Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ADAM23-PPAP2A

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ADAM23-PPAP2A
	FusionPDB ID: 1997
	FusionGDB2.0 ID: 1997
		Hgene	Tgene
	Gene symbol	ADAM23	PPAP2A
	Gene ID	8745	8611
	Gene name	ADAM metallopeptidase domain 23	phospholipid phosphatase 1
	Synonyms	MDC-3\|MDC3	LLP1a\|LPP1\|PAP-2a\|PAP2\|PPAP2A
	Cytomap	2q33.3	5q11.2
	Type of gene	protein-coding	protein-coding
	Description	disintegrin and metalloproteinase domain-containing protein 23metalloproteinase-like, disintegrin-like, and cysteine-rich protein 3	phospholipid phosphatase 1lipid phosphate phosphohydrolase 1aphosphatidate phosphohydrolase type 2aphosphatidic acid phosphatase 2aphosphatidic acid phosphatase type 2Aphosphatidic acid phosphohydrolase type 2atype-2 phosphatidic acid phosphatase al
	Modification date	20200313	20200313
	UniProtAcc	O75077 Main function of 5'-partner protein: FUNCTION: May play a role in cell-cell and cell-matrix interactions. This is a non-catalytic metalloprotease-like protein.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000264377, ENST00000374415, ENST00000374416,	ENST00000515132, ENST00000264775, ENST00000307259,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	4 X 4 X 3=48	10 X 5 X 6=300
	# samples	5	10
	** MAII score	log2(5/48*10)=0.0588936890535686 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(10/300*10)=-1.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ADAM23 [Title/Abstract] AND PPAP2A [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ADAM23 [Title/Abstract] AND PPAP2A [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ADAM23(207432046)-PPAP2A(54721162), # samples:1
Anticipated loss of major functional domain due to fusion event.	ADAM23-PPAP2A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ADAM23-PPAP2A seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ADAM23-PPAP2A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ADAM23-PPAP2A seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	PPAP2A	GO:0006644	phospholipid metabolic process	9305923\|9705349\|15461590
Tgene	PPAP2A	GO:0006670	sphingosine metabolic process	9705349
Tgene	PPAP2A	GO:0006672	ceramide metabolic process	9305923\|9705349
Tgene	PPAP2A	GO:0046839	phospholipid dephosphorylation	9305923\|9705349\|15461590\|16464866

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:207432046/chr5:54721162)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ADAM23 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PPAP2A (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000264377	ADAM23	chr2	207432046	-	ENST00000264775	PPAP2A	chr5	54721162	-	2303	1822	328	1950	540
ENST00000264377	ADAM23	chr2	207432046	-	ENST00000307259	PPAP2A	chr5	54721162	-	2272	1822	328	1950	540
ENST00000374416	ADAM23	chr2	207432046	-	ENST00000264775	PPAP2A	chr5	54721162	-	2027	1546	52	1674	540
ENST00000374416	ADAM23	chr2	207432046	-	ENST00000307259	PPAP2A	chr5	54721162	-	1996	1546	52	1674	540
ENST00000374415	ADAM23	chr2	207432046	-	ENST00000264775	PPAP2A	chr5	54721162	-	1975	1494	0	1622	540
ENST00000374415	ADAM23	chr2	207432046	-	ENST00000307259	PPAP2A	chr5	54721162	-	1944	1494	0	1622	540

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000264377	ENST00000264775	ADAM23	chr2	207432046	-	PPAP2A	chr5	54721162	-	0.01116371	0.98883635
ENST00000264377	ENST00000307259	ADAM23	chr2	207432046	-	PPAP2A	chr5	54721162	-	0.01202669	0.98797333
ENST00000374416	ENST00000264775	ADAM23	chr2	207432046	-	PPAP2A	chr5	54721162	-	0.006232606	0.9937674
ENST00000374416	ENST00000307259	ADAM23	chr2	207432046	-	PPAP2A	chr5	54721162	-	0.00661048	0.9933895
ENST00000374415	ENST00000264775	ADAM23	chr2	207432046	-	PPAP2A	chr5	54721162	-	0.005983968	0.99401605
ENST00000374415	ENST00000307259	ADAM23	chr2	207432046	-	PPAP2A	chr5	54721162	-	0.006341505	0.9936585

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ADAM23-PPAP2A

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ADAM23	chr2	207432046	PPAP2A	chr5	54721162	1494	498	RGGGACLFNRPTKAVYVSDFFKERTS
ADAM23	chr2	207432046	PPAP2A	chr5	54721162	1546	498	RGGGACLFNRPTKAVYVSDFFKERTS
ADAM23	chr2	207432046	PPAP2A	chr5	54721162	1822	498	RGGGACLFNRPTKAVYVSDFFKERTS

