![]() |
|||||||
|
Fusion Protein:DGAT1-TONSL |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: DGAT1-TONSL | FusionPDB ID: 22392 | FusionGDB2.0 ID: 22392 | Hgene | Tgene | Gene symbol | DGAT1 | TONSL | Gene ID | 8694 | 4796 |
Gene name | diacylglycerol O-acyltransferase 1 | tonsoku like, DNA repair protein | |
Synonyms | ARAT|ARGP1|DGAT|DIAR7 | IKBR|NFKBIL2|SEMDSP | |
Cytomap | 8q24.3 | 8q24.3 | |
Type of gene | protein-coding | protein-coding | |
Description | diacylglycerol O-acyltransferase 1ACAT related gene product 1acyl coenzyme A:cholesterol acyltransferase related gene 1acyl-CoA retinol O-fatty-acyltransferaseacyl-CoA:diacylglycerol acyltransferasediacylglycerol O-acyltransferase homologdiglyceride | tonsoku-like proteinI-kappa-B-related proteinNF-kappa-B inhibitor-like protein 2ikappaBRinhibitor of kappa B-related proteinnuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | O75907 Main function of 5'-partner protein: FUNCTION: Catalyzes the terminal and only committed step in triacylglycerol synthesis by using diacylglycerol and fatty acyl CoA as substrates (PubMed:16214399, PubMed:18768481, PubMed:28420705, PubMed:9756920, PubMed:32433611, PubMed:32433610). Highly expressed in epithelial cells of the small intestine and its activity is essential for the absorption of dietary fats (PubMed:18768481). In liver, plays a role in esterifying exogenous fatty acids to glycerol, and is required to synthesize fat for storage (PubMed:16214399). Also present in female mammary glands, where it produces fat in the milk (By similarity). May be involved in VLDL (very low density lipoprotein) assembly (PubMed:18768481). In contrast to DGAT2 it is not essential for survival (By similarity). Functions as the major acyl-CoA retinol acyltransferase (ARAT) in the skin, where it acts to maintain retinoid homeostasis and prevent retinoid toxicity leading to skin and hair disorders (PubMed:16214399). Exhibits additional acyltransferase activities, includin acyl CoA:monoacylglycerol acyltransferase (MGAT), wax monoester and wax diester synthases (By similarity). Also able to use 1-monoalkylglycerol (1-MAkG) as an acyl acceptor for the synthesis of monoalkyl-monoacylglycerol (MAMAG) (PubMed:28420705). {ECO:0000250|UniProtKB:Q8MK44, ECO:0000250|UniProtKB:Q9Z2A7, ECO:0000269|PubMed:16214399, ECO:0000269|PubMed:18768481, ECO:0000269|PubMed:28420705, ECO:0000269|PubMed:32433610, ECO:0000269|PubMed:32433611, ECO:0000269|PubMed:9756920}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000332324, ENST00000531896, ENST00000527438, | ENST00000409379, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 6 X 7 X 4=168 | 7 X 7 X 4=196 |
# samples | 7 | 8 | |
** MAII score | log2(7/168*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(8/196*10)=-1.29278174922785 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: DGAT1 [Title/Abstract] AND TONSL [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: DGAT1 [Title/Abstract] AND TONSL [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | DGAT1(145544983)-TONSL(145662482), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | DGAT1-TONSL seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DGAT1-TONSL seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DGAT1-TONSL seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DGAT1-TONSL seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | DGAT1 | GO:0019432 | triglyceride biosynthetic process | 18238778|18458083 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:145544983/chr8:145662482) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000332324 | DGAT1 | chr8 | 145544983 | - | ENST00000409379 | TONSL | chr8 | 145662482 | - | 3381 | 562 | 121 | 3045 | 974 |
ENST00000531896 | DGAT1 | chr8 | 145544983 | - | ENST00000409379 | TONSL | chr8 | 145662482 | - | 3145 | 326 | 38 | 2809 | 923 |
ENST00000332324 | DGAT1 | chr8 | 145544984 | - | ENST00000409379 | TONSL | chr8 | 145662482 | - | 3381 | 562 | 121 | 3045 | 974 |
ENST00000531896 | DGAT1 | chr8 | 145544984 | - | ENST00000409379 | TONSL | chr8 | 145662482 | - | 3145 | 326 | 38 | 2809 | 923 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000332324 | ENST00000409379 | DGAT1 | chr8 | 145544983 | - | TONSL | chr8 | 145662482 | - | 0.038267788 | 0.9617322 |
ENST00000531896 | ENST00000409379 | DGAT1 | chr8 | 145544983 | - | TONSL | chr8 | 145662482 | - | 0.04454134 | 0.95545864 |
ENST00000332324 | ENST00000409379 | DGAT1 | chr8 | 145544984 | - | TONSL | chr8 | 145662482 | - | 0.038267788 | 0.9617322 |
ENST00000531896 | ENST00000409379 | DGAT1 | chr8 | 145544984 | - | TONSL | chr8 | 145662482 | - | 0.04454134 | 0.95545864 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for DGAT1-TONSL |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
DGAT1 | chr8 | 145544983 | TONSL | chr8 | 145662482 | 326 | 96 | NYRGILNWCVVMLGHPLNPRDYCGWT |
DGAT1 | chr8 | 145544983 | TONSL | chr8 | 145662482 | 562 | 16 | LVRRSPGLRRPAGGSGGRCLGPGGGA |
DGAT1 | chr8 | 145544984 | TONSL | chr8 | 145662482 | 326 | 96 | NYRGILNWCVVMLGHPLNPRDYCGWT |
DGAT1 | chr8 | 145544984 | TONSL | chr8 | 145662482 | 562 | 16 | LVRRSPGLRRPAGGSGGRCLGPGGGA |
Top |
Potential FusionNeoAntigen Information of DGAT1-TONSL in HLA I |
![]() |
DGAT1-TONSL_145544983_145662482.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 326 | HLA-A74:09 | MLGHPLNPR | 0.973 | 0.8064 | 11 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 326 | HLA-A74:03 | MLGHPLNPR | 0.973 | 0.8064 | 11 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 326 | HLA-A74:11 | MLGHPLNPR | 0.973 | 0.8064 | 11 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 326 | HLA-A31:06 | MLGHPLNPR | 0.9712 | 0.6719 | 11 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 326 | HLA-A31:02 | MLGHPLNPR | 0.8598 | 0.794 | 11 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 326 | HLA-A74:11 | VMLGHPLNPR | 0.9926 | 0.7283 | 10 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 326 | HLA-A74:09 | VMLGHPLNPR | 0.9926 | 0.7283 | 10 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 326 | HLA-A74:03 | VMLGHPLNPR | 0.9926 | 0.7283 | 10 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 326 | HLA-A31:06 | VMLGHPLNPR | 0.989 | 0.6229 | 10 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 326 | HLA-A31:02 | VMLGHPLNPR | 0.9824 | 0.7375 | 10 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 562 | HLA-B07:05 | RPAGGSGGRCL | 0.9999 | 0.6948 | 9 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 562 | HLA-B07:02 | RPAGGSGGRCL | 0.9999 | 0.6781 | 9 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 562 | HLA-B81:01 | RPAGGSGGRCL | 0.6675 | 0.7223 | 9 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 326 | HLA-A31:01 | VMLGHPLNPR | 0.9917 | 0.7111 | 10 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 562 | HLA-B07:12 | RPAGGSGGRCL | 0.9983 | 0.7547 | 9 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 562 | HLA-B07:04 | RPAGGSGGRCL | 0.9866 | 0.6211 | 9 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 562 | HLA-B42:01 | RPAGGSGGRCL | 0.9465 | 0.6969 | 9 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 326 | HLA-A74:01 | MLGHPLNPR | 0.973 | 0.8064 | 11 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 326 | HLA-A74:01 | VMLGHPLNPR | 0.9926 | 0.7283 | 10 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 562 | HLA-B07:22 | RPAGGSGGRCL | 0.9999 | 0.6781 | 9 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 562 | HLA-B07:09 | RPAGGSGGRCL | 0.9999 | 0.6844 | 9 | 20 |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 562 | HLA-B67:01 | RPAGGSGGRCL | 0.7145 | 0.798 | 9 | 20 |
Top |
Potential FusionNeoAntigen Information of DGAT1-TONSL in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of DGAT1-TONSL |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
2958 | GLRRPAGGSGGRCL | DGAT1 | TONSL | chr8 | 145544983 | chr8 | 145662482 | 562 |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
6454 | NWCVVMLGHPLNPR | DGAT1 | TONSL | chr8 | 145544983 | chr8 | 145662482 | 326 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of DGAT1-TONSL |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 2958 | GLRRPAGGSGGRCL | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 2958 | GLRRPAGGSGGRCL | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 2958 | GLRRPAGGSGGRCL | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 2958 | GLRRPAGGSGGRCL | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 2958 | GLRRPAGGSGGRCL | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 2958 | GLRRPAGGSGGRCL | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 2958 | GLRRPAGGSGGRCL | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 2958 | GLRRPAGGSGGRCL | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 2958 | GLRRPAGGSGGRCL | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 2958 | GLRRPAGGSGGRCL | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 2958 | GLRRPAGGSGGRCL | -3.37154 | -4.40684 |
HLA-B14:02 | 3BVN | 6454 | NWCVVMLGHPLNPR | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 6454 | NWCVVMLGHPLNPR | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 6454 | NWCVVMLGHPLNPR | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 6454 | NWCVVMLGHPLNPR | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 6454 | NWCVVMLGHPLNPR | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 6454 | NWCVVMLGHPLNPR | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 6454 | NWCVVMLGHPLNPR | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 6454 | NWCVVMLGHPLNPR | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 6454 | NWCVVMLGHPLNPR | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 6454 | NWCVVMLGHPLNPR | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 6454 | NWCVVMLGHPLNPR | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of DGAT1-TONSL |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 10 | 20 | VMLGHPLNPR | GTGATGCTGGGCCACCCCCTTAACCCTCGG |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 11 | 20 | MLGHPLNPR | ATGCTGGGCCACCCCCTTAACCCTCGG |
DGAT1-TONSL | chr8 | 145544983 | chr8 | 145662482 | 9 | 20 | RPAGGSGGRCL | GTGGTGATGCTGGGCCACCCCCTTAACCCTCGG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of DGAT1-TONSL |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
ESCA | DGAT1-TONSL | chr8 | 145544983 | ENST00000332324 | chr8 | 145662482 | ENST00000409379 | TCGA-2H-A9GN |
ESCA | DGAT1-TONSL | chr8 | 145544983 | ENST00000531896 | chr8 | 145662482 | ENST00000409379 | TCGA-2H-A9GN |
Top |
Potential target of CAR-T therapy development for DGAT1-TONSL |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to DGAT1-TONSL |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to DGAT1-TONSL |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |