Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:DNM2-NFIX

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: DNM2-NFIX
	FusionPDB ID: 23647
	FusionGDB2.0 ID: 23647
		Hgene	Tgene
	Gene symbol	DNM2	NFIX
	Gene ID	1785	4784
	Gene name	dynamin 2	nuclear factor I X
	Synonyms	CMT2M\|CMTDI1\|CMTDIB\|DI-CMTB\|DYN2\|DYNII\|LCCS5	CTF\|MRSHSS\|NF-I/X\|NF1-X\|NF1A\|SOTOS2
	Cytomap	19p13.2	19p13.13
	Type of gene	protein-coding	protein-coding
	Description	dynamin-2dynamin II	nuclear factor 1 X-typeCCAAT-box-binding transcription factorTGGCA-binding proteinnuclear factor 1/X
	Modification date	20200329	20200329
	UniProtAcc	P50570 Main function of 5'-partner protein: FUNCTION: Microtubule-associated force-producing protein involved in producing microtubule bundles and able to bind and hydrolyze GTP. Plays a role in the regulation of neuron morphology, axon growth and formation of neuronal growth cones (By similarity). Plays an important role in vesicular trafficking processes, in particular endocytosis. Involved in cytokinesis (PubMed:12498685). Regulates maturation of apoptotic cell corpse-containing phagosomes by recruiting PIK3C3 to the phagosome membrane (By similarity). {ECO:0000250\|UniProtKB:P39052, ECO:0000250\|UniProtKB:P39054, ECO:0000269\|PubMed:12498685}.	Q14938 Main function of 5'-partner protein: FUNCTION: Recognizes and binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3' present in viral and cellular promoters and in the origin of replication of adenovirus type 2. These proteins are individually capable of activating transcription and replication.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000314646, ENST00000355667, ENST00000359692, ENST00000389253, ENST00000408974, ENST00000585892, ENST00000591819,	ENST00000588680, ENST00000358552, ENST00000587260, ENST00000588228, ENST00000360105, ENST00000397661, ENST00000585575, ENST00000587760, ENST00000592199,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	36 X 17 X 17=10404	22 X 13 X 10=2860
	# samples	49	26
	** MAII score	log2(49/10404*10)=-4.40821274494042 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(26/2860*10)=-3.4594316186373 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: DNM2 [Title/Abstract] AND NFIX [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: DNM2 [Title/Abstract] AND NFIX [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	DNM2(10870487)-NFIX(13135835), # samples:3 NFIX(13106678)-DNM2(10897240), # samples:3
Anticipated loss of major functional domain due to fusion event.	DNM2-NFIX seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DNM2-NFIX seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DNM2-NFIX seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DNM2-NFIX seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NFIX-DNM2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NFIX-DNM2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DNM2-NFIX seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. DNM2-NFIX seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. DNM2-NFIX seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. DNM2-NFIX seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	DNM2	GO:1903526	negative regulation of membrane tubulation	18388313
Tgene	NFIX	GO:0000122	negative regulation of transcription by RNA polymerase II	19706729
Tgene	NFIX	GO:0045944	positive regulation of transcription by RNA polymerase II	19706729

