Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:DNAJC11-CAMTA1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: DNAJC11-CAMTA1
	FusionPDB ID: 23450
	FusionGDB2.0 ID: 23450
		Hgene	Tgene
	Gene symbol	DNAJC11	CAMTA1
	Gene ID	55735	23261
	Gene name	DnaJ heat shock protein family (Hsp40) member C11	calmodulin binding transcription activator 1
	Synonyms	dJ126A5.1	CANPMR
	Cytomap	1p36.31	1p36.31-p36.23
	Type of gene	protein-coding	protein-coding
	Description	dnaJ homolog subfamily C member 11DnaJ (Hsp40) homolog, subfamily C, member 11novel DnaJ domain-containing protein	calmodulin-binding transcription activator 1
	Modification date	20200327	20200315
	UniProtAcc	Q9NVH1 Main function of 5'-partner protein: FUNCTION: [Isoform 1]: Required for mitochondrial inner membrane organization. Seems to function through its association with the MICOS complex and the mitochondrial outer membrane sorting assembly machinery (SAM) complex. {ECO:0000269\|PubMed:25111180, ECO:0000305}.	Q9Y6Y1 Main function of 5'-partner protein: FUNCTION: Transcriptional activator. May act as a tumor suppressor. {ECO:0000269\|PubMed:11925432, ECO:0000269\|PubMed:15709179}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000294401, ENST00000377577, ENST00000377573, ENST00000349363, ENST00000465508, ENST00000542246,	ENST00000467404, ENST00000473578, ENST00000476163, ENST00000476864, ENST00000557126, ENST00000303635, ENST00000439411,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	5 X 5 X 5=125	21 X 19 X 8=3192
	# samples	5	24
	** MAII score	log2(5/125*10)=-1.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(24/3192*10)=-3.73335434061383 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: DNAJC11 [Title/Abstract] AND CAMTA1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: DNAJC11 [Title/Abstract] AND CAMTA1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	DNAJC11(6761789)-CAMTA1(6880241), # samples:1
Anticipated loss of major functional domain due to fusion event.	DNAJC11-CAMTA1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DNAJC11-CAMTA1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DNAJC11-CAMTA1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DNAJC11-CAMTA1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:6761789/chr1:6880241)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across DNAJC11 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CAMTA1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000377577	DNAJC11	chr1	6761789	-	ENST00000303635	CAMTA1	chr1	6880241	+	8388	196	124	5172	1682
ENST00000377577	DNAJC11	chr1	6761789	-	ENST00000439411	CAMTA1	chr1	6880241	+	5131	196	124	5130	1669
ENST00000294401	DNAJC11	chr1	6761789	-	ENST00000303635	CAMTA1	chr1	6880241	+	8388	196	124	5172	1682
ENST00000294401	DNAJC11	chr1	6761789	-	ENST00000439411	CAMTA1	chr1	6880241	+	5131	196	124	5130	1669

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000377577	ENST00000303635	DNAJC11	chr1	6761789	-	CAMTA1	chr1	6880241	+	0.000368869	0.99963117
ENST00000377577	ENST00000439411	DNAJC11	chr1	6761789	-	CAMTA1	chr1	6880241	+	0.003576219	0.9964238
ENST00000294401	ENST00000303635	DNAJC11	chr1	6761789	-	CAMTA1	chr1	6880241	+	0.000368869	0.99963117
ENST00000294401	ENST00000439411	DNAJC11	chr1	6761789	-	CAMTA1	chr1	6880241	+	0.003576219	0.9964238

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for DNAJC11-CAMTA1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
DNAJC11	chr1	6761789	CAMTA1	chr1	6880241	196	24	NEDYYSLLNVRRESVSQSVFCGTSTY

Top

Potential FusionNeoAntigen Information of DNAJC11-CAMTA1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

DNAJC11-CAMTA1_6761789_6880241.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B41:01	RESVSQSV	0.9867	0.7318	11	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B39:13	RESVSQSV	0.9624	0.9204	11	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B50:01	RESVSQSV	0.9541	0.7585	11	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B44:03	RESVSQSVF	0.9976	0.9374	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B08:01	LLNVRRESV	0.9973	0.7157	6	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B08:09	LLNVRRESV	0.9972	0.73	6	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B27:04	RRESVSQSV	0.9949	0.5875	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B47:01	RESVSQSVF	0.9947	0.609	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B13:01	RESVSQSVF	0.9943	0.9233	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B27:05	RRESVSQSV	0.9902	0.5201	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B39:06	RRESVSQSV	0.9874	0.8052	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B39:01	RRESVSQSV	0.9511	0.7826	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B18:01	RESVSQSVF	0.8738	0.8649	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B15:03	RESVSQSVF	0.4852	0.8292	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B39:13	RESVSQSVF	0.4235	0.9186	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B27:04	RRESVSQSVF	0.9987	0.6738	10	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B27:05	RRESVSQSVF	0.9977	0.7065	10	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B40:06	RESVSQSV	1	0.6968	11	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B39:08	RESVSQSV	0.9883	0.7501	11	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B73:01	RRESVSQSV	0.9783	0.7159	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C07:05	RRESVSQSV	0.9558	0.9177	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B39:12	RRESVSQSV	0.9439	0.7884	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C07:27	RRESVSQSV	0.8733	0.9184	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C07:95	RRESVSQSV	0.8288	0.6018	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C07:13	RRESVSQSV	0.7915	0.8777	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C07:46	RRESVSQSV	0.7319	0.8582	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B27:03	RRESVSQSV	0.6711	0.5543	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B39:08	RESVSQSVF	0.4966	0.724	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C12:16	RRESVSQSV	0.0151	0.9304	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C07:95	RRESVSQSVF	0.9945	0.6082	10	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C07:46	RRESVSQSVF	0.9728	0.8569	10	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B27:03	RRESVSQSVF	0.9367	0.7296	10	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B40:04	RESVSQSV	0.9997	0.7637	11	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B50:04	RESVSQSV	0.9541	0.7585	11	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B50:05	RESVSQSV	0.9541	0.7585	11	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B44:13	RESVSQSVF	0.9976	0.9374	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B44:07	RESVSQSVF	0.9976	0.9374	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B44:26	RESVSQSVF	0.9976	0.9374	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B08:18	LLNVRRESV	0.9973	0.7157	6	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B27:06	RRESVSQSV	0.9966	0.606	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B40:04	RESVSQSVF	0.9956	0.7167	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B27:09	RRESVSQSV	0.9954	0.516	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B27:10	RRESVSQSV	0.9951	0.752	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B18:11	RESVSQSVF	0.9486	0.8365	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B39:31	RRESVSQSV	0.942	0.7795	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B18:08	RESVSQSVF	0.8828	0.8053	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B18:05	RESVSQSVF	0.8738	0.8649	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C07:01	RRESVSQSV	0.86	0.6025	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B15:53	RESVSQSVF	0.8407	0.9072	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C06:08	RRESVSQSV	0.774	0.9862	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B08:12	LLNVRRESV	0.7272	0.8629	6	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B15:54	RESVSQSVF	0.6669	0.8909	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B35:28	RESVSQSVF	0.5684	0.9044	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C07:22	RRESVSQSV	0.5527	0.6337	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C07:04	RRESVSQSV	0.498	0.9135	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C06:06	RRESVSQSV	0.4916	0.985	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B48:02	RESVSQSVF	0.4244	0.886	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B39:02	RESVSQSVF	0.4107	0.9161	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B15:68	RESVSQSVF	0.3836	0.6908	11	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C06:17	RRESVSQSV	0.0993	0.9871	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C06:02	RRESVSQSV	0.0993	0.9871	10	19
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B27:10	RRESVSQSVF	0.9986	0.8367	10	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B27:09	RRESVSQSVF	0.9981	0.6702	10	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B27:08	RRESVSQSVF	0.9979	0.568	10	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B27:06	RRESVSQSVF	0.9976	0.6523	10	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C07:01	RRESVSQSVF	0.9948	0.6145	10	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-C07:22	RRESVSQSVF	0.9893	0.664	10	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B15:54	RRESVSQSVF	0.9302	0.8609	10	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B15:68	RRESVSQSVF	0.9217	0.6819	10	20
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	HLA-B15:53	RRESVSQSVF	0.8479	0.8795	10	20

Top

Potential FusionNeoAntigen Information of DNAJC11-CAMTA1 in HLA II

DNAJC11-CAMTA1_6761789_6880241.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-0486	EDYYSLLNVRRESVS	1	16
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-0486	NEDYYSLLNVRRESV	0	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-0832	NEDYYSLLNVRRESV	0	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-0832	EDYYSLLNVRRESVS	1	16
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1401	YYSLLNVRRESVSQS	3	18
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1401	DYYSLLNVRRESVSQ	2	17
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1426	YYSLLNVRRESVSQS	3	18
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1426	DYYSLLNVRRESVSQ	2	17
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1446	NEDYYSLLNVRRESV	0	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1454	YYSLLNVRRESVSQS	3	18
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1454	DYYSLLNVRRESVSQ	2	17
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1458	YYSLLNVRRESVSQS	3	18
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1458	DYYSLLNVRRESVSQ	2	17
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1460	YYSLLNVRRESVSQS	3	18
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1460	DYYSLLNVRRESVSQ	2	17
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1462	YYSLLNVRRESVSQS	3	18
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1462	DYYSLLNVRRESVSQ	2	17
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1475	YYSLLNVRRESVSQS	3	18
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1486	YYSLLNVRRESVSQS	3	18
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1486	DYYSLLNVRRESVSQ	2	17
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1487	YYSLLNVRRESVSQS	3	18
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1487	DYYSLLNVRRESVSQ	2	17
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1488	YYSLLNVRRESVSQS	3	18
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1488	DYYSLLNVRRESVSQ	2	17
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1490	YYSLLNVRRESVSQS	3	18
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1490	DYYSLLNVRRESVSQ	2	17
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1497	YYSLLNVRRESVSQS	3	18
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1497	DYYSLLNVRRESVSQ	2	17
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1499	YYSLLNVRRESVSQS	3	18
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB1-1499	DYYSLLNVRRESVSQ	2	17
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB5-0101	NEDYYSLLNVRRESV	0	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB5-0102	NEDYYSLLNVRRESV	0	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB5-0102	EDYYSLLNVRRESVS	1	16
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB5-0103	NEDYYSLLNVRRESV	0	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB5-0104	NEDYYSLLNVRRESV	0	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB5-0105	NEDYYSLLNVRRESV	0	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB5-0108N	NEDYYSLLNVRRESV	0	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB5-0108N	EDYYSLLNVRRESVS	1	16
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB5-0111	NEDYYSLLNVRRESV	0	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB5-0113	NEDYYSLLNVRRESV	0	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB5-0114	NEDYYSLLNVRRESV	0	15
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	196	DRB5-0203	NEDYYSLLNVRRESV	0	15

Top

Fusion breakpoint peptide structures of DNAJC11-CAMTA1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5250	LLNVRRESVSQSVF	DNAJC11	CAMTA1	chr1	6761789	chr1	6880241	196

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of DNAJC11-CAMTA1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	5250	LLNVRRESVSQSVF	-7.41917	-8.45447
HLA-B14:02	3BVN	5250	LLNVRRESVSQSVF	-6.57167	-6.68507
HLA-B52:01	3W39	5250	LLNVRRESVSQSVF	-6.03562	-6.14902
HLA-B52:01	3W39	5250	LLNVRRESVSQSVF	-5.32332	-6.35862
HLA-A11:01	4UQ2	5250	LLNVRRESVSQSVF	10000.1	10000
HLA-A24:02	5HGA	5250	LLNVRRESVSQSVF	-7.52142	-7.63482
HLA-A24:02	5HGA	5250	LLNVRRESVSQSVF	-4.83773	-5.87303
HLA-B44:05	3DX8	5250	LLNVRRESVSQSVF	-6.8795	-6.9929
HLA-B44:05	3DX8	5250	LLNVRRESVSQSVF	-3.74318	-4.77848

Top

Vaccine Design for the FusionNeoAntigens of DNAJC11-CAMTA1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	10	19	RRESVSQSV	CGCAGGGAGAGCGTTTCCCAAAGTGTA
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	10	20	RRESVSQSVF	CGCAGGGAGAGCGTTTCCCAAAGTGTATTC
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	11	19	RESVSQSV	AGGGAGAGCGTTTCCCAAAGTGTA
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	11	20	RESVSQSVF	AGGGAGAGCGTTTCCCAAAGTGTATTC
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	6	15	LLNVRRESV	TTGCTGAACGTGCGCAGGGAGAGCGTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	0	15	NEDYYSLLNVRRESV	AATGAAGACTATTACTCGTTGCTGAACGTGCGCAGGGAGAGCGTT
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	1	16	EDYYSLLNVRRESVS	GAAGACTATTACTCGTTGCTGAACGTGCGCAGGGAGAGCGTTTCC
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	2	17	DYYSLLNVRRESVSQ	GACTATTACTCGTTGCTGAACGTGCGCAGGGAGAGCGTTTCCCAA
DNAJC11-CAMTA1	chr1	6761789	chr1	6880241	3	18	YYSLLNVRRESVSQS	TATTACTCGTTGCTGAACGTGCGCAGGGAGAGCGTTTCCCAAAGT

Top

Information of the samples that have these potential fusion neoantigens of DNAJC11-CAMTA1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
GBM	DNAJC11-CAMTA1	chr1	6761789	ENST00000294401	chr1	6880241	ENST00000303635	TCGA-16-1045-01B

Top

Potential target of CAR-T therapy development for DNAJC11-CAMTA1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to DNAJC11-CAMTA1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to DNAJC11-CAMTA1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)