)