Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ADAM28-STAG1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ADAM28-STAG1
	FusionPDB ID: 1999
	FusionGDB2.0 ID: 1999
		Hgene	Tgene
	Gene symbol	ADAM28	STAG1
	Gene ID	10863	56937
	Gene name	ADAM metallopeptidase domain 28	prostate transmembrane protein, androgen induced 1
	Synonyms	ADAM 28\|MDC-L\|MDCL\|eMDC II\|eMDCII	STAG1\|TMEPAI
	Cytomap	8p21.2	20q13.31
	Type of gene	protein-coding	protein-coding
	Description	disintegrin and metalloproteinase domain-containing protein 28epididymal metalloproteinase-like, disintegrin-like, and cysteine-rich protein IIepididymial metalloproteinase-like, disintegrin-like, and cysteine-rich protein IIepididymis secretory sperm	protein TMEPAIsolid tumor-associated 1 proteintransmembrane, prostate androgen induced RNA
	Modification date	20200313	20200313
	UniProtAcc	Q9UKQ2 Main function of 5'-partner protein: FUNCTION: May play a role in the adhesive and proteolytic events that occur during lymphocyte emigration or may function in ectodomain shedding of lymphocyte surface target proteins, such as FASL and CD40L. May be involved in sperm maturation.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000265769, ENST00000437154, ENST00000397649, ENST00000540823, ENST00000518516,	ENST00000480733, ENST00000536929, ENST00000236698, ENST00000383202, ENST00000434713,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	2 X 2 X 2=8	16 X 17 X 8=2176
	# samples	2	23
	** MAII score	log2(2/8*10)=1.32192809488736	log2(23/2176*10)=-3.24197279030596 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ADAM28 [Title/Abstract] AND STAG1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ADAM28 [Title/Abstract] AND STAG1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ADAM28(24157590)-STAG1(136117671), # samples:1
Anticipated loss of major functional domain due to fusion event.	ADAM28-STAG1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ADAM28-STAG1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ADAM28-STAG1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ADAM28-STAG1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	STAG1	GO:0010991	negative regulation of SMAD protein complex assembly	20129061
Tgene	STAG1	GO:0030512	negative regulation of transforming growth factor beta receptor signaling pathway	24627487
Tgene	STAG1	GO:0060394	negative regulation of pathway-restricted SMAD protein phosphorylation	24627487

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:24157590/chr3:136117671)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ADAM28 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across STAG1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000265769	ADAM28	chr8	24157590	+	ENST00000383202	STAG1	chr3	136117671	-	3860	260	95	1840	581
ENST00000265769	ADAM28	chr8	24157590	+	ENST00000236698	STAG1	chr3	136117671	-	3748	260	95	1729	544
ENST00000265769	ADAM28	chr8	24157590	+	ENST00000434713	STAG1	chr3	136117671	-	2603	260	95	1738	547
ENST00000437154	ADAM28	chr8	24157590	+	ENST00000383202	STAG1	chr3	136117671	-	3789	189	24	1769	581
ENST00000437154	ADAM28	chr8	24157590	+	ENST00000236698	STAG1	chr3	136117671	-	3677	189	24	1658	544
ENST00000437154	ADAM28	chr8	24157590	+	ENST00000434713	STAG1	chr3	136117671	-	2532	189	24	1667	547

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000265769	ENST00000383202	ADAM28	chr8	24157590	+	STAG1	chr3	136117671	-	0.000428766	0.99957126
ENST00000265769	ENST00000236698	ADAM28	chr8	24157590	+	STAG1	chr3	136117671	-	0.000299056	0.999701
ENST00000265769	ENST00000434713	ADAM28	chr8	24157590	+	STAG1	chr3	136117671	-	0.000682433	0.9993175
ENST00000437154	ENST00000383202	ADAM28	chr8	24157590	+	STAG1	chr3	136117671	-	0.000394747	0.99960524
ENST00000437154	ENST00000236698	ADAM28	chr8	24157590	+	STAG1	chr3	136117671	-	0.000276301	0.99972373
ENST00000437154	ENST00000434713	ADAM28	chr8	24157590	+	STAG1	chr3	136117671	-	0.000593235	0.9994068

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ADAM28-STAG1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ADAM28	chr8	24157590	STAG1	chr3	136117671	189	54	HPLHKREAKEPEQQIVVQALQCSHYS
ADAM28	chr8	24157590	STAG1	chr3	136117671	260	54	HPLHKREAKEPEQQIVVQALQCSHYS