Top

Potential FusionNeoAntigen Information of ADAM23-PPAP2A in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ADAM23-PPAP2A_207432046_54721162.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B58:01	KAVYVSDFF	0.9935	0.7997	12	21
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B15:17	KAVYVSDFF	0.9923	0.8328	12	21
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B15:16	KAVYVSDFF	0.9893	0.5911	12	21
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B57:03	KAVYVSDFF	0.989	0.9314	12	21
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B58:02	KAVYVSDFF	0.9887	0.8231	12	21
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-A02:22	CLFNRPTKA	0.9722	0.6853	5	14
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B15:02	FNRPTKAVY	0.9645	0.7978	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-A02:27	CLFNRPTKA	0.964	0.6894	5	14
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-A02:13	CLFNRPTKA	0.9546	0.7492	5	14
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B08:09	CLFNRPTKA	0.937	0.695	5	14
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-A02:38	CLFNRPTKA	0.9324	0.7469	5	14
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B15:03	FNRPTKAVY	0.6659	0.5476	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-A02:13	ACLFNRPTKA	0.3165	0.7769	4	14
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:46	NRPTKAVY	0.9945	0.6043	8	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B39:12	NRPTKAVYV	0.9781	0.7966	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B15:21	FNRPTKAVY	0.9592	0.8056	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:05	NRPTKAVYV	0.9314	0.8939	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C12:16	FNRPTKAVY	0.9221	0.9138	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:27	NRPTKAVYV	0.8804	0.8897	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:95	NRPTKAVYV	0.8504	0.5136	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:80	NRPTKAVYV	0.7458	0.9068	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:67	NRPTKAVYV	0.7458	0.9068	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:10	NRPTKAVYV	0.7396	0.9144	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:19	NRPTKAVYV	0.7184	0.567	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:29	NRPTKAVYV	0.694	0.8505	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:46	NRPTKAVYV	0.6877	0.7947	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:13	NRPTKAVYV	0.6845	0.8685	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B14:03	NRPTKAVYV	0.5357	0.6873	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C12:12	FNRPTKAVY	0.456	0.8175	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C03:14	FNRPTKAVY	0.225	0.9301	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C12:16	NRPTKAVYV	0.0117	0.9324	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B15:11	FNRPTKAVY	0.9959	0.709	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B15:08	FNRPTKAVY	0.9956	0.7074	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B35:43	FNRPTKAVY	0.9945	0.7053	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B15:50	FNRPTKAVY	0.9922	0.8425	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B15:35	FNRPTKAVY	0.9875	0.7254	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-A02:03	CLFNRPTKA	0.9865	0.7933	5	14
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B15:53	FNRPTKAVY	0.9811	0.6929	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B15:12	FNRPTKAVY	0.9592	0.8054	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B57:02	KAVYVSDFF	0.9587	0.7798	12	21
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C06:08	NRPTKAVYV	0.9401	0.9649	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B15:54	FNRPTKAVY	0.8226	0.6748	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C03:02	FNRPTKAVY	0.819	0.932	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C12:02	FNRPTKAVY	0.7798	0.9287	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:17	NRPTKAVYV	0.7497	0.934	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:02	NRPTKAVYV	0.7458	0.9068	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B18:04	FNRPTKAVY	0.5066	0.8258	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C12:03	FNRPTKAVY	0.4852	0.9162	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:22	NRPTKAVYV	0.4147	0.5986	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C07:04	NRPTKAVYV	0.3788	0.8721	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C16:04	FNRPTKAVY	0.2972	0.9577	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C06:06	NRPTKAVYV	0.217	0.977	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-B18:07	FNRPTKAVY	0.192	0.7808	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C02:02	FNRPTKAVY	0.0455	0.9479	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C02:10	FNRPTKAVY	0.0455	0.9479	7	16
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C06:02	NRPTKAVYV	0.0356	0.9808	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C06:17	NRPTKAVYV	0.0356	0.9808	8	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C06:02	FNRPTKAVYV	0.9327	0.9882	7	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-C06:17	FNRPTKAVYV	0.9327	0.9882	7	17
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	1822	HLA-A02:03	ACLFNRPTKA	0.4184	0.806	4	14

Top

Potential FusionNeoAntigen Information of ADAM23-PPAP2A in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ADAM23-PPAP2A

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4971	LFNRPTKAVYVSDF	ADAM23	PPAP2A	chr2	207432046	chr5	54721162	1822

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ADAM23-PPAP2A

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4971	LFNRPTKAVYVSDF	-7.15543	-7.26883
HLA-B14:02	3BVN	4971	LFNRPTKAVYVSDF	-4.77435	-5.80965
HLA-B52:01	3W39	4971	LFNRPTKAVYVSDF	-6.80875	-6.92215
HLA-B52:01	3W39	4971	LFNRPTKAVYVSDF	-4.20386	-5.23916
HLA-A11:01	4UQ2	4971	LFNRPTKAVYVSDF	-7.5194	-8.5547
HLA-A11:01	4UQ2	4971	LFNRPTKAVYVSDF	-6.9601	-7.0735
HLA-A24:02	5HGA	4971	LFNRPTKAVYVSDF	-7.52403	-7.63743
HLA-A24:02	5HGA	4971	LFNRPTKAVYVSDF	-5.82433	-6.85963
HLA-B27:05	6PYJ	4971	LFNRPTKAVYVSDF	-3.28285	-4.31815
HLA-B44:05	3DX8	4971	LFNRPTKAVYVSDF	-5.91172	-6.94702
HLA-B44:05	3DX8	4971	LFNRPTKAVYVSDF	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of ADAM23-PPAP2A

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	12	21	KAVYVSDFF	AAGGCTGTATATGTATCGGATTTCTTC
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	4	14	ACLFNRPTKA	GCCTGCCTTTTCAACAGGCCAACAAAGGCT
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	5	14	CLFNRPTKA	TGCCTTTTCAACAGGCCAACAAAGGCT
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	7	16	FNRPTKAVY	TTCAACAGGCCAACAAAGGCTGTATAT
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	7	17	FNRPTKAVYV	TTCAACAGGCCAACAAAGGCTGTATATGTA
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	8	16	NRPTKAVY	AACAGGCCAACAAAGGCTGTATAT
ADAM23-PPAP2A	chr2	207432046	chr5	54721162	8	17	NRPTKAVYV	AACAGGCCAACAAAGGCTGTATATGTA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ADAM23-PPAP2A

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
HNSC	ADAM23-PPAP2A	chr2	207432046	ENST00000264377	chr5	54721162	ENST00000264775	TCGA-CR-7397-01A

Top

Potential target of CAR-T therapy development for ADAM23-PPAP2A

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ADAM23-PPAP2A

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ADAM23-PPAP2A

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)