Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CTSB-TG

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CTSB-TG
	FusionPDB ID: 20477
	FusionGDB2.0 ID: 20477
		Hgene	Tgene
	Gene symbol	CTSB	TG
	Gene ID	1508	7038
	Gene name	cathepsin B	thyroglobulin
	Synonyms	APPS\|CPSB\|RECEUP	AITD3\|TGN
	Cytomap	8p23.1	8q24.22
	Type of gene	protein-coding	protein-coding
	Description	cathepsin BAPP secretaseamyloid precursor protein secretasecathepsin B1cysteine proteaseepididymis secretory sperm binding protein	thyroglobulin
	Modification date	20200313	20200313
	UniProtAcc	P07858 Main function of 5'-partner protein: FUNCTION: Thiol protease which is believed to participate in intracellular degradation and turnover of proteins (PubMed:12220505). Cleaves matrix extracellular phosphoglycoprotein MEPE (PubMed:12220505). Involved in the solubilization of cross-linked TG/thyroglobulin in the thyroid follicle lumen (By similarity). Has also been implicated in tumor invasion and metastasis (PubMed:3972105). {ECO:0000250\|UniProtKB:P10605, ECO:0000269\|PubMed:12220505, ECO:0000269\|PubMed:3972105}.	TIAF1 Main function of 5'-partner protein: 115
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000415599, ENST00000345125, ENST00000353047, ENST00000434271, ENST00000453527, ENST00000530640, ENST00000531089, ENST00000533455, ENST00000534510, ENST00000525076,	ENST00000220616, ENST00000377869, ENST00000519543, ENST00000542445, ENST00000522523,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	24 X 19 X 10=4560	27 X 26 X 8=5616
	# samples	25	29
	** MAII score	log2(25/4560*10)=-4.18903382439002 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(29/5616*10)=-4.27541813028963 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: CTSB [Title/Abstract] AND TG [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CTSB [Title/Abstract] AND TG [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CTSB(11705575)-TG(134042125), # samples:1 CTSB(11705577)-TG(134042123), # samples:1
Anticipated loss of major functional domain due to fusion event.	CTSB-TG seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CTSB-TG seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CTSB-TG seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	CTSB	GO:0006508	proteolysis	7890620\|8811434
Hgene	CTSB	GO:0030574	collagen catabolic process	22952693
Hgene	CTSB	GO:0051603	proteolysis involved in cellular protein catabolic process	22952693

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:11705575/chr8:134042125)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CTSB (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TG (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000434271	CTSB	chr8	11705575	-	ENST00000377869	TG	chr8	134042125	+	2086	770	238	1980	580
ENST00000434271	CTSB	chr8	11705575	-	ENST00000220616	TG	chr8	134042125	+	2084	770	238	1980	580
ENST00000434271	CTSB	chr8	11705575	-	ENST00000542445	TG	chr8	134042125	+	2014	770	238	1980	580
ENST00000434271	CTSB	chr8	11705575	-	ENST00000519543	TG	chr8	134042125	+	2090	770	238	1980	580
ENST00000530640	CTSB	chr8	11705575	-	ENST00000377869	TG	chr8	134042125	+	1985	669	137	1879	580
ENST00000530640	CTSB	chr8	11705575	-	ENST00000220616	TG	chr8	134042125	+	1983	669	137	1879	580
ENST00000530640	CTSB	chr8	11705575	-	ENST00000542445	TG	chr8	134042125	+	1913	669	137	1879	580
ENST00000530640	CTSB	chr8	11705575	-	ENST00000519543	TG	chr8	134042125	+	1989	669	137	1879	580
ENST00000533455	CTSB	chr8	11705575	-	ENST00000377869	TG	chr8	134042125	+	2067	751	219	1961	580
ENST00000533455	CTSB	chr8	11705575	-	ENST00000220616	TG	chr8	134042125	+	2065	751	219	1961	580
ENST00000533455	CTSB	chr8	11705575	-	ENST00000542445	TG	chr8	134042125	+	1995	751	219	1961	580
ENST00000533455	CTSB	chr8	11705575	-	ENST00000519543	TG	chr8	134042125	+	2071	751	219	1961	580
ENST00000434271	CTSB	chr8	11705577	-	ENST00000377869	TG	chr8	134042123	+	2088	770	819	1982	387
ENST00000434271	CTSB	chr8	11705577	-	ENST00000220616	TG	chr8	134042123	+	2086	770	819	1982	387
ENST00000434271	CTSB	chr8	11705577	-	ENST00000542445	TG	chr8	134042123	+	2016	770	819	1982	387
ENST00000434271	CTSB	chr8	11705577	-	ENST00000519543	TG	chr8	134042123	+	2092	770	819	1982	387
ENST00000530640	CTSB	chr8	11705577	-	ENST00000377869	TG	chr8	134042123	+	1987	669	718	1881	387
ENST00000530640	CTSB	chr8	11705577	-	ENST00000220616	TG	chr8	134042123	+	1985	669	718	1881	387
ENST00000530640	CTSB	chr8	11705577	-	ENST00000542445	TG	chr8	134042123	+	1915	669	718	1881	387
ENST00000530640	CTSB	chr8	11705577	-	ENST00000519543	TG	chr8	134042123	+	1991	669	718	1881	387
ENST00000533455	CTSB	chr8	11705577	-	ENST00000377869	TG	chr8	134042123	+	2069	751	800	1963	387
ENST00000533455	CTSB	chr8	11705577	-	ENST00000220616	TG	chr8	134042123	+	2067	751	800	1963	387
ENST00000533455	CTSB	chr8	11705577	-	ENST00000542445	TG	chr8	134042123	+	1997	751	800	1963	387
ENST00000533455	CTSB	chr8	11705577	-	ENST00000519543	TG	chr8	134042123	+	2073	751	800	1963	387

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000434271	ENST00000377869	CTSB	chr8	11705575	-	TG	chr8	134042125	+	0.017031454	0.9829685
ENST00000434271	ENST00000220616	CTSB	chr8	11705575	-	TG	chr8	134042125	+	0.016822912	0.9831771
ENST00000434271	ENST00000542445	CTSB	chr8	11705575	-	TG	chr8	134042125	+	0.018741123	0.9812588
ENST00000434271	ENST00000519543	CTSB	chr8	11705575	-	TG	chr8	134042125	+	0.017792903	0.98220706
ENST00000530640	ENST00000377869	CTSB	chr8	11705575	-	TG	chr8	134042125	+	0.021603892	0.9783961
ENST00000530640	ENST00000220616	CTSB	chr8	11705575	-	TG	chr8	134042125	+	0.02140966	0.97859037
ENST00000530640	ENST00000542445	CTSB	chr8	11705575	-	TG	chr8	134042125	+	0.023307644	0.97669244
ENST00000530640	ENST00000519543	CTSB	chr8	11705575	-	TG	chr8	134042125	+	0.021989154	0.97801083
ENST00000533455	ENST00000377869	CTSB	chr8	11705575	-	TG	chr8	134042125	+	0.020867633	0.97913235
ENST00000533455	ENST00000220616	CTSB	chr8	11705575	-	TG	chr8	134042125	+	0.020671636	0.97932833
ENST00000533455	ENST00000542445	CTSB	chr8	11705575	-	TG	chr8	134042125	+	0.022736259	0.97726375
ENST00000533455	ENST00000519543	CTSB	chr8	11705575	-	TG	chr8	134042125	+	0.021538064	0.978462
ENST00000434271	ENST00000377869	CTSB	chr8	11705577	-	TG	chr8	134042123	+	0.015948612	0.9840514
ENST00000434271	ENST00000220616	CTSB	chr8	11705577	-	TG	chr8	134042123	+	0.015941564	0.98405844
ENST00000434271	ENST00000542445	CTSB	chr8	11705577	-	TG	chr8	134042123	+	0.016043985	0.98395604
ENST00000434271	ENST00000519543	CTSB	chr8	11705577	-	TG	chr8	134042123	+	0.015895966	0.98410404
ENST00000530640	ENST00000377869	CTSB	chr8	11705577	-	TG	chr8	134042123	+	0.015992329	0.98400766
ENST00000530640	ENST00000220616	CTSB	chr8	11705577	-	TG	chr8	134042123	+	0.016082617	0.98391736
ENST00000530640	ENST00000542445	CTSB	chr8	11705577	-	TG	chr8	134042123	+	0.015747728	0.9842523
ENST00000530640	ENST00000519543	CTSB	chr8	11705577	-	TG	chr8	134042123	+	0.015483514	0.98451644
ENST00000533455	ENST00000377869	CTSB	chr8	11705577	-	TG	chr8	134042123	+	0.017479878	0.98252004
ENST00000533455	ENST00000220616	CTSB	chr8	11705577	-	TG	chr8	134042123	+	0.017499061	0.982501
ENST00000533455	ENST00000542445	CTSB	chr8	11705577	-	TG	chr8	134042123	+	0.017302325	0.98269767
ENST00000533455	ENST00000519543	CTSB	chr8	11705577	-	TG	chr8	134042123	+	0.017146563	0.9828535

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CTSB-TG

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CTSB	chr8	11705575	TG	chr8	134042125	669	177	KGLVSGGLYESHVVQTHIRGFGGDPR
CTSB	chr8	11705575	TG	chr8	134042125	751	177	KGLVSGGLYESHVVQTHIRGFGGDPR
CTSB	chr8	11705575	TG	chr8	134042125	770	177	KGLVSGGLYESHVVQTHIRGFGGDPR

Top

Potential FusionNeoAntigen Information of CTSB-TG in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CTSB-TG_11705575_134042125.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B38:01	SHVVQTHI	0.9913	0.6862	10	18
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B15:37	SHVVQTHI	0.9905	0.5771	10	18
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B38:02	SHVVQTHI	0.9897	0.6998	10	18
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B18:01	YESHVVQTH	0.9931	0.6521	8	17
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B44:03	YESHVVQTH	0.9866	0.7521	8	17
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-A32:13	VVQTHIRGF	0.6122	0.7515	12	21
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B38:01	SHVVQTHIRGF	0.986	0.7546	10	21
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B51:07	ESHVVQTHI	0.9939	0.5104	9	18
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-C15:04	VVQTHIRGF	0.8143	0.6866	12	21
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-C12:04	VVQTHIRGF	0.1268	0.9767	12	21
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B38:05	SHVVQTHI	0.9913	0.6862	10	18
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B18:07	YESHVVQTH	0.9958	0.6095	8	17
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B18:04	YESHVVQTH	0.9958	0.6687	8	17
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B18:06	YESHVVQTH	0.994	0.6523	8	17
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B18:05	YESHVVQTH	0.9931	0.6521	8	17
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B18:03	YESHVVQTH	0.9899	0.641	8	17
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B44:26	YESHVVQTH	0.9866	0.7521	8	17
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B44:13	YESHVVQTH	0.9866	0.7521	8	17
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B44:07	YESHVVQTH	0.9866	0.7521	8	17
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B18:11	YESHVVQTH	0.9814	0.6004	8	17
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B15:24	VVQTHIRGF	0.9136	0.5232	12	21
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-A32:01	VVQTHIRGF	0.8639	0.6209	12	21
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-C15:09	VVQTHIRGF	0.8143	0.6866	12	21
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B35:20	YESHVVQTH	0.742	0.712	8	17
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B15:53	YESHVVQTH	0.6645	0.6966	8	17
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B48:02	YESHVVQTH	0.5182	0.6398	8	17
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-C02:10	VVQTHIRGF	0.2013	0.9434	12	21
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-C02:02	VVQTHIRGF	0.2013	0.9434	12	21
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-C16:02	VVQTHIRGF	0.1398	0.9742	12	21
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-A25:01	HVVQTHIRGF	0.9743	0.7298	11	21
CTSB-TG	chr8	11705575	chr8	134042125	770	HLA-B38:05	SHVVQTHIRGF	0.986	0.7546	10	21

Top

Potential FusionNeoAntigen Information of CTSB-TG in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of CTSB-TG

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2973	GLYESHVVQTHIRG	CTSB	TG	chr8	11705575	chr8	134042125	770

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CTSB-TG

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2973	GLYESHVVQTHIRG	-7.15543	-7.26883
HLA-B14:02	3BVN	2973	GLYESHVVQTHIRG	-4.77435	-5.80965
HLA-B52:01	3W39	2973	GLYESHVVQTHIRG	-6.80875	-6.92215
HLA-B52:01	3W39	2973	GLYESHVVQTHIRG	-4.20386	-5.23916
HLA-A11:01	4UQ2	2973	GLYESHVVQTHIRG	-7.5194	-8.5547
HLA-A11:01	4UQ2	2973	GLYESHVVQTHIRG	-6.9601	-7.0735
HLA-A24:02	5HGA	2973	GLYESHVVQTHIRG	-7.52403	-7.63743
HLA-A24:02	5HGA	2973	GLYESHVVQTHIRG	-5.82433	-6.85963
HLA-B27:05	6PYJ	2973	GLYESHVVQTHIRG	-3.28285	-4.31815
HLA-B44:05	3DX8	2973	GLYESHVVQTHIRG	-5.91172	-6.94702
HLA-B44:05	3DX8	2973	GLYESHVVQTHIRG	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of CTSB-TG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CTSB-TG	chr8	11705575	chr8	134042125	10	18	SHVVQTHI	CCCATGTAGTGCAGACCCACATCC
CTSB-TG	chr8	11705575	chr8	134042125	10	21	SHVVQTHIRGF	CCCATGTAGTGCAGACCCACATCCGAGGATTTG
CTSB-TG	chr8	11705575	chr8	134042125	11	21	HVVQTHIRGF	ATGTAGTGCAGACCCACATCCGAGGATTTG
CTSB-TG	chr8	11705575	chr8	134042125	12	21	VVQTHIRGF	TAGTGCAGACCCACATCCGAGGATTTG
CTSB-TG	chr8	11705575	chr8	134042125	8	17	YESHVVQTH	ATGAATCCCATGTAGTGCAGACCCACA
CTSB-TG	chr8	11705575	chr8	134042125	9	18	ESHVVQTHI	AATCCCATGTAGTGCAGACCCACATCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of CTSB-TG

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
Non-Cancer	CTSB-TG	chr8	11705575	ENST00000434271	chr8	134042125	ENST00000220616	TCGA-EL-A3TA-11A

Top

Potential target of CAR-T therapy development for CTSB-TG

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CTSB-TG

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CTSB-TG

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)