Top

Potential FusionNeoAntigen Information of ADAM28-STAG1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ADAM28-STAG1_24157590_136117671.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B48:01	QQIVVQAL	0.9936	0.7655	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:24	QQIVVQAL	0.9898	0.8249	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:13	QQIVVQAL	0.935	0.9854	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B15:10	QQIVVQAL	0.9288	0.7298	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B13:01	QQIVVQAL	0.8697	0.991	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B52:01	QQIVVQAL	0.7797	0.9879	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B15:37	QQIVVQAL	0.7525	0.6848	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B14:01	EQQIVVQAL	0.9909	0.9179	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B14:02	EQQIVVQAL	0.9909	0.9179	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B50:02	KEPEQQIVV	0.9842	0.6258	8	17
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:01	EQQIVVQAL	0.9835	0.9654	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:24	EQQIVVQAL	0.9805	0.7904	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:13	EQQIVVQAL	0.9749	0.9697	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B48:01	EQQIVVQAL	0.9742	0.5163	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B45:01	KEPEQQIVV	0.9625	0.8936	8	17
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B38:02	EQQIVVQAL	0.9595	0.9866	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B45:01	PEQQIVVQA	0.9437	0.9868	10	19
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B50:02	PEQQIVVQA	0.8814	0.8123	10	19
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B15:10	EQQIVVQAL	0.8007	0.5752	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B15:37	EQQIVVQAL	0.7088	0.6207	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B13:01	EQQIVVQAL	0.6398	0.9562	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B47:01	KEPEQQIVV	0.63	0.5676	8	17
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B41:01	KEPEQQIVV	0.5218	0.9253	8	17
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B08:09	EQQIVVQAL	0.4054	0.7748	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B50:01	KEPEQQIVV	0.3822	0.7347	8	17
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B41:01	PEQQIVVQA	0.2746	0.9451	10	19
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:13	KEPEQQIVV	0.1929	0.9673	8	17
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B13:01	REAKEPEQQI	0.9676	0.8401	5	15
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B44:03	REAKEPEQQI	0.9122	0.8914	5	15
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B45:01	EPEQQIVVQA	0.7226	0.9649	9	19
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B50:02	EPEQQIVVQA	0.6946	0.7832	9	19
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B41:01	REAKEPEQQI	0.6395	0.7029	5	15
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:13	REAKEPEQQI	0.5093	0.8329	5	15
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B45:01	KEPEQQIVVQA	0.9941	0.946	8	19
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B41:01	KEPEQQIVVQA	0.9309	0.9349	8	19
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B35:03	EPEQQIVVQAL	0.8103	0.6628	9	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B35:02	EPEQQIVVQAL	0.7078	0.9263	9	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B35:04	EPEQQIVVQAL	0.7078	0.9263	9	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B15:04	QQIVVQAL	0.9635	0.9273	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:05	QQIVVQAL	0.9284	0.9743	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B48:03	QQIVVQAL	0.9154	0.7119	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B40:06	KEPEQQIVV	0.998	0.613	8	17
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B51:07	EAKEPEQQI	0.9926	0.7653	6	15
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:09	EQQIVVQAL	0.9877	0.885	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:12	EQQIVVQAL	0.9705	0.9667	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:05	EQQIVVQAL	0.9653	0.9605	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:08	EQQIVVQAL	0.9089	0.9082	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B40:06	PEQQIVVQA	0.8998	0.8328	10	19
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B14:03	EQQIVVQAL	0.7	0.9303	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B15:31	EQQIVVQAL	0.5757	0.786	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:08	KEPEQQIVV	0.3211	0.9072	8	17
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B51:07	EQQIVVQAL	0.1529	0.951	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B40:06	REAKEPEQQI	0.9974	0.5665	5	15
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:08	REAKEPEQQI	0.8406	0.6133	5	15
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B54:01	EPEQQIVVQA	0.738	0.8714	9	19
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B40:06	KEPEQQIVVQA	0.9989	0.9069	8	19
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B35:12	EPEQQIVVQAL	0.7078	0.9263	9	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:10	EPEQQIVVQAL	0.6287	0.908	9	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:02	QQIVVQAL	0.9852	0.9855	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B15:73	QQIVVQAL	0.9496	0.9752	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B15:30	QQIVVQAL	0.9374	0.9665	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B40:12	QQIVVQAL	0.9154	0.7119	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B40:49	QQIVVQAL	0.855	0.6868	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B40:21	QQIVVQAL	0.8308	0.776	12	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B78:02	EAKEPEQQI	0.9934	0.6084	6	15
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B40:04	KEPEQQIVV	0.9853	0.7035	8	17
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:31	EQQIVVQAL	0.9833	0.9662	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:02	EQQIVVQAL	0.9815	0.9696	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:11	EQQIVVQAL	0.8662	0.8914	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B08:12	EQQIVVQAL	0.7562	0.8026	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B15:09	EQQIVVQAL	0.6665	0.6337	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B15:73	EQQIVVQAL	0.6492	0.8972	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B41:03	KEPEQQIVV	0.6256	0.74	8	17
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B15:30	EQQIVVQAL	0.59	0.8486	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B35:20	EQQIVVQAL	0.5764	0.8358	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B18:04	EQQIVVQAL	0.4913	0.7739	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B50:04	KEPEQQIVV	0.3822	0.7347	8	17
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B50:05	KEPEQQIVV	0.3822	0.7347	8	17
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B18:07	EQQIVVQAL	0.3634	0.7295	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B18:08	EQQIVVQAL	0.321	0.8225	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B18:06	EQQIVVQAL	0.3055	0.778	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B15:12	EQQIVVQAL	0.3023	0.8807	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B18:03	EQQIVVQAL	0.2849	0.757	11	20
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B39:02	KEPEQQIVV	0.1722	0.9669	8	17
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B40:04	REAKEPEQQI	0.9885	0.5727	5	15
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B44:13	REAKEPEQQI	0.9122	0.8914	5	15
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B44:07	REAKEPEQQI	0.9122	0.8914	5	15
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B44:26	REAKEPEQQI	0.9122	0.8914	5	15
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	HLA-B35:09	EPEQQIVVQAL	0.7078	0.9263	9	20

Top

Potential FusionNeoAntigen Information of ADAM28-STAG1 in HLA II

ADAM28-STAG1_24157590_136117671.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ADAM28-STAG1	chr8	24157590	chr3	136117671	260	DRB4-0104	EQQIVVQALQCSHYS	11	26

Top

Fusion breakpoint peptide structures of ADAM28-STAG1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1525	EAKEPEQQIVVQAL	ADAM28	STAG1	chr8	24157590	chr3	136117671	260

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ADAM28-STAG1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1525	EAKEPEQQIVVQAL	-5.702	-5.708
HLA-B52:01	3W39	1525	EAKEPEQQIVVQAL	-5.28291	-5.28891
HLA-A24:02	5HGA	1525	EAKEPEQQIVVQAL	-6.71747	-6.72347
HLA-B27:05	6PYJ	1525	EAKEPEQQIVVQAL	-3.912	-3.918
HLA-B44:05	3DX8	1525	EAKEPEQQIVVQAL	-4.42946	-4.43546

Top

Vaccine Design for the FusionNeoAntigens of ADAM28-STAG1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ADAM28-STAG1	chr8	24157590	chr3	136117671	10	19	PEQQIVVQA	GAGCAACAGATAGTCGTGCAAGCACTG
ADAM28-STAG1	chr8	24157590	chr3	136117671	11	20	EQQIVVQAL	CAACAGATAGTCGTGCAAGCACTGCAG
ADAM28-STAG1	chr8	24157590	chr3	136117671	12	20	QQIVVQAL	CAGATAGTCGTGCAAGCACTGCAG
ADAM28-STAG1	chr8	24157590	chr3	136117671	5	15	REAKEPEQQI	GAGGCCAAAGAGCCAGAGCAACAGATAGTC
ADAM28-STAG1	chr8	24157590	chr3	136117671	6	15	EAKEPEQQI	GCCAAAGAGCCAGAGCAACAGATAGTC
ADAM28-STAG1	chr8	24157590	chr3	136117671	8	17	KEPEQQIVV	GAGCCAGAGCAACAGATAGTCGTGCAA
ADAM28-STAG1	chr8	24157590	chr3	136117671	8	19	KEPEQQIVVQA	GAGCCAGAGCAACAGATAGTCGTGCAAGCACTG
ADAM28-STAG1	chr8	24157590	chr3	136117671	9	19	EPEQQIVVQA	CCAGAGCAACAGATAGTCGTGCAAGCACTG
ADAM28-STAG1	chr8	24157590	chr3	136117671	9	20	EPEQQIVVQAL	CCAGAGCAACAGATAGTCGTGCAAGCACTGCAG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ADAM28-STAG1	chr8	24157590	chr3	136117671	11	26	EQQIVVQALQCSHYS	CAACAGATAGTCGTGCAAGCACTGCAGTGTTCCCATTATTCGATT

Top

Information of the samples that have these potential fusion neoantigens of ADAM28-STAG1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	ADAM28-STAG1	chr8	24157590	ENST00000265769	chr3	136117671	ENST00000236698	TCGA-BH-A1EV-11A

Top

Potential target of CAR-T therapy development for ADAM28-STAG1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ADAM28-STAG1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ADAM28-STAG1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)