Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:DCBLD1-MCM9

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: DCBLD1-MCM9
	FusionPDB ID: 21564
	FusionGDB2.0 ID: 21564
		Hgene	Tgene
	Gene symbol	DCBLD1	MCM9
	Gene ID	285761	254394
	Gene name	discoidin, CUB and LCCL domain containing 1	minichromosome maintenance 9 homologous recombination repair factor
	Synonyms	dJ94G16.1	C6orf61\|MCMDC1\|ODG4\|dJ329L24.1\|dJ329L24.3
	Cytomap	6q22.1	6q22.31
	Type of gene	protein-coding	protein-coding
	Description	discoidin, CUB and LCCL domain-containing protein 1	DNA helicase MCM9DNA replication licensing factor MCM9mini-chromosome maintenance deficient domain-containing protein 1minichromosome maintenance complex component 9
	Modification date	20200313	20200313
	UniProtAcc	Q8N8Z6 Main function of 5'-partner protein:	Q9NXL9 Main function of 5'-partner protein: FUNCTION: Component of the MCM8-MCM9 complex, a complex involved in the repair of double-stranded DNA breaks (DBSs) and DNA interstrand cross-links (ICLs) by homologous recombination (HR) (PubMed:23401855). Required for DNA resection by the MRE11-RAD50-NBN/NBS1 (MRN) complex by recruiting the MRN complex to the repair site and by promoting the complex nuclease activity (PubMed:26215093). Probably by regulating the localization of the MRN complex, indirectly regulates the recruitment of downstream effector RAD51 to DNA damage sites including DBSs and ICLs (PubMed:23401855). Acts as a helicase in DNA mismatch repair (MMR) following DNA replication errors to unwind the mismatch containing DNA strand (PubMed:26300262). In addition, recruits MLH1, a component of the MMR complex, to chromatin (PubMed:26300262). The MCM8-MCM9 complex is dispensable for DNA replication and S phase progression (PubMed:23401855). Probably by regulating HR, plays a key role during gametogenesis (By similarity). {ECO:0000250\|UniProtKB:Q2KHI9, ECO:0000269\|PubMed:23401855, ECO:0000269\|PubMed:26215093, ECO:0000269\|PubMed:26300262}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000296955, ENST00000338728, ENST00000368503, ENST00000534777,	ENST00000505485, ENST00000316068, ENST00000316316,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	8 X 6 X 5=240	5 X 5 X 4=100
	# samples	8	5
	** MAII score	log2(8/240*10)=-1.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(5/100*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: DCBLD1 [Title/Abstract] AND MCM9 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: DCBLD1 [Title/Abstract] AND MCM9 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	DCBLD1(117825142)-MCM9(119177708), # samples:1
Anticipated loss of major functional domain due to fusion event.	DCBLD1-MCM9 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DCBLD1-MCM9 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DCBLD1-MCM9 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DCBLD1-MCM9 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	MCM9	GO:0000724	double-strand break repair via homologous recombination	22771115
Tgene	MCM9	GO:0006974	cellular response to DNA damage stimulus	22771115

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:117825142/chr6:119177708)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across DCBLD1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MCM9 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000368503	DCBLD1	chr6	117825142	+	ENST00000316316	MCM9	chr6	119177708	-	4114	450	8	2731	907
ENST00000296955	DCBLD1	chr6	117825142	+	ENST00000316316	MCM9	chr6	119177708	-	4114	450	8	2731	907
ENST00000338728	DCBLD1	chr6	117825142	+	ENST00000316316	MCM9	chr6	119177708	-	4109	445	3	2726	907

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000368503	ENST00000316316	DCBLD1	chr6	117825142	+	MCM9	chr6	119177708	-	0.00048133	0.99951863
ENST00000296955	ENST00000316316	DCBLD1	chr6	117825142	+	MCM9	chr6	119177708	-	0.00048133	0.99951863
ENST00000338728	ENST00000316316	DCBLD1	chr6	117825142	+	MCM9	chr6	119177708	-	0.000468329	0.99953175

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for DCBLD1-MCM9

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
DCBLD1	chr6	117825142	MCM9	chr6	119177708	445	147	SDYLLFTSSSDQYGLTVTAVKDSGEW
DCBLD1	chr6	117825142	MCM9	chr6	119177708	450	147	SDYLLFTSSSDQYGLTVTAVKDSGEW

Top

Potential FusionNeoAntigen Information of DCBLD1-MCM9 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

DCBLD1-MCM9_117825142_119177708.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B14:01	DQYGLTVTA	0.9956	0.936	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B14:02	DQYGLTVTA	0.9956	0.936	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B39:06	DQYGLTVTA	0.9689	0.9611	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B15:37	DQYGLTVTA	0.9564	0.6809	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B50:01	DQYGLTVTA	0.9402	0.9305	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B50:02	DQYGLTVTA	0.915	0.784	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B39:01	DQYGLTVTA	0.82	0.9402	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B18:01	DQYGLTVTA	0.6328	0.8577	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C05:09	SSDQYGLTV	0.9999	0.9004	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C04:10	SSDQYGLTV	0.9999	0.8196	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C04:07	SSDQYGLTV	0.9998	0.8066	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C08:15	SSDQYGLTV	0.9997	0.8803	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B73:01	DQYGLTVTA	0.9822	0.8974	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C15:06	SSDQYGLTV	0.9736	0.8351	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C03:07	SSDQYGLTV	0.9727	0.9297	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C04:06	SSDQYGLTV	0.9627	0.786	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B39:09	DQYGLTVTA	0.8199	0.8961	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B78:01	DQYGLTVTA	0.8097	0.9005	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C03:19	SSDQYGLTV	0.7596	0.969	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B51:07	DQYGLTVTA	0.7395	0.9809	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B39:05	DQYGLTVTA	0.7236	0.9324	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C04:14	SSDQYGLTV	0.721	0.851	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B14:03	DQYGLTVTA	0.7159	0.8438	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C08:13	SSDQYGLTV	0.6453	0.8281	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C08:04	SSDQYGLTV	0.6453	0.8281	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C08:03	SSDQYGLTV	0.2373	0.9515	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C02:06	SSDQYGLTV	0.117	0.9027	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B51:07	DQYGLTVTAV	0.815	0.9816	10	20
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B15:04	SDQYGLTVTA	0.7479	0.8061	9	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C04:03	SSDQYGLTV	0.9999	0.8396	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C05:01	SSDQYGLTV	0.9999	0.9004	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C04:01	SSDQYGLTV	0.9998	0.8066	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C18:01	SSDQYGLTV	0.9998	0.834	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C01:03	SSDQYGLTV	0.9997	0.7927	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C08:02	SSDQYGLTV	0.9997	0.8803	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C15:02	SSDQYGLTV	0.9883	0.7492	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C15:05	SSDQYGLTV	0.9803	0.7943	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B50:05	DQYGLTVTA	0.9402	0.9305	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B50:04	DQYGLTVTA	0.9402	0.9305	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C04:04	SSDQYGLTV	0.9139	0.7636	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B39:31	DQYGLTVTA	0.8352	0.9396	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B18:04	DQYGLTVTA	0.8264	0.8647	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B78:02	DQYGLTVTA	0.7463	0.919	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C03:06	SSDQYGLTV	0.6822	0.9719	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B18:06	DQYGLTVTA	0.6338	0.8844	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B18:05	DQYGLTVTA	0.6328	0.8577	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B18:08	DQYGLTVTA	0.6071	0.9023	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B18:03	DQYGLTVTA	0.6004	0.8405	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B15:09	DQYGLTVTA	0.5055	0.9246	10	19
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C17:01	SSDQYGLTV	0.3454	0.8009	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C08:01	SSDQYGLTV	0.2373	0.9515	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-C07:04	SSDQYGLTV	0.1127	0.9146	8	17
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	HLA-B07:13	SSDQYGLTV	0.0029	0.6544	8	17

Top

Potential FusionNeoAntigen Information of DCBLD1-MCM9 in HLA II

DCBLD1-MCM9_117825142_119177708.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	DRB1-0486	SDYLLFTSSSDQYGL	0	15
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	DRB5-0101	SDQYGLTVTAVKDSG	9	24
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	DRB5-0105	SDQYGLTVTAVKDSG	9	24
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	DRB5-0112	SDQYGLTVTAVKDSG	9	24
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	DRB5-0112	SSDQYGLTVTAVKDS	8	23
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	DRB5-0113	SDQYGLTVTAVKDSG	9	24
DCBLD1-MCM9	chr6	117825142	chr6	119177708	450	DRB5-0114	SDQYGLTVTAVKDSG	9	24

Top

Fusion breakpoint peptide structures of DCBLD1-MCM9

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9674	TSSSDQYGLTVTAV	DCBLD1	MCM9	chr6	117825142	chr6	119177708	450

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of DCBLD1-MCM9

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9674	TSSSDQYGLTVTAV	-8.46672	-8.58012
HLA-B14:02	3BVN	9674	TSSSDQYGLTVTAV	-4.13749	-5.17279
HLA-B52:01	3W39	9674	TSSSDQYGLTVTAV	-7.85514	-7.96854
HLA-B52:01	3W39	9674	TSSSDQYGLTVTAV	-2.01447	-3.04977
HLA-A11:01	4UQ2	9674	TSSSDQYGLTVTAV	-9.68879	-9.80219
HLA-A24:02	5HGA	9674	TSSSDQYGLTVTAV	-8.7721	-8.8855
HLA-A24:02	5HGA	9674	TSSSDQYGLTVTAV	-5.53899	-6.57429
HLA-B44:05	3DX8	9674	TSSSDQYGLTVTAV	-7.04417	-7.15757
HLA-B44:05	3DX8	9674	TSSSDQYGLTVTAV	-3.2143	-4.2496

Top

Vaccine Design for the FusionNeoAntigens of DCBLD1-MCM9

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
DCBLD1-MCM9	chr6	117825142	chr6	119177708	10	19	DQYGLTVTA	ATCAATATGGTCTGACGGTAACTGCTG
DCBLD1-MCM9	chr6	117825142	chr6	119177708	10	20	DQYGLTVTAV	ATCAATATGGTCTGACGGTAACTGCTGTAA
DCBLD1-MCM9	chr6	117825142	chr6	119177708	8	17	SSDQYGLTV	CTTCAGATCAATATGGTCTGACGGTAA
DCBLD1-MCM9	chr6	117825142	chr6	119177708	9	19	SDQYGLTVTA	CAGATCAATATGGTCTGACGGTAACTGCTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
DCBLD1-MCM9	chr6	117825142	chr6	119177708	0	15	SDYLLFTSSSDQYGL	CTGACTATCTTCTCTTCACCAGCTCTTCAGATCAATATGGTCTGA
DCBLD1-MCM9	chr6	117825142	chr6	119177708	8	23	SSDQYGLTVTAVKDS	CTTCAGATCAATATGGTCTGACGGTAACTGCTGTAAAAGACTCAG
DCBLD1-MCM9	chr6	117825142	chr6	119177708	9	24	SDQYGLTVTAVKDSG	CAGATCAATATGGTCTGACGGTAACTGCTGTAAAAGACTCAGGAG

Top

Information of the samples that have these potential fusion neoantigens of DCBLD1-MCM9

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	DCBLD1-MCM9	chr6	117825142	ENST00000296955	chr6	119177708	ENST00000316316	TCGA-BR-A4IY-01A

Top

Potential target of CAR-T therapy development for DCBLD1-MCM9

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to DCBLD1-MCM9

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to DCBLD1-MCM9

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)