Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ADCK1-SLIRP

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ADCK1-SLIRP
	FusionPDB ID: 2191
	FusionGDB2.0 ID: 2191
		Hgene	Tgene
	Gene symbol	ADCK1	SLIRP
	Gene ID	57143	81892
	Gene name	aarF domain containing kinase 1	SRA stem-loop interacting RNA binding protein
	Synonyms	-	C14orf156\|DC50\|PD04872
	Cytomap	14q24.3	14q24.3
	Type of gene	protein-coding	protein-coding
	Description	aarF domain-containing protein kinase 1	SRA stem-loop-interacting RNA-binding protein, mitochondrial
	Modification date	20200313	20200313
	UniProtAcc	Q86TW2 Main function of 5'-partner protein: FUNCTION: Appears to be essential for maintaining mitochondrial cristae formation and mitochondrial function by acting via YME1L1 in a kinase-independent manner to regulate essential mitochondrial structural proteins OPA1 and IMMT (PubMed:31125351). The action of this enzyme is not yet clear (Probable). It is not known if it has protein kinase activity and what type of substrate it would phosphorylate (Ser, Thr or Tyr) (Probable). {ECO:0000269\|PubMed:31125351, ECO:0000305}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000238561, ENST00000341211, ENST00000556560,	ENST00000238688, ENST00000557342, ENST00000557431, ENST00000557623,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	1 X 1 X 1=1	5 X 5 X 3=75
	# samples	1	6
	** MAII score	log2(1/1*10)=3.32192809488736	log2(6/75*10)=-0.321928094887362 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ADCK1 [Title/Abstract] AND SLIRP [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ADCK1 [Title/Abstract] AND SLIRP [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ADCK1(78288861)-SLIRP(78182115), # samples:1
Anticipated loss of major functional domain due to fusion event.	ADCK1-SLIRP seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ADCK1-SLIRP seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr14:78288861/chr14:78182115)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ADCK1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SLIRP (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000238561	ADCK1	chr14	78288861	+	ENST00000557342	SLIRP	chr14	78182115	+	529	318	6	491	161
ENST00000238561	ADCK1	chr14	78288861	+	ENST00000238688	SLIRP	chr14	78182115	+	523	318	6	485	159
ENST00000238561	ADCK1	chr14	78288861	+	ENST00000557623	SLIRP	chr14	78182115	+	1018	318	6	458	150
ENST00000238561	ADCK1	chr14	78288861	+	ENST00000557431	SLIRP	chr14	78182115	+	878	318	6	536	176
ENST00000341211	ADCK1	chr14	78288861	+	ENST00000557342	SLIRP	chr14	78182115	+	473	262	43	435	130
ENST00000341211	ADCK1	chr14	78288861	+	ENST00000238688	SLIRP	chr14	78182115	+	467	262	43	429	128
ENST00000341211	ADCK1	chr14	78288861	+	ENST00000557623	SLIRP	chr14	78182115	+	962	262	43	402	119
ENST00000341211	ADCK1	chr14	78288861	+	ENST00000557431	SLIRP	chr14	78182115	+	822	262	43	480	145

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000238561	ENST00000557342	ADCK1	chr14	78288861	+	SLIRP	chr14	78182115	+	0.009174901	0.9908251
ENST00000238561	ENST00000238688	ADCK1	chr14	78288861	+	SLIRP	chr14	78182115	+	0.010744778	0.9892552
ENST00000238561	ENST00000557623	ADCK1	chr14	78288861	+	SLIRP	chr14	78182115	+	0.014199868	0.98580015
ENST00000238561	ENST00000557431	ADCK1	chr14	78288861	+	SLIRP	chr14	78182115	+	0.048730545	0.95126945
ENST00000341211	ENST00000557342	ADCK1	chr14	78288861	+	SLIRP	chr14	78182115	+	0.008392382	0.99160767
ENST00000341211	ENST00000238688	ADCK1	chr14	78288861	+	SLIRP	chr14	78182115	+	0.009700132	0.9902998
ENST00000341211	ENST00000557623	ADCK1	chr14	78288861	+	SLIRP	chr14	78182115	+	0.014950899	0.98504907
ENST00000341211	ENST00000557431	ADCK1	chr14	78288861	+	SLIRP	chr14	78182115	+	0.05490963	0.94509035

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ADCK1-SLIRP

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ADCK1	chr14	78288861	SLIRP	chr14	78182115	262	73	PYGSEEYLQLRSKDKETGFHRGLGWV
ADCK1	chr14	78288861	SLIRP	chr14	78182115	318	104	PYGSEEYLQLRSKDKETGFHRGLGWV

Top

Potential FusionNeoAntigen Information of ADCK1-SLIRP in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ADCK1-SLIRP_78288861_78182115.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B57:01	RSKDKETGF	0.9945	0.9383	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B15:01	RSKDKETGF	0.9912	0.8178	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B58:02	RSKDKETGF	0.9879	0.8326	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B15:17	RSKDKETGF	0.9846	0.8532	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B15:16	RSKDKETGF	0.978	0.7876	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B57:03	RSKDKETGF	0.9358	0.9416	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-A30:08	RSKDKETGF	0.7038	0.8243	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-A32:13	RSKDKETGF	0.5906	0.8659	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-A31:02	RSKDKETGFHR	0.9909	0.5046	10	21
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B15:07	RSKDKETGF	0.9881	0.7456	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-C15:04	RSKDKETGF	0.9826	0.9455	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-C12:12	RSKDKETGF	0.8802	0.9106	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B57:10	RSKDKETGF	0.9945	0.9383	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B57:04	RSKDKETGF	0.993	0.7804	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B58:06	RSKDKETGF	0.9913	0.7579	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B15:33	RSKDKETGF	0.9912	0.8178	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B15:125	RSKDKETGF	0.9912	0.8178	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B15:34	RSKDKETGF	0.9912	0.8178	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B15:135	RSKDKETGF	0.991	0.8622	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B15:24	RSKDKETGF	0.9892	0.8559	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B15:35	RSKDKETGF	0.986	0.7985	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-C15:09	RSKDKETGF	0.9826	0.9455	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B15:68	RSKDKETGF	0.9617	0.6735	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B15:50	RSKDKETGF	0.9508	0.7791	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-A32:01	RSKDKETGF	0.9362	0.8892	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-B57:02	RSKDKETGF	0.7611	0.8976	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-C16:02	RSKDKETGF	0.5879	0.9887	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-C02:10	RSKDKETGF	0.0887	0.9507	10	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	HLA-C02:02	RSKDKETGF	0.0887	0.9507	10	19

Top

Potential FusionNeoAntigen Information of ADCK1-SLIRP in HLA II

ADCK1-SLIRP_78288861_78182115.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB1-1103	YLQLRSKDKETGFHR	6	21
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB1-1141	YLQLRSKDKETGFHR	6	21
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB1-1155	YLQLRSKDKETGFHR	6	21
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB1-1159	YLQLRSKDKETGFHR	6	21
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB1-1163	YLQLRSKDKETGFHR	6	21
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB1-1176	YLQLRSKDKETGFHR	6	21
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB1-1185	YLQLRSKDKETGFHR	6	21
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB1-1324	YLQLRSKDKETGFHR	6	21
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0101	SEEYLQLRSKDKETG	3	18
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0101	GSEEYLQLRSKDKET	2	17
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0101	YGSEEYLQLRSKDKE	1	16
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0101	EEYLQLRSKDKETGF	4	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0102	SEEYLQLRSKDKETG	3	18
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0102	GSEEYLQLRSKDKET	2	17
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0102	YGSEEYLQLRSKDKE	1	16
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0102	EEYLQLRSKDKETGF	4	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0103	SEEYLQLRSKDKETG	3	18
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0103	GSEEYLQLRSKDKET	2	17
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0104	SEEYLQLRSKDKETG	3	18
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0104	GSEEYLQLRSKDKET	2	17
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0104	YGSEEYLQLRSKDKE	1	16
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0105	SEEYLQLRSKDKETG	3	18
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0105	GSEEYLQLRSKDKET	2	17
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0105	YGSEEYLQLRSKDKE	1	16
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0105	EEYLQLRSKDKETGF	4	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0108N	SEEYLQLRSKDKETG	3	18
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0108N	GSEEYLQLRSKDKET	2	17
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0108N	YGSEEYLQLRSKDKE	1	16
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0108N	EEYLQLRSKDKETGF	4	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0113	SEEYLQLRSKDKETG	3	18
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0113	GSEEYLQLRSKDKET	2	17
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0113	YGSEEYLQLRSKDKE	1	16
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0113	EEYLQLRSKDKETGF	4	19
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0114	SEEYLQLRSKDKETG	3	18
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0114	GSEEYLQLRSKDKET	2	17
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0114	YGSEEYLQLRSKDKE	1	16
ADCK1-SLIRP	chr14	78288861	chr14	78182115	318	DRB5-0114	EEYLQLRSKDKETGF	4	19

Top

Fusion breakpoint peptide structures of ADCK1-SLIRP

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10717	YLQLRSKDKETGFH	ADCK1	SLIRP	chr14	78288861	chr14	78182115	318

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ADCK1-SLIRP

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10717	YLQLRSKDKETGFH	-6.69561	-6.80901
HLA-B14:02	3BVN	10717	YLQLRSKDKETGFH	-4.57314	-5.60844
HLA-B52:01	3W39	10717	YLQLRSKDKETGFH	-8.26982	-8.38322
HLA-B52:01	3W39	10717	YLQLRSKDKETGFH	-4.20619	-5.24149
HLA-A11:01	4UQ2	10717	YLQLRSKDKETGFH	-6.38936	-6.50276
HLA-A11:01	4UQ2	10717	YLQLRSKDKETGFH	-5.4102	-6.4455
HLA-A24:02	5HGA	10717	YLQLRSKDKETGFH	-7.10684	-7.22024
HLA-A24:02	5HGA	10717	YLQLRSKDKETGFH	-5.37582	-6.41112
HLA-B44:05	3DX8	10717	YLQLRSKDKETGFH	-5.61918	-5.73258
HLA-B44:05	3DX8	10717	YLQLRSKDKETGFH	-4.56468	-5.59998

Top

Vaccine Design for the FusionNeoAntigens of ADCK1-SLIRP

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ADCK1-SLIRP	chr14	78288861	chr14	78182115	10	19	RSKDKETGF	AGATCTAAGGACAAGGAGACTGGCTTT
ADCK1-SLIRP	chr14	78288861	chr14	78182115	10	21	RSKDKETGFHR	AGATCTAAGGACAAGGAGACTGGCTTTCACAGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
ADCK1-SLIRP	chr14	78288861	chr14	78182115	1	16	YGSEEYLQLRSKDKE	TATGGCTCAGAGGAGTACTTGCAGCTGAGATCTAAGGACAAGGAG
ADCK1-SLIRP	chr14	78288861	chr14	78182115	2	17	GSEEYLQLRSKDKET	GGCTCAGAGGAGTACTTGCAGCTGAGATCTAAGGACAAGGAGACT
ADCK1-SLIRP	chr14	78288861	chr14	78182115	3	18	SEEYLQLRSKDKETG	TCAGAGGAGTACTTGCAGCTGAGATCTAAGGACAAGGAGACTGGC
ADCK1-SLIRP	chr14	78288861	chr14	78182115	4	19	EEYLQLRSKDKETGF	GAGGAGTACTTGCAGCTGAGATCTAAGGACAAGGAGACTGGCTTT
ADCK1-SLIRP	chr14	78288861	chr14	78182115	6	21	YLQLRSKDKETGFHR	TACTTGCAGCTGAGATCTAAGGACAAGGAGACTGGCTTTCACAGA

Top

Information of the samples that have these potential fusion neoantigens of ADCK1-SLIRP

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
UCEC	ADCK1-SLIRP	chr14	78288861	ENST00000238561	chr14	78182115	ENST00000238688	TCGA-EY-A54A-01A

Top

Potential target of CAR-T therapy development for ADCK1-SLIRP

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ADCK1-SLIRP

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ADCK1-SLIRP

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)