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:10870487/chr19:13135835)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across DNM2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across NFIX (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000585892	DNM2	chr19	10870487	+	ENST00000397661	NFIX	chr19	13183861	+	2753	399	164	1165	333
ENST00000585892	DNM2	chr19	10870487	+	ENST00000592199	NFIX	chr19	13183861	+	1349	399	164	1348	395
ENST00000585892	DNM2	chr19	10870487	+	ENST00000587760	NFIX	chr19	13183861	+	1310	399	164	1165	333
ENST00000585892	DNM2	chr19	10870487	+	ENST00000585575	NFIX	chr19	13183861	+	1349	399	164	1348	395
ENST00000585892	DNM2	chr19	10870487	+	ENST00000360105	NFIX	chr19	13183861	+	5225	399	164	1042	292
ENST00000585892	DNM2	chr19	10870487	+	ENST00000588228	NFIX	chr19	13183861	+	1455	399	164	1348	394
ENST00000585892	DNM2	chr19	10870487	+	ENST00000587260	NFIX	chr19	13183861	+	1322	399	164	1165	333
ENST00000585892	DNM2	chr19	10870487	+	ENST00000358552	NFIX	chr19	13183861	+	5373	399	164	1225	353
ENST00000314646	DNM2	chr19	10870487	+	ENST00000397661	NFIX	chr19	13183861	+	2753	399	164	1165	333
ENST00000314646	DNM2	chr19	10870487	+	ENST00000592199	NFIX	chr19	13183861	+	1349	399	164	1348	395
ENST00000314646	DNM2	chr19	10870487	+	ENST00000587760	NFIX	chr19	13183861	+	1310	399	164	1165	333
ENST00000314646	DNM2	chr19	10870487	+	ENST00000585575	NFIX	chr19	13183861	+	1349	399	164	1348	395
ENST00000314646	DNM2	chr19	10870487	+	ENST00000360105	NFIX	chr19	13183861	+	5225	399	164	1042	292
ENST00000314646	DNM2	chr19	10870487	+	ENST00000588228	NFIX	chr19	13183861	+	1455	399	164	1348	394
ENST00000314646	DNM2	chr19	10870487	+	ENST00000587260	NFIX	chr19	13183861	+	1322	399	164	1165	333
ENST00000314646	DNM2	chr19	10870487	+	ENST00000358552	NFIX	chr19	13183861	+	5373	399	164	1225	353
ENST00000359692	DNM2	chr19	10870487	+	ENST00000397661	NFIX	chr19	13183861	+	2739	385	150	1151	333
ENST00000359692	DNM2	chr19	10870487	+	ENST00000592199	NFIX	chr19	13183861	+	1335	385	150	1334	394
ENST00000359692	DNM2	chr19	10870487	+	ENST00000587760	NFIX	chr19	13183861	+	1296	385	150	1151	333
ENST00000359692	DNM2	chr19	10870487	+	ENST00000585575	NFIX	chr19	13183861	+	1335	385	150	1334	394
ENST00000359692	DNM2	chr19	10870487	+	ENST00000360105	NFIX	chr19	13183861	+	5211	385	150	1028	292
ENST00000359692	DNM2	chr19	10870487	+	ENST00000588228	NFIX	chr19	13183861	+	1441	385	150	1334	394
ENST00000359692	DNM2	chr19	10870487	+	ENST00000587260	NFIX	chr19	13183861	+	1308	385	150	1151	333
ENST00000359692	DNM2	chr19	10870487	+	ENST00000358552	NFIX	chr19	13183861	+	5359	385	150	1211	353
ENST00000389253	DNM2	chr19	10870487	+	ENST00000397661	NFIX	chr19	13183861	+	2701	347	112	1113	333
ENST00000389253	DNM2	chr19	10870487	+	ENST00000592199	NFIX	chr19	13183861	+	1297	347	112	1296	395
ENST00000389253	DNM2	chr19	10870487	+	ENST00000587760	NFIX	chr19	13183861	+	1258	347	112	1113	333
ENST00000389253	DNM2	chr19	10870487	+	ENST00000585575	NFIX	chr19	13183861	+	1297	347	112	1296	395
ENST00000389253	DNM2	chr19	10870487	+	ENST00000360105	NFIX	chr19	13183861	+	5173	347	112	990	292
ENST00000389253	DNM2	chr19	10870487	+	ENST00000588228	NFIX	chr19	13183861	+	1403	347	112	1296	394
ENST00000389253	DNM2	chr19	10870487	+	ENST00000587260	NFIX	chr19	13183861	+	1270	347	112	1113	333
ENST00000389253	DNM2	chr19	10870487	+	ENST00000358552	NFIX	chr19	13183861	+	5321	347	112	1173	353
ENST00000355667	DNM2	chr19	10870487	+	ENST00000397661	NFIX	chr19	13183861	+	2669	315	80	1081	333
ENST00000355667	DNM2	chr19	10870487	+	ENST00000592199	NFIX	chr19	13183861	+	1265	315	80	1264	395
ENST00000355667	DNM2	chr19	10870487	+	ENST00000587760	NFIX	chr19	13183861	+	1226	315	80	1081	333
ENST00000355667	DNM2	chr19	10870487	+	ENST00000585575	NFIX	chr19	13183861	+	1265	315	80	1264	395
ENST00000355667	DNM2	chr19	10870487	+	ENST00000360105	NFIX	chr19	13183861	+	5141	315	80	958	292
ENST00000355667	DNM2	chr19	10870487	+	ENST00000588228	NFIX	chr19	13183861	+	1371	315	80	1264	394
ENST00000355667	DNM2	chr19	10870487	+	ENST00000587260	NFIX	chr19	13183861	+	1238	315	80	1081	333
ENST00000355667	DNM2	chr19	10870487	+	ENST00000358552	NFIX	chr19	13183861	+	5289	315	80	1141	353
ENST00000408974	DNM2	chr19	10870487	+	ENST00000397661	NFIX	chr19	13183861	+	2624	270	35	1036	333
ENST00000408974	DNM2	chr19	10870487	+	ENST00000592199	NFIX	chr19	13183861	+	1220	270	35	1219	395
ENST00000408974	DNM2	chr19	10870487	+	ENST00000587760	NFIX	chr19	13183861	+	1181	270	35	1036	333
ENST00000408974	DNM2	chr19	10870487	+	ENST00000585575	NFIX	chr19	13183861	+	1220	270	35	1219	395
ENST00000408974	DNM2	chr19	10870487	+	ENST00000360105	NFIX	chr19	13183861	+	5096	270	35	913	292
ENST00000408974	DNM2	chr19	10870487	+	ENST00000588228	NFIX	chr19	13183861	+	1326	270	35	1219	394
ENST00000408974	DNM2	chr19	10870487	+	ENST00000587260	NFIX	chr19	13183861	+	1193	270	35	1036	333
ENST00000408974	DNM2	chr19	10870487	+	ENST00000358552	NFIX	chr19	13183861	+	5244	270	35	1096	353

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000585892	ENST00000397661	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.055643454	0.94435656
ENST00000585892	ENST00000592199	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.041855372	0.9581446
ENST00000585892	ENST00000587760	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.0770331	0.9229669
ENST00000585892	ENST00000585575	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.041855372	0.9581446
ENST00000585892	ENST00000360105	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.017770575	0.9822295
ENST00000585892	ENST00000588228	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.06963636	0.93036366
ENST00000585892	ENST00000587260	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.08487763	0.91512233
ENST00000585892	ENST00000358552	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.011735195	0.9882648
ENST00000314646	ENST00000397661	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.055643454	0.94435656
ENST00000314646	ENST00000592199	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.041855372	0.9581446
ENST00000314646	ENST00000587760	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.0770331	0.9229669
ENST00000314646	ENST00000585575	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.041855372	0.9581446
ENST00000314646	ENST00000360105	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.017770575	0.9822295
ENST00000314646	ENST00000588228	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.06963636	0.93036366
ENST00000314646	ENST00000587260	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.08487763	0.91512233
ENST00000314646	ENST00000358552	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.011735195	0.9882648
ENST00000359692	ENST00000397661	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.053664383	0.94633555
ENST00000359692	ENST00000592199	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.04193242	0.9580676
ENST00000359692	ENST00000587760	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.07815545	0.9218445
ENST00000359692	ENST00000585575	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.04193242	0.9580676
ENST00000359692	ENST00000360105	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.01775239	0.98224765
ENST00000359692	ENST00000588228	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.06899212	0.93100786
ENST00000359692	ENST00000587260	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.08382538	0.9161746
ENST00000359692	ENST00000358552	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.011691192	0.9883088
ENST00000389253	ENST00000397661	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.05283437	0.9471656
ENST00000389253	ENST00000592199	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.036934353	0.9630656
ENST00000389253	ENST00000587760	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.0745046	0.9254954
ENST00000389253	ENST00000585575	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.036934353	0.9630656
ENST00000389253	ENST00000360105	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.017270127	0.9827299
ENST00000389253	ENST00000588228	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.06444267	0.9355573
ENST00000389253	ENST00000587260	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.079362266	0.9206377
ENST00000389253	ENST00000358552	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.011346614	0.98865336
ENST00000355667	ENST00000397661	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.05316248	0.9468375
ENST00000355667	ENST00000592199	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.031525437	0.96847457
ENST00000355667	ENST00000587760	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.0681502	0.93184984
ENST00000355667	ENST00000585575	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.031525437	0.96847457
ENST00000355667	ENST00000360105	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.01699086	0.98300916
ENST00000355667	ENST00000588228	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.05660961	0.9433904
ENST00000355667	ENST00000587260	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.073857136	0.92614293
ENST00000355667	ENST00000358552	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.011198504	0.9888015
ENST00000408974	ENST00000397661	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.05589634	0.9441036
ENST00000408974	ENST00000592199	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.033491045	0.966509
ENST00000408974	ENST00000587760	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.07393424	0.92606574
ENST00000408974	ENST00000585575	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.033491045	0.966509
ENST00000408974	ENST00000360105	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.017789235	0.9822107
ENST00000408974	ENST00000588228	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.058884118	0.94111586
ENST00000408974	ENST00000587260	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.0788079	0.92119205
ENST00000408974	ENST00000358552	DNM2	chr19	10870487	+	NFIX	chr19	13183861	+	0.011543852	0.98845613

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for DNM2-NFIX

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
DNM2	chr19	10870487	NFIX	chr19	13183861	270	78	RRPLILQLIFSKTESGQSDSSNQQGD
DNM2	chr19	10870487	NFIX	chr19	13183861	315	78	RRPLILQLIFSKTESGQSDSSNQQGD
DNM2	chr19	10870487	NFIX	chr19	13183861	347	78	RRPLILQLIFSKTESGQSDSSNQQGD
DNM2	chr19	10870487	NFIX	chr19	13183861	385	78	RRPLILQLIFSKTESGQSDSSNQQGD
DNM2	chr19	10870487	NFIX	chr19	13183861	399	78	RRPLILQLIFSKTESGQSDSSNQQGD

Top

Potential FusionNeoAntigen Information of DNM2-NFIX in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA I

FusionNeoAntigen peptide

Binding score

Immunogenic score

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Potential FusionNeoAntigen Information of DNM2-NFIX in HLA II

DNM2-NFIX_10870487_13183861.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0403	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0413	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0415	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0427	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0436	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0439	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0441	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0444	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0446	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0449	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0450	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0451	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0452	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0460	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0471	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0478	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0479	ILQLIFSKTESGQSD	4	19
DNM2-NFIX	chr19	10870487	chr19	13183861	399	DRB1-0485	ILQLIFSKTESGQSD	4	19

Top

Fusion breakpoint peptide structures of DNM2-NFIX

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of DNM2-NFIX

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele

PDB ID

File name

BPseq

Docking score

Glide score

Top

Vaccine Design for the FusionNeoAntigens of DNM2-NFIX

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide sequence

FusionNeoAntigen RNA sequence

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
DNM2-NFIX	chr19	10870487	chr19	13183861	4	19	ILQLIFSKTESGQSD	TTCTGCAGCTCATCTTCTCAAAAACAGAATCCGGACAATCAGATA

Top

Information of the samples that have these potential fusion neoantigens of DNM2-NFIX

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type

Fusion gene

Hchr

Hbp

Henst

Tchr

Tbp

Tenst

Sample

Top

Potential target of CAR-T therapy development for DNM2-NFIX

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to DNM2-NFIX

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to DNM2-NFIX

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)