Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:DCAF6-ILDR2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: DCAF6-ILDR2
	FusionPDB ID: 21521
	FusionGDB2.0 ID: 21521
		Hgene	Tgene
	Gene symbol	DCAF6	ILDR2
	Gene ID	55827	387597
	Gene name	DDB1 and CUL4 associated factor 6	immunoglobulin like domain containing receptor 2
	Synonyms	1200006M05Rik\|ARCAP\|IQWD1\|MSTP055\|NRIP\|PC326	C1orf32\|dJ782G3.1
	Cytomap	1q24.2	1q24.1
	Type of gene	protein-coding	protein-coding
	Description	DDB1- and CUL4-associated factor 6IQ motif and WD repeat-containing protein 1IQ motif and WD repeats 1androgen receptor complex-associated proteinnuclear receptor interaction protein	immunoglobulin-like domain-containing receptor 2
	Modification date	20200313	20200313
	UniProtAcc	Q58WW2 Main function of 5'-partner protein: FUNCTION: Ligand-dependent coactivator of nuclear receptors. Enhance transcriptional activity of the nuclear receptors NR3C1 and AR. May function as a substrate receptor for CUL4-DDB1 E3 ubiquitin-protein ligase complex. {ECO:0000269\|PubMed:15784617, ECO:0000269\|PubMed:16949367, ECO:0000269\|PubMed:16964240}.	Q71H61 Main function of 5'-partner protein: FUNCTION: May be involved in lipid homeostasis and ER stress pathways. {ECO:0000250}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000312263, ENST00000367840, ENST00000367843, ENST00000432587, ENST00000470919,	ENST00000469934, ENST00000525740, ENST00000526687, ENST00000528703, ENST00000529071, ENST00000529387, ENST00000271417,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 10 X 8=1040	6 X 6 X 4=144
	# samples	17	6
	** MAII score	log2(17/1040*10)=-2.61297687689075 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(6/144*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: DCAF6 [Title/Abstract] AND ILDR2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: DCAF6 [Title/Abstract] AND ILDR2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	DCAF6(167906246)-ILDR2(166908807), # samples:2
Anticipated loss of major functional domain due to fusion event.	DCAF6-ILDR2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DCAF6-ILDR2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DCAF6-ILDR2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DCAF6-ILDR2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:167906246/chr1:166908807)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across DCAF6 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ILDR2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000367843	DCAF6	chr1	167906246	+	ENST00000271417	ILDR2	chr1	166908807	-	7918	348	251	1768	505
ENST00000432587	DCAF6	chr1	167906246	+	ENST00000271417	ILDR2	chr1	166908807	-	7880	310	213	1730	505
ENST00000312263	DCAF6	chr1	167906246	+	ENST00000271417	ILDR2	chr1	166908807	-	7871	301	204	1721	505
ENST00000367840	DCAF6	chr1	167906246	+	ENST00000271417	ILDR2	chr1	166908807	-	7761	191	94	1611	505

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000367843	ENST00000271417	DCAF6	chr1	167906246	+	ILDR2	chr1	166908807	-	0.003314599	0.99668545
ENST00000432587	ENST00000271417	DCAF6	chr1	167906246	+	ILDR2	chr1	166908807	-	0.00338288	0.99661714
ENST00000312263	ENST00000271417	DCAF6	chr1	167906246	+	ILDR2	chr1	166908807	-	0.003395807	0.9966042
ENST00000367840	ENST00000271417	DCAF6	chr1	167906246	+	ILDR2	chr1	166908807	-	0.003212367	0.99678767

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for DCAF6-ILDR2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
DCAF6	chr1	167906246	ILDR2	chr1	166908807	191	31	LGLEDPSRLRSRYLGRTGLLADLLPS
DCAF6	chr1	167906246	ILDR2	chr1	166908807	301	31	LGLEDPSRLRSRYLGRTGLLADLLPS
DCAF6	chr1	167906246	ILDR2	chr1	166908807	310	31	LGLEDPSRLRSRYLGRTGLLADLLPS
DCAF6	chr1	167906246	ILDR2	chr1	166908807	348	31	LGLEDPSRLRSRYLGRTGLLADLLPS

Top

Potential FusionNeoAntigen Information of DCAF6-ILDR2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

DCAF6-ILDR2_167906246_166908807.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:07	SRYLGRTGL	0.9999	0.5895	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:02	SRYLGRTGL	0.9998	0.6016	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:05	SRYLGRTGL	0.9998	0.8225	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:04	SRYLGRTGL	0.9998	0.7859	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B39:24	SRYLGRTGL	0.9937	0.7624	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B39:06	SRYLGRTGL	0.9902	0.8608	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A24:23	RYLGRTGLL	0.9901	0.7112	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B14:01	SRYLGRTGL	0.9894	0.9205	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B14:02	SRYLGRTGL	0.9894	0.9205	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A24:25	RYLGRTGLL	0.9882	0.7317	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A30:08	RLRSRYLGR	0.985	0.6532	7	16
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A24:20	RYLGRTGLL	0.984	0.729	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A24:15	RYLGRTGLL	0.9837	0.7136	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A74:03	RLRSRYLGR	0.9817	0.5427	7	16
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A74:09	RLRSRYLGR	0.9817	0.5427	7	16
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A74:11	RLRSRYLGR	0.9817	0.5427	7	16
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B39:01	SRYLGRTGL	0.9813	0.9151	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A24:31	RYLGRTGLL	0.9788	0.7861	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B38:02	SRYLGRTGL	0.9594	0.9821	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A24:17	RYLGRTGLL	0.8707	0.7372	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A24:14	RYLGRTGLL	0.8316	0.6821	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A24:10	RYLGRTGLL	0.8115	0.6902	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A31:02	RLRSRYLGR	0.7935	0.5417	7	16
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A31:08	RYLGRTGLL	0.6766	0.6331	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B15:10	SRYLGRTGL	0.6603	0.7097	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B48:01	SRYLGRTGL	0.647	0.5701	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B15:18	SRYLGRTGL	0.5501	0.8707	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B15:37	SRYLGRTGL	0.3687	0.8041	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B07:10	SRYLGRTGL	0.1249	0.6254	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:02	SRYLGRTGLL	0.9999	0.5807	10	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:04	SRYLGRTGLL	0.9999	0.8062	10	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:05	SRYLGRTGLL	0.9999	0.8149	10	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:07	SRYLGRTGLL	0.9998	0.6688	10	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:02	RSRYLGRTGL	0.9958	0.6971	9	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:05	RSRYLGRTGL	0.9951	0.8618	9	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:04	RSRYLGRTGL	0.995	0.8898	9	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:07	RSRYLGRTGL	0.993	0.7764	9	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B14:01	SRYLGRTGLL	0.9545	0.9204	10	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B14:02	SRYLGRTGLL	0.9545	0.9204	10	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B07:10	SRYLGRTGLL	0.6283	0.6365	10	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:14	SRYLGRTGL	0.9998	0.7192	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:05	SRYLGRTGL	0.9981	0.9538	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:95	SRYLGRTGL	0.9974	0.748	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:27	SRYLGRTGL	0.9961	0.959	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:13	SRYLGRTGL	0.9931	0.9407	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:03	SRYLGRTGL	0.9912	0.835	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:29	SRYLGRTGL	0.9892	0.9457	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B39:09	SRYLGRTGL	0.9858	0.7955	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A31:01	RLRSRYLGR	0.9853	0.5166	7	16
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A24:02	RYLGRTGLL	0.984	0.729	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B39:12	SRYLGRTGL	0.9783	0.921	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B73:01	SRYLGRTGL	0.9758	0.7863	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B39:05	SRYLGRTGL	0.9421	0.909	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:46	SRYLGRTGL	0.9129	0.8904	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:80	SRYLGRTGL	0.8689	0.9382	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:67	SRYLGRTGL	0.8689	0.9382	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:19	SRYLGRTGL	0.8661	0.7953	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:10	SRYLGRTGL	0.8304	0.9544	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B14:03	SRYLGRTGL	0.4887	0.9459	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:05	RYLGRTGLL	0.46	0.9818	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:19	RYLGRTGLL	0.4415	0.8605	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:29	RYLGRTGLL	0.4247	0.9628	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:67	RYLGRTGLL	0.4142	0.9714	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:80	RYLGRTGLL	0.4142	0.9714	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:10	RYLGRTGLL	0.4063	0.984	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:13	RYLGRTGLL	0.3971	0.9628	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:46	RYLGRTGLL	0.3831	0.9454	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C12:16	SRYLGRTGL	0.21	0.9662	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:14	SRYLGRTGLL	0.9999	0.7301	10	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:03	SRYLGRTGLL	0.9969	0.8278	10	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:14	RSRYLGRTGL	0.9956	0.8221	9	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:03	RSRYLGRTGL	0.8856	0.8692	9	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:14	SRYLGRTGLLA	0.9999	0.5977	10	21
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B73:01	SRYLGRTGLLA	0.9997	0.8299	10	21
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C14:03	RYLGRTGL	0.7945	0.9862	11	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C14:02	RYLGRTGL	0.7945	0.9862	11	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:06	SRYLGRTGL	0.9999	0.7706	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:08	SRYLGRTGL	0.9998	0.7169	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:10	SRYLGRTGL	0.9998	0.8911	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:09	SRYLGRTGL	0.9998	0.7921	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:01	SRYLGRTGL	0.9977	0.7582	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A24:03	RYLGRTGLL	0.9901	0.7112	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A30:01	RLRSRYLGR	0.9879	0.8431	7	16
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-A74:01	RLRSRYLGR	0.9817	0.5427	7	16
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B39:31	SRYLGRTGL	0.9805	0.9175	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C06:08	SRYLGRTGL	0.9792	0.9882	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:17	SRYLGRTGL	0.9558	0.9586	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:04	SRYLGRTGL	0.8864	0.9858	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:02	SRYLGRTGL	0.8689	0.9382	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:22	SRYLGRTGL	0.8212	0.7913	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C03:67	SRYLGRTGL	0.448	0.988	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B15:09	SRYLGRTGL	0.4228	0.8999	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C07:02	RYLGRTGLL	0.4142	0.9714	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C06:06	SRYLGRTGL	0.3219	0.9929	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C06:02	SRYLGRTGL	0.2988	0.9932	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C06:17	SRYLGRTGL	0.2988	0.9932	10	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C06:06	RYLGRTGLL	0.228	0.9963	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C14:03	RYLGRTGLL	0.1547	0.9884	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-C14:02	RYLGRTGLL	0.1547	0.9884	11	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:08	SRYLGRTGLL	0.9999	0.702	10	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:06	SRYLGRTGLL	0.9999	0.8112	10	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:10	SRYLGRTGLL	0.9999	0.9014	10	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:09	SRYLGRTGLL	0.9997	0.8061	10	20
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:10	RSRYLGRTGL	0.9955	0.9411	9	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:06	RSRYLGRTGL	0.9945	0.8998	9	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:08	RSRYLGRTGL	0.9936	0.7957	9	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:09	RSRYLGRTGL	0.9882	0.8226	9	19
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	HLA-B27:06	LRSRYLGRTGL	0.9997	0.9195	8	19

Top

Potential FusionNeoAntigen Information of DCAF6-ILDR2 in HLA II

DCAF6-ILDR2_167906246_166908807.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DCAF6-ILDR2	chr1	167906246	chr1	166908807	301	DRB1-0103	LRSRYLGRTGLLADL	8	23

Top

Fusion breakpoint peptide structures of DCAF6-ILDR2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8966	SRLRSRYLGRTGLL	DCAF6	ILDR2	chr1	167906246	chr1	166908807	301

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of DCAF6-ILDR2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8966	SRLRSRYLGRTGLL	-7.15543	-7.26883
HLA-B14:02	3BVN	8966	SRLRSRYLGRTGLL	-4.77435	-5.80965
HLA-B52:01	3W39	8966	SRLRSRYLGRTGLL	-6.80875	-6.92215
HLA-B52:01	3W39	8966	SRLRSRYLGRTGLL	-4.20386	-5.23916
HLA-A11:01	4UQ2	8966	SRLRSRYLGRTGLL	-7.5194	-8.5547
HLA-A11:01	4UQ2	8966	SRLRSRYLGRTGLL	-6.9601	-7.0735
HLA-A24:02	5HGA	8966	SRLRSRYLGRTGLL	-7.52403	-7.63743
HLA-A24:02	5HGA	8966	SRLRSRYLGRTGLL	-5.82433	-6.85963
HLA-B27:05	6PYJ	8966	SRLRSRYLGRTGLL	-3.28285	-4.31815
HLA-B44:05	3DX8	8966	SRLRSRYLGRTGLL	-5.91172	-6.94702
HLA-B44:05	3DX8	8966	SRLRSRYLGRTGLL	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of DCAF6-ILDR2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
DCAF6-ILDR2	chr1	167906246	chr1	166908807	10	19	SRYLGRTGL	GATACCTGGGCAGGACAGGGCTGCTTG
DCAF6-ILDR2	chr1	167906246	chr1	166908807	10	20	SRYLGRTGLL	GATACCTGGGCAGGACAGGGCTGCTTGCTG
DCAF6-ILDR2	chr1	167906246	chr1	166908807	10	21	SRYLGRTGLLA	GATACCTGGGCAGGACAGGGCTGCTTGCTGATC
DCAF6-ILDR2	chr1	167906246	chr1	166908807	11	19	RYLGRTGL	ACCTGGGCAGGACAGGGCTGCTTG
DCAF6-ILDR2	chr1	167906246	chr1	166908807	11	20	RYLGRTGLL	ACCTGGGCAGGACAGGGCTGCTTGCTG
DCAF6-ILDR2	chr1	167906246	chr1	166908807	7	16	RLRSRYLGR	TGCGGAGTCGATACCTGGGCAGGACAG
DCAF6-ILDR2	chr1	167906246	chr1	166908807	8	19	LRSRYLGRTGL	GGAGTCGATACCTGGGCAGGACAGGGCTGCTTG
DCAF6-ILDR2	chr1	167906246	chr1	166908807	9	19	RSRYLGRTGL	GTCGATACCTGGGCAGGACAGGGCTGCTTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
DCAF6-ILDR2	chr1	167906246	chr1	166908807	8	23	LRSRYLGRTGLLADL	GGAGTCGATACCTGGGCAGGACAGGGCTGCTTGCTGATCTCTTGC

Top

Information of the samples that have these potential fusion neoantigens of DCAF6-ILDR2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	DCAF6-ILDR2	chr1	167906246	ENST00000312263	chr1	166908807	ENST00000271417	TCGA-55-7576-01A

Top

Potential target of CAR-T therapy development for DCAF6-ILDR2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

ILDR2

chr1:167906246

chr1:166908807

ENST00000271417

187_207

640.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to DCAF6-ILDR2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to DCAF6-ILDR2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)