Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CUX1-EHBP1L1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CUX1-EHBP1L1
	FusionPDB ID: 20727
	FusionGDB2.0 ID: 20727
		Hgene	Tgene
	Gene symbol	CUX1	EHBP1L1
	Gene ID	1523	254102
	Gene name	cut like homeobox 1	EH domain binding protein 1 like 1
	Synonyms	CASP\|CDP\|CDP/Cut\|CDP1\|COY1\|CUTL1\|CUX\|Clox\|Cux/CDP\|GDDI\|GOLIM6\|Nbla10317\|p100\|p110\|p200\|p75	-
	Cytomap	7q22.1	11q13.1
	Type of gene	protein-coding	protein-coding
	Description	protein CASPHomeobox protein cut-like 1CCAAT displacement proteinCUX1 gene Alternatively Spliced Productcut homologgolgi integral membrane protein 6homeobox protein cux-1putative protein product of Nbla10317	EH domain-binding protein 1-like protein 1tangerin
	Modification date	20200320	20200313
	UniProtAcc	P39880 Main function of 5'-partner protein: FUNCTION: Transcription factor involved in the control of neuronal differentiation in the brain. Regulates dendrite development and branching, and dendritic spine formation in cortical layers II-III. Also involved in the control of synaptogenesis. In addition, it has probably a broad role in mammalian development as a repressor of developmentally regulated gene expression. May act by preventing binding of positively-activing CCAAT factors to promoters. Component of nf-munr repressor; binds to the matrix attachment regions (MARs) (5' and 3') of the immunoglobulin heavy chain enhancer. Represses T-cell receptor (TCR) beta enhancer function by binding to MARbeta, an ATC-rich DNA sequence located upstream of the TCR beta enhancer. Binds to the TH enhancer; may require the basic helix-loop-helix protein TCF4 as a coactivator. {ECO:0000250\|UniProtKB:P53564}.; FUNCTION: [CDP/Cux p110]: Plays a role in cell cycle progression, in particular at the G1/S transition. As cells progress into S phase, a fraction of CUX1 molecules is proteolytically processed into N-terminally truncated proteins of 110 kDa. While CUX1 only transiently binds to DNA and carries the CCAAT-displacement activity, CDP/Cux p110 makes a stable interaction with DNA and stimulates expression of genes such as POLA1. {ECO:0000269\|PubMed:15099520}.	Q8N3D4 Main function of 5'-partner protein: FUNCTION: May act as Rab effector protein and play a role in vesicle trafficking. {ECO:0000305\|PubMed:27552051}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000292538, ENST00000360264, ENST00000393824, ENST00000425244, ENST00000437600, ENST00000547394, ENST00000292535, ENST00000546411, ENST00000549414, ENST00000550008, ENST00000556210, ENST00000560541,	ENST00000529596, ENST00000533364, ENST00000309295,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	32 X 26 X 13=10816	7 X 7 X 4=196
	# samples	37	7
	** MAII score	log2(37/10816*10)=-4.86949797576587 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(7/196*10)=-1.48542682717024 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: CUX1 [Title/Abstract] AND EHBP1L1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CUX1 [Title/Abstract] AND EHBP1L1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CUX1(101459373)-EHBP1L1(65351712), # samples:2
Anticipated loss of major functional domain due to fusion event.	CUX1-EHBP1L1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CUX1-EHBP1L1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CUX1-EHBP1L1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CUX1-EHBP1L1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:101459373/chr11:65351712)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CUX1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across EHBP1L1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000437600	CUX1	chr7	101459373	+	ENST00000309295	EHBP1L1	chr11	65351712	+	2242	415	352	1893	513
ENST00000292538	CUX1	chr7	101459373	+	ENST00000309295	EHBP1L1	chr11	65351712	+	1916	89	26	1567	513
ENST00000393824	CUX1	chr7	101459373	+	ENST00000309295	EHBP1L1	chr11	65351712	+	1913	86	23	1564	513
ENST00000547394	CUX1	chr7	101459373	+	ENST00000309295	EHBP1L1	chr11	65351712	+	1912	85	22	1563	513
ENST00000360264	CUX1	chr7	101459373	+	ENST00000309295	EHBP1L1	chr11	65351712	+	1910	83	20	1561	513
ENST00000425244	CUX1	chr7	101459373	+	ENST00000309295	EHBP1L1	chr11	65351712	+	1900	73	10	1551	513

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000437600	ENST00000309295	CUX1	chr7	101459373	+	EHBP1L1	chr11	65351712	+	0.012182492	0.9878176
ENST00000292538	ENST00000309295	CUX1	chr7	101459373	+	EHBP1L1	chr11	65351712	+	0.020681635	0.9793184
ENST00000393824	ENST00000309295	CUX1	chr7	101459373	+	EHBP1L1	chr11	65351712	+	0.020989262	0.9790107
ENST00000547394	ENST00000309295	CUX1	chr7	101459373	+	EHBP1L1	chr11	65351712	+	0.020922149	0.9790779
ENST00000360264	ENST00000309295	CUX1	chr7	101459373	+	EHBP1L1	chr11	65351712	+	0.021499379	0.97850066
ENST00000425244	ENST00000309295	CUX1	chr7	101459373	+	EHBP1L1	chr11	65351712	+	0.02147218	0.97852784

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CUX1-EHBP1L1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CUX1	chr7	101459373	EHBP1L1	chr11	65351712	415	20	MFQYWKRFDLQQLQAPPALVSSSQSL
CUX1	chr7	101459373	EHBP1L1	chr11	65351712	73	20	MFQYWKRFDLQQLQAPPALVSSSQSL
CUX1	chr7	101459373	EHBP1L1	chr11	65351712	83	20	MFQYWKRFDLQQLQAPPALVSSSQSL
CUX1	chr7	101459373	EHBP1L1	chr11	65351712	85	20	MFQYWKRFDLQQLQAPPALVSSSQSL
CUX1	chr7	101459373	EHBP1L1	chr11	65351712	86	20	MFQYWKRFDLQQLQAPPALVSSSQSL
CUX1	chr7	101459373	EHBP1L1	chr11	65351712	89	20	MFQYWKRFDLQQLQAPPALVSSSQSL

Top

Potential FusionNeoAntigen Information of CUX1-EHBP1L1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CUX1-EHBP1L1_101459373_65351712.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B13:02	LQAPPALV	0.9962	0.997	12	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B52:01	LQAPPALV	0.9804	0.9977	12	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B48:01	QQLQAPPAL	0.9963	0.938	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B39:01	QQLQAPPAL	0.9913	0.9915	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B39:24	QQLQAPPAL	0.9898	0.9214	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:22	QLQAPPALV	0.9875	0.8316	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B14:01	QQLQAPPAL	0.9839	0.989	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B14:02	QQLQAPPAL	0.9839	0.989	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B39:06	QQLQAPPAL	0.9835	0.989	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B39:13	QQLQAPPAL	0.9774	0.9949	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:60	QLQAPPALV	0.9763	0.7731	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:01	QQLQAPPAL	0.9759	0.9626	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:24	QLQAPPALV	0.9755	0.7717	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:30	QLQAPPALV	0.9755	0.7717	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:67	QLQAPPALV	0.9755	0.7717	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:11	QLQAPPALV	0.9742	0.7778	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:27	QLQAPPALV	0.9703	0.7705	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:13	QLQAPPALV	0.9677	0.8327	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B38:01	QQLQAPPAL	0.9604	0.9979	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B38:02	QQLQAPPAL	0.9599	0.9979	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:16	QLQAPPALV	0.9544	0.6842	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:38	QLQAPPALV	0.9407	0.7933	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B40:05	QQLQAPPAL	0.9373	0.6518	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:29	QLQAPPALV	0.9216	0.7769	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:35	QLQAPPALV	0.914	0.7811	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:20	QLQAPPALV	0.8717	0.7796	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:19	QLQAPPALV	0.8682	0.7053	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:10	QQLQAPPAL	0.8518	0.91	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:03	QQLQAPPAL	0.8285	0.9652	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B40:01	QQLQAPPAL	0.8266	0.9264	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:18	QQLQAPPAL	0.8236	0.9454	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B13:02	QQLQAPPAL	0.8034	0.9793	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B13:01	QQLQAPPAL	0.79	0.9979	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:25	QQLQAPPAL	0.7561	0.9805	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B47:01	QQLQAPPAL	0.6882	0.7638	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:21	QQLQAPPAL	0.6518	0.8487	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:37	QQLQAPPAL	0.627	0.904	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B07:10	QQLQAPPAL	0.3545	0.5751	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B13:02	QLQAPPALV	0.2344	0.9968	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B52:01	QQLQAPPAL	0.0973	0.9981	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B27:05	KRFDLQQLQA	0.9996	0.8414	5	15
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B27:04	KRFDLQQLQA	0.9996	0.8061	5	15
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B27:07	KRFDLQQLQA	0.9993	0.8871	5	15
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B48:01	LQQLQAPPAL	0.9733	0.8907	9	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B13:02	QQLQAPPALV	0.8193	0.9966	10	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-C04:10	RFDLQQLQA	0.9988	0.9881	6	15
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-C04:07	RFDLQQLQA	0.9982	0.9878	6	15
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B39:09	QQLQAPPAL	0.9902	0.9665	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:02	QLQAPPALV	0.9879	0.8082	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B39:12	QQLQAPPAL	0.9877	0.9919	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:01	QLQAPPALV	0.9755	0.7717	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B39:05	QQLQAPPAL	0.9614	0.9896	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B39:08	QQLQAPPAL	0.9603	0.9884	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B48:03	QQLQAPPAL	0.9329	0.9414	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:04	QQLQAPPAL	0.9095	0.9775	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:05	QQLQAPPAL	0.7577	0.858	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B14:03	QQLQAPPAL	0.7553	0.9624	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:21	QQLQAPPAL	0.7431	0.97	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:05	QQLQAPPAL	0.5686	0.9557	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B27:14	KRFDLQQLQA	0.9997	0.8286	5	15
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B27:03	KRFDLQQLQA	0.989	0.8498	5	15
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B73:01	KRFDLQQLQA	0.9875	0.9577	5	15
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B48:03	LQQLQAPPAL	0.7872	0.8981	9	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B27:14	KRFDLQQLQAP	0.9999	0.7656	5	16
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B73:01	KRFDLQQLQAP	0.9974	0.965	5	16
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-C18:01	RFDLQQLQA	0.9984	0.9858	6	15
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-C04:01	RFDLQQLQA	0.9982	0.9878	6	15
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B27:06	QQLQAPPAL	0.9958	0.8665	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B39:31	QQLQAPPAL	0.9922	0.9916	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B39:02	QQLQAPPAL	0.992	0.9945	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:03	QLQAPPALV	0.9875	0.8827	11	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:27	QQLQAPPAL	0.9762	0.9764	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:125	QQLQAPPAL	0.9759	0.9626	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:33	QQLQAPPAL	0.9759	0.9626	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:34	QQLQAPPAL	0.9759	0.9626	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B38:05	QQLQAPPAL	0.9604	0.9979	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B39:11	QQLQAPPAL	0.959	0.9804	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B40:12	QQLQAPPAL	0.9329	0.9414	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:50	QQLQAPPAL	0.9275	0.9727	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:73	QQLQAPPAL	0.8912	0.9958	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B40:36	QQLQAPPAL	0.8267	0.9104	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:54	QQLQAPPAL	0.8126	0.9584	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:53	QQLQAPPAL	0.8125	0.9609	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:68	QQLQAPPAL	0.8084	0.9427	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B40:49	QQLQAPPAL	0.8055	0.9328	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B40:21	QQLQAPPAL	0.794	0.9487	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B48:02	QQLQAPPAL	0.7859	0.9681	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:30	QQLQAPPAL	0.7566	0.9956	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:12	QQLQAPPAL	0.7554	0.9547	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:39	QQLQAPPAL	0.7486	0.9703	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:09	QQLQAPPAL	0.7379	0.9762	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:14	QQLQAPPAL	0.661	0.8398	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-A02:06	QQLQAPPAL	0.6518	0.8487	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B35:13	QQLQAPPAL	0.6346	0.9597	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B35:20	QQLQAPPAL	0.5677	0.973	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:20	QQLQAPPAL	0.5597	0.9696	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B35:28	QQLQAPPAL	0.5402	0.9711	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B48:05	QQLQAPPAL	0.4728	0.5286	10	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B27:08	KRFDLQQLQA	0.9996	0.7677	5	15
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B27:10	KRFDLQQLQA	0.9996	0.8784	5	15
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B27:09	KRFDLQQLQA	0.9995	0.8329	5	15
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B27:06	KRFDLQQLQA	0.9992	0.8577	5	15
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:73	LQQLQAPPAL	0.9604	0.995	9	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B15:30	LQQLQAPPAL	0.9381	0.9946	9	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B40:12	LQQLQAPPAL	0.7872	0.8981	9	19
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	HLA-B40:21	LQQLQAPPAL	0.6397	0.9106	9	19

Top

Potential FusionNeoAntigen Information of CUX1-EHBP1L1 in HLA II

CUX1-EHBP1L1_101459373_65351712.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	DRB1-0102	RFDLQQLQAPPALVS	6	21
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	DRB1-0102	KRFDLQQLQAPPALV	5	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	DRB1-0123	RFDLQQLQAPPALVS	6	21
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	DRB1-0123	KRFDLQQLQAPPALV	5	20
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	89	DRB1-1002	RFDLQQLQAPPALVS	6	21

Top

Fusion breakpoint peptide structures of CUX1-EHBP1L1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7824	RFDLQQLQAPPALV	CUX1	EHBP1L1	chr7	101459373	chr11	65351712	89

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CUX1-EHBP1L1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7824	RFDLQQLQAPPALV	-7.9962	-8.1096
HLA-B14:02	3BVN	7824	RFDLQQLQAPPALV	-5.70842	-6.74372
HLA-B52:01	3W39	7824	RFDLQQLQAPPALV	-6.83737	-6.95077
HLA-B52:01	3W39	7824	RFDLQQLQAPPALV	-4.4836	-5.5189
HLA-A11:01	4UQ2	7824	RFDLQQLQAPPALV	-10.0067	-10.1201
HLA-A11:01	4UQ2	7824	RFDLQQLQAPPALV	-9.03915	-10.0745
HLA-A24:02	5HGA	7824	RFDLQQLQAPPALV	-6.56204	-6.67544
HLA-A24:02	5HGA	7824	RFDLQQLQAPPALV	-5.42271	-6.45801
HLA-B44:05	3DX8	7824	RFDLQQLQAPPALV	-7.85648	-8.89178
HLA-B44:05	3DX8	7824	RFDLQQLQAPPALV	-5.3978	-5.5112
HLA-A02:01	6TDR	7824	RFDLQQLQAPPALV	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of CUX1-EHBP1L1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	10	19	QQLQAPPAL	CAGCTGCAGGCACCACCTGCCCTGGTC
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	10	20	QQLQAPPALV	CAGCTGCAGGCACCACCTGCCCTGGTCAGC
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	11	20	QLQAPPALV	CTGCAGGCACCACCTGCCCTGGTCAGC
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	12	20	LQAPPALV	CAGGCACCACCTGCCCTGGTCAGC
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	5	15	KRFDLQQLQA	CGCTTTGATTTACAGCAGCTGCAGGCACCA
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	5	16	KRFDLQQLQAP	CGCTTTGATTTACAGCAGCTGCAGGCACCACCT
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	6	15	RFDLQQLQA	TTTGATTTACAGCAGCTGCAGGCACCA
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	9	19	LQQLQAPPAL	CAGCAGCTGCAGGCACCACCTGCCCTGGTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	5	20	KRFDLQQLQAPPALV	CGCTTTGATTTACAGCAGCTGCAGGCACCACCTGCCCTGGTCAGC
CUX1-EHBP1L1	chr7	101459373	chr11	65351712	6	21	RFDLQQLQAPPALVS	TTTGATTTACAGCAGCTGCAGGCACCACCTGCCCTGGTCAGCTCC

Top

Information of the samples that have these potential fusion neoantigens of CUX1-EHBP1L1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUSC	CUX1-EHBP1L1	chr7	101459373	ENST00000292538	chr11	65351712	ENST00000309295	TCGA-37-4132-01A

Top

Potential target of CAR-T therapy development for CUX1-EHBP1L1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CUX1-EHBP1L1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CUX1-EHBP1L1